Starting /dee2/code/volunteer_pipeline.sh SRR7170642 current disk space = 3090259906560 free memory = 1575400452 SRR7170642 SRAfilesize 58725c51ca4b2d677fc9714d09b0fddd SRR7170642.sra SRR7170642.sra file validated SRR7170642 is paired end SRR7170642 is conventional basespace SRR7170642 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170642_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.9085 31.0 18.0 33.0 18.0 33.0 2 27.473 29.0 25.0 31.0 18.0 33.0 3 30.587 31.0 29.0 33.0 27.0 33.0 4 32.05225 33.0 31.0 33.0 30.0 33.0 5 32.5265 33.0 33.0 33.0 32.0 34.0 6 36.6515 38.0 37.0 38.0 34.0 38.0 7 36.971 38.0 38.0 38.0 35.0 38.0 8 37.22975 38.0 38.0 38.0 36.0 38.0 9 37.3945 38.0 38.0 38.0 37.0 38.0 10-14 37.402 38.0 38.0 38.0 36.8 38.0 15-19 37.42014999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.50995 38.0 38.0 38.0 37.4 38.0 25-29 37.518600000000006 38.0 38.0 38.0 37.4 38.0 30-34 37.5153 38.0 38.0 38.0 37.2 38.0 35-39 37.501999999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.427949999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.43235 38.0 38.0 38.0 37.0 38.0 50-54 37.33425 38.0 38.0 38.0 37.0 38.0 55-59 37.23795 38.0 38.0 38.0 36.2 38.0 60-64 37.220749999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.178399999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.017399999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.8738 38.0 38.0 38.0 35.2 38.0 80-84 36.8827 38.0 38.0 38.0 35.2 38.0 85-89 36.78485 38.0 38.0 38.0 35.0 38.0 90-94 36.5302 38.0 38.0 38.0 34.0 38.0 95-99 36.422900000000006 38.0 37.6 38.0 33.8 38.0 100-104 36.29285 38.0 37.0 38.0 33.8 38.0 105-109 36.1712 38.0 37.0 38.0 33.4 38.0 110-114 36.02325 38.0 37.0 38.0 32.8 38.0 115-119 35.7813 38.0 36.2 38.0 31.0 38.0 120-124 35.5094 38.0 36.0 38.0 30.6 38.0 125-129 35.3395 38.0 35.8 38.0 29.6 38.0 130-134 35.01335 38.0 35.0 38.0 27.8 38.0 135-139 34.7587 38.0 34.8 38.0 28.0 38.0 140-144 34.25945 38.0 34.6 38.0 25.4 38.0 145-149 33.38055 38.0 33.0 38.0 21.0 38.0 150-151 28.504125000000002 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 4.0 20 2.0 21 2.0 22 7.0 23 4.0 24 11.0 25 11.0 26 13.0 27 13.0 28 25.0 29 22.0 30 47.0 31 58.0 32 72.0 33 115.0 34 219.0 35 366.0 36 1013.0 37 1993.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.51172273190622 18.603465851172274 10.575942915392456 37.308868501529055 2 17.1 25.7 38.15 19.05 3 15.675 30.525000000000002 28.000000000000004 25.8 4 21.099999999999998 36.925000000000004 22.2 19.775000000000002 5 20.01005530417295 38.3107088989442 24.409250879839114 17.26998491704374 6 17.05 35.525 24.525 22.900000000000002 7 12.525 19.650000000000002 45.725 22.1 8 17.724999999999998 20.925 28.475 32.875 9 17.474999999999998 20.375 30.975 31.175000000000004 10-14 19.139999999999997 29.4 26.8 24.66 15-19 19.24 27.925 28.28 24.555 20-24 19.85 29.285 27.384999999999998 23.48 25-29 19.91 28.744999999999997 27.815 23.53 30-34 20.39 28.825 27.474999999999998 23.31 35-39 19.86 29.099999999999998 27.375 23.665 40-44 20.13 28.860000000000003 27.605 23.405 45-49 20.0 28.665000000000003 27.22 24.115000000000002 50-54 20.3 28.384999999999998 28.09 23.225 55-59 20.365 28.24 27.845 23.549999999999997 60-64 20.28 28.660000000000004 27.529999999999998 23.53 65-69 20.055 28.675 27.82 23.45 70-74 20.115 28.54 27.905 23.44 75-79 20.05 28.4 27.905 23.645 80-84 20.18 28.294999999999998 27.665 23.86 85-89 20.305 28.32 27.894999999999996 23.48 90-94 20.445 28.12 27.63 23.805 95-99 20.18 28.54 27.61 23.669999999999998 100-104 20.195 28.465 27.779999999999998 23.56 105-109 20.76 28.384999999999998 27.46 23.395 110-114 20.69 28.349999999999998 27.794999999999998 23.165 115-119 20.64 28.705000000000002 27.245 23.41 120-124 20.285 28.365000000000002 27.87 23.48 125-129 20.549999999999997 28.34 27.505000000000003 23.605 130-134 21.26 28.24 27.694999999999997 22.805 135-139 20.605 28.4 27.405 23.59 140-144 20.080000000000002 28.125 27.73 24.065 145-149 20.635 28.51 28.01 22.845 150-151 20.825515947467167 28.230143839899934 26.866791744840523 24.07754846779237 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 2.5 21 3.5 22 4.0 23 3.5 24 4.0 25 4.0 26 4.0 27 8.5 28 11.5 29 11.5 30 18.0 31 29.5 32 36.5 33 42.5 34 54.5 35 77.0 36 103.5 37 126.5 38 145.0 39 159.5 40 187.0 41 213.0 42 223.0 43 251.0 44 279.0 45 263.0 46 255.0 47 248.0 48 226.5 49 216.0 50 177.0 51 138.5 52 120.5 53 93.0 54 68.5 55 50.0 56 35.5 57 27.0 58 21.0 59 15.0 60 12.0 61 10.0 62 6.5 63 4.5 64 2.0 65 0.5 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.5499999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34426229508196 98.475 2 0.5548549810844893 1.0999999999999999 3 0.025220680958385876 0.075 4 0.025220680958385876 0.1 5 0.05044136191677175 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 5 0.125 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.3875000000000002 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 2.0250000000000004 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170642 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170642_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81125 33.0 33.0 34.0 32.0 34.0 2 32.9475 33.0 33.0 34.0 32.0 34.0 3 33.01775 34.0 33.0 34.0 32.0 34.0 4 32.8825 34.0 33.0 34.0 32.0 34.0 5 32.91475 34.0 33.0 34.0 32.0 34.0 6 37.024 38.0 38.0 38.0 36.0 38.0 7 37.158 38.0 38.0 38.0 37.0 38.0 8 37.14625 38.0 38.0 38.0 37.0 38.0 9 37.116 38.0 38.0 38.0 37.0 38.0 10-14 37.191250000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.158100000000005 38.0 38.0 38.0 36.8 38.0 20-24 37.1084 38.0 38.0 38.0 36.8 38.0 25-29 37.11105 38.0 38.0 38.0 36.8 38.0 30-34 37.09354999999999 38.0 38.0 38.0 36.6 38.0 35-39 37.13695 38.0 38.0 38.0 36.8 38.0 40-44 37.06885 38.0 38.0 38.0 36.6 38.0 45-49 37.0843 38.0 38.0 38.0 36.2 38.0 50-54 36.99065 38.0 38.0 38.0 36.0 38.0 55-59 36.8513 38.0 38.0 38.0 36.0 38.0 60-64 36.879749999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.8486 38.0 38.0 38.0 36.0 38.0 70-74 36.77265 38.0 38.0 38.0 35.6 38.0 75-79 36.766749999999995 38.0 38.0 38.0 35.4 38.0 80-84 36.619550000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.5312 38.0 38.0 38.0 34.6 38.0 90-94 36.42100000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.310050000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.22945 38.0 38.0 38.0 34.0 38.0 105-109 36.099450000000004 38.0 38.0 38.0 33.8 38.0 110-114 35.905950000000004 38.0 37.2 38.0 32.8 38.0 115-119 35.6262 38.0 37.0 38.0 31.0 38.0 120-124 35.68265 38.0 36.8 38.0 32.0 38.0 125-129 35.282399999999996 38.0 36.0 38.0 30.2 38.0 130-134 34.91375000000001 38.0 36.0 38.0 28.0 38.0 135-139 34.44584999999999 38.0 34.2 38.0 27.2 38.0 140-144 33.92105 38.0 33.2 38.0 23.6 38.0 145-149 33.0335 38.0 33.0 38.0 17.6 38.0 150-151 27.731375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 4.0 5 0.0 6 1.0 7 1.0 8 3.0 9 2.0 10 2.0 11 1.0 12 1.0 13 1.0 14 3.0 15 3.0 16 3.0 17 0.0 18 6.0 19 9.0 20 10.0 21 5.0 22 10.0 23 14.0 24 13.0 25 10.0 26 24.0 27 13.0 28 34.0 29 38.0 30 40.0 31 52.0 32 76.0 33 100.0 34 144.0 35 291.0 36 660.0 37 2424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.550000000000004 14.899999999999999 14.35 32.2 2 22.650000000000002 23.95 36.449999999999996 16.950000000000003 3 18.95 25.900000000000002 33.85 21.3 4 22.05 36.4 22.475 19.075 5 21.725 40.6 21.075 16.6 6 17.95 38.2 24.224999999999998 19.625 7 16.25 15.049999999999999 46.525 22.175 8 18.725 22.75 28.1 30.425 9 23.150000000000002 22.825 28.925 25.1 10-14 22.255 28.53 27.575 21.64 15-19 22.365 27.49 29.244999999999997 20.9 20-24 22.919999999999998 27.445000000000004 28.645 20.990000000000002 25-29 22.56 28.725 27.944999999999997 20.77 30-34 21.990000000000002 28.655 28.21 21.145 35-39 22.915 28.485 27.54 21.060000000000002 40-44 22.395 27.865000000000002 28.360000000000003 21.38 45-49 22.875 28.29 27.815 21.02 50-54 23.05 27.735 27.694999999999997 21.52 55-59 22.495 27.52 28.105000000000004 21.88 60-64 22.645 27.37 28.12 21.865000000000002 65-69 23.244999999999997 27.77 28.105000000000004 20.880000000000003 70-74 23.46 28.055000000000003 27.605 20.880000000000003 75-79 23.3 28.17 27.855 20.674999999999997 80-84 22.895 27.534999999999997 28.084999999999997 21.485000000000003 85-89 23.025000000000002 28.065 27.72 21.19 90-94 22.97 27.944999999999997 28.000000000000004 21.085 95-99 23.02 27.67 28.435 20.875 100-104 23.28 27.905 27.975 20.84 105-109 23.76 27.295 28.315 20.630000000000003 110-114 22.955000000000002 28.04 28.349999999999998 20.655 115-119 23.13 27.675 28.735 20.46 120-124 23.255 27.860000000000003 27.639999999999997 21.245 125-129 23.125 28.22 27.76 20.895 130-134 23.465 28.115000000000002 27.965 20.455000000000002 135-139 23.76 28.34 27.450000000000003 20.45 140-144 24.255 27.71 27.61 20.424999999999997 145-149 24.08 27.88 27.51 20.53 150-151 24.075 27.462500000000002 27.6375 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 1.5 24 4.0 25 4.5 26 5.5 27 7.0 28 13.5 29 18.0 30 16.5 31 22.0 32 30.0 33 40.0 34 49.0 35 66.5 36 88.5 37 112.0 38 149.0 39 172.0 40 178.5 41 205.0 42 234.5 43 251.5 44 267.5 45 288.5 46 288.5 47 257.0 48 223.0 49 189.5 50 158.5 51 134.0 52 116.5 53 99.5 54 78.5 55 58.0 56 43.0 57 35.5 58 26.5 59 16.0 60 13.0 61 10.5 62 7.0 63 5.0 64 3.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98605830164765 97.625 2 0.7858048162230671 1.55 3 0.1520912547528517 0.44999999999999996 4 0.025348542458808618 0.1 5 0.025348542458808618 0.125 6 0.025348542458808618 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.2125 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCAG 10 0.006830828 145.0 5 >>END_MODULE Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918342 spots for SRR7170642.sra Written 918342 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra Read 918333 spots for SRR7170642.sra Written 918333 spots for SRR7170642.sra SRR ids: ['SRR7170642.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xhedprco SRR7170642.sra spots: 18366669 blocks: [[1, 918333], [918334, 1836666], [1836667, 2754999], [2755000, 3673332], [3673333, 4591665], [4591666, 5509998], [5509999, 6428331], [6428332, 7346664], [7346665, 8264997], [8264998, 9183330], [9183331, 10101663], [10101664, 11019996], [11019997, 11938329], [11938330, 12856662], [12856663, 13774995], [13774996, 14693328], [14693329, 15611661], [15611662, 16529994], [16529995, 17448327], [17448328, 18366669]] SRR7170642 file size 6202161 SRR7170642 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170642 SRR7170642_1.fastq SRR7170642_2.fastq Input file: SRR7170642_1.fastq Paired file: SRR7170642_2.fastq trimmed: SRR7170642-trimmed-pair1.fastq, SRR7170642-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:59:42 2025 >> started Thu Feb 13 14:00:03 2025 >> done (21.076s) 18366669 read pairs processed; of these: 9166 ( 0.05%) short read pairs filtered out after trimming by size control 30090 ( 0.16%) empty read pairs filtered out after trimming by size control 18327413 (99.79%) read pairs available; of these: 9161959 (49.99%) trimmed read pairs available after processing 9165454 (50.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 5 0.00% 21 4 0.00% 22 6 0.00% 23 9 0.00% 24 7 0.00% 25 13 0.00% 26 6 0.00% 27 10 0.00% 28 9 0.00% 29 5 0.00% 30 8 0.00% 31 29 0.00% 32 8 0.00% 33 13 0.00% 34 13 0.00% 35 12 0.00% 36 10 0.00% 37 19 0.00% 38 20 0.00% 39 13 0.00% 40 21 0.00% 41 20 0.00% 42 24 0.00% 43 22 0.00% 44 33 0.00% 45 45 0.00% 46 47 0.00% 47 44 0.00% 48 54 0.00% 49 60 0.00% 50 69 0.00% 51 71 0.00% 52 102 0.00% 53 118 0.00% 54 104 0.00% 55 87 0.00% 56 129 0.00% 57 135 0.00% 58 154 0.00% 59 162 0.00% 60 162 0.00% 61 210 0.00% 62 238 0.00% 63 290 0.00% 64 280 0.00% 65 325 0.00% 66 314 0.00% 67 366 0.00% 68 413 0.00% 69 468 0.00% 70 552 0.00% 71 606 0.00% 72 762 0.00% 73 802 0.00% 74 918 0.01% 75 1010 0.01% 76 1152 0.01% 77 1317 0.01% 78 1353 0.01% 79 1575 0.01% 80 1639 0.01% 81 1831 0.01% 82 2120 0.01% 83 2431 0.01% 84 3176 0.02% 85 3707 0.02% 86 3989 0.02% 87 4398 0.02% 88 4405 0.02% 89 4838 0.03% 90 5157 0.03% 91 5563 0.03% 92 5905 0.03% 93 6229 0.03% 94 6702 0.04% 95 7268 0.04% 96 7648 0.04% 97 7982 0.04% 98 8458 0.05% 99 8863 0.05% 100 9236 0.05% 101 9904 0.05% 102 10450 0.06% 103 10951 0.06% 104 11552 0.06% 105 12389 0.07% 106 12848 0.07% 107 13429 0.07% 108 13922 0.08% 109 14472 0.08% 110 15272 0.08% 111 15810 0.09% 112 16531 0.09% 113 17339 0.09% 114 18152 0.10% 115 18910 0.10% 116 19608 0.11% 117 20422 0.11% 118 21023 0.11% 119 21634 0.12% 120 22525 0.12% 121 23726 0.13% 122 24641 0.13% 123 26373 0.14% 124 27417 0.15% 125 28370 0.15% 126 29586 0.16% 127 31432 0.17% 128 33027 0.18% 129 34768 0.19% 130 36249 0.20% 131 37992 0.21% 132 41020 0.22% 133 43930 0.24% 134 47256 0.26% 135 51041 0.28% 136 55447 0.30% 137 60952 0.33% 138 66373 0.36% 139 73871 0.40% 140 82914 0.45% 141 93819 0.51% 142 107970 0.59% 143 128908 0.70% 144 153955 0.84% 145 189708 1.04% 146 246355 1.34% 147 344075 1.88% 148 545275 2.98% 149 1103386 6.02% 150 4948586 27.00% 151 9165454 50.01% 18327413 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=18 prefix-density=0.58 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=34.00 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.1 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=8 prefix-density=0.77 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=30.52 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170642 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:00:43 Started mapping on | Feb 13 14:00:43 Finished on | Feb 13 14:02:37 Mapping speed, Million of reads per hour | 578.76 Number of input reads | 18327413 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17303009 Uniquely mapped reads % | 94.41% Average mapped length | 295.71 Number of splices: Total | 17449306 Number of splices: Annotated (sjdb) | 17056051 Number of splices: GT/AG | 17115281 Number of splices: GC/AG | 272641 Number of splices: AT/AC | 10670 Number of splices: Non-canonical | 50714 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454514 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 49194 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 581862 581862 581862 N_multimapping 454514 454514 454514 N_noFeature 701573 16974570 807724 N_ambiguous 340334 1028 117454 UnstrandedReadsAssigned:16261102 PositiveStrandReadsAssigned:327411 NegativeStrandReadsAssigned:16377831 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170642 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170642-trimmed-pair1.fastq SRR7170642-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,327,413 reads, 16,265,829 reads pseudoaligned [quant] estimated average fragment length: 291.682 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7170642.ke.tsv 34699 SRR7170642.se.tsv 87100 total ==> SRR7170642.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.32 861 26.3304 Potri.005G024800.1.v4.1 1035 744.318 88 6.24526 Potri.004G059700.1.v4.1 961 670.421 22 1.73341 Potri.007G009000.2.v4.1 1416 1125.32 0 0 Potri.003G141000.2.v4.1 2943 2652.32 1052.97 20.9709 Potri.016G087400.1.v4.1 270 69.5235 745 566.045 Potri.015G069301.1.v4.1 564 285.653 0 0 Potri.010G195200.1.v4.1 1773 1482.32 21 0.748349 Potri.012G127500.1.v4.1 977 686.356 117 9.00456 ==> SRR7170642.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1320 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 26 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 132 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 2 SRR7170642 completed mapping pipeline successfully