Starting /dee2/code/volunteer_pipeline.sh SRR7170643 current disk space = 3089448210432 free memory = 1574407148 SRR7170643 SRAfilesize 23a1d48c9600e392780532eee4ee4dec SRR7170643.sra SRR7170643.sra file validated SRR7170643 is paired end SRR7170643 is conventional basespace SRR7170643 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170643_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.30225 18.0 18.0 30.0 18.0 33.0 2 30.88275 31.0 30.0 33.0 27.0 33.0 3 31.69 33.0 31.0 33.0 29.0 33.0 4 32.0575 33.0 33.0 33.0 31.0 34.0 5 32.909 33.0 33.0 34.0 32.0 34.0 6 37.11575 38.0 38.0 38.0 36.0 38.0 7 37.255 38.0 38.0 38.0 36.0 38.0 8 37.31225 38.0 38.0 38.0 37.0 38.0 9 37.3045 38.0 38.0 38.0 37.0 38.0 10-14 37.35979999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.423350000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.45105 38.0 38.0 38.0 37.4 38.0 25-29 37.41665 38.0 38.0 38.0 37.4 38.0 30-34 37.363299999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.3267 38.0 38.0 38.0 37.0 38.0 40-44 37.25945 38.0 38.0 38.0 37.0 38.0 45-49 37.256099999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.1206 38.0 38.0 38.0 36.2 38.0 55-59 37.0881 38.0 38.0 38.0 36.2 38.0 60-64 36.95805 38.0 38.0 38.0 36.0 38.0 65-69 36.96719999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.91735 38.0 38.0 38.0 36.0 38.0 75-79 36.56325 38.0 38.0 38.0 35.2 38.0 80-84 36.37865 38.0 38.0 38.0 34.6 38.0 85-89 36.3689 38.0 38.0 38.0 34.8 38.0 90-94 36.141949999999994 38.0 38.0 38.0 34.0 38.0 95-99 35.9311 38.0 38.0 38.0 33.4 38.0 100-104 35.84715 38.0 37.4 38.0 33.4 38.0 105-109 35.76205 38.0 37.0 38.0 33.0 38.0 110-114 35.6209 38.0 37.0 38.0 32.0 38.0 115-119 35.334950000000006 38.0 36.6 38.0 30.2 38.0 120-124 35.253750000000004 38.0 36.0 38.0 30.6 38.0 125-129 35.16215 38.0 36.0 38.0 30.2 38.0 130-134 34.85085 38.0 36.0 38.0 28.0 38.0 135-139 34.67745 38.0 35.8 38.0 27.4 38.0 140-144 34.075900000000004 38.0 34.2 38.0 24.6 38.0 145-149 33.322199999999995 38.0 33.2 38.0 20.2 38.0 150-151 29.391875000000002 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 2.0 13 2.0 14 5.0 15 2.0 16 8.0 17 1.0 18 8.0 19 33.0 20 5.0 21 10.0 22 5.0 23 6.0 24 6.0 25 8.0 26 16.0 27 13.0 28 25.0 29 34.0 30 48.0 31 54.0 32 70.0 33 89.0 34 163.0 35 305.0 36 740.0 37 2334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.444051528163676 17.504420308158625 17.201313462995707 26.850214700681992 2 19.675 25.124999999999996 34.675 20.525 3 15.425 32.5 31.424999999999997 20.65 4 19.75 34.300000000000004 25.35 20.599999999999998 5 21.523427712352795 35.73039338511651 23.352543222250063 19.39363568028063 6 17.2 36.4 24.8 21.6 7 12.825000000000001 22.375 43.875 20.925 8 16.45 22.75 27.725 33.074999999999996 9 18.125 23.724999999999998 30.55 27.6 10-14 18.555 30.885 26.085 24.474999999999998 15-19 19.275000000000002 29.74 27.400000000000002 23.585 20-24 19.265 29.885 27.73 23.119999999999997 25-29 19.835 29.270000000000003 27.029999999999998 23.865 30-34 19.535 29.37 27.11 23.985 35-39 19.650000000000002 29.085 27.38 23.885 40-44 19.57 29.585 27.534999999999997 23.31 45-49 19.400000000000002 29.69 27.644999999999996 23.265 50-54 20.095 28.57 27.534999999999997 23.799999999999997 55-59 19.605 29.160000000000004 27.474999999999998 23.76 60-64 20.21 28.515 27.865000000000002 23.41 65-69 19.54 29.799999999999997 27.435 23.225 70-74 19.98 30.255 26.840000000000003 22.925 75-79 19.525000000000002 29.74 26.82 23.915 80-84 20.04 28.895 27.185 23.880000000000003 85-89 20.064999999999998 28.660000000000004 27.49 23.785 90-94 20.235 28.970000000000002 27.055 23.74 95-99 20.32 28.84 26.889999999999997 23.95 100-104 19.950000000000003 28.470000000000002 28.01 23.57 105-109 20.244999999999997 28.884999999999998 27.405 23.465 110-114 20.51 28.54 26.545 24.404999999999998 115-119 20.515 29.575000000000003 26.27 23.64 120-124 20.575 28.82 26.365 24.240000000000002 125-129 20.62 28.860000000000003 26.724999999999998 23.794999999999998 130-134 20.674999999999997 28.115000000000002 27.095000000000002 24.115000000000002 135-139 20.485 28.24 26.39 24.884999999999998 140-144 20.04 28.384999999999998 26.645000000000003 24.93 145-149 20.724999999999998 28.42 26.21 24.645 150-151 20.89066800100075 27.77082812109082 25.50662997247936 25.83187390542907 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 2.0 3 2.0 4 1.0 5 1.5 6 1.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 1.5 17 1.5 18 0.5 19 1.5 20 1.5 21 2.0 22 4.0 23 4.0 24 5.5 25 7.5 26 8.0 27 15.5 28 21.0 29 23.0 30 31.0 31 40.5 32 45.5 33 64.5 34 90.5 35 102.5 36 116.5 37 143.5 38 156.5 39 157.5 40 180.5 41 203.0 42 209.5 43 219.5 44 212.5 45 205.0 46 209.5 47 206.0 48 222.0 49 210.5 50 158.0 51 129.5 52 113.0 53 100.0 54 97.0 55 76.0 56 51.5 57 39.0 58 28.5 59 23.0 60 15.5 61 13.0 62 11.0 63 3.0 64 1.0 65 1.0 66 0.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.79579810402255 96.39999999999999 2 1.0504739943633103 2.0500000000000003 3 0.10248526774276198 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025621316935690495 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025621316935690495 1.075 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 43 1.075 TruSeq Adapter, Index 2 (97% over 37bp) CGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.7375 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.7249999999999996 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.4375 0.0 0.0 0.0 0.0 126-127 4.8 0.0 0.0 0.0 0.0 128-129 5.2875 0.0 0.0 0.0 0.0 130-131 5.575 0.0 0.0 0.0 0.0 132-133 5.975 0.0 0.0 0.0 0.0 134-135 6.4625 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGCC 10 0.006830828 145.0 6 AGAATCT 10 0.006830828 145.0 3 TCTGCCC 10 0.006830828 145.0 7 TCTCCTT 10 0.006830828 145.0 1 CAGTGAG 10 0.006830828 145.0 9 AAAAAAA 225 1.6083504E-7 9.666667 65-69 >>END_MODULE SRR7170643 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170643_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.656 33.0 33.0 34.0 32.0 34.0 2 32.74025 33.0 33.0 34.0 32.0 34.0 3 32.836 34.0 33.0 34.0 32.0 34.0 4 32.63425 34.0 33.0 34.0 32.0 34.0 5 32.64025 34.0 33.0 34.0 32.0 34.0 6 36.77575 38.0 38.0 38.0 36.0 38.0 7 36.763 38.0 38.0 38.0 36.0 38.0 8 36.76775 38.0 38.0 38.0 36.0 38.0 9 36.737 38.0 38.0 38.0 36.0 38.0 10-14 36.75755 38.0 38.0 38.0 36.0 38.0 15-19 36.6577 38.0 38.0 38.0 35.8 38.0 20-24 36.61515 38.0 38.0 38.0 36.0 38.0 25-29 36.64765 38.0 38.0 38.0 36.0 38.0 30-34 36.5531 38.0 38.0 38.0 35.8 38.0 35-39 36.612100000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.596700000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.51945 38.0 38.0 38.0 35.6 38.0 50-54 36.476299999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.4078 38.0 38.0 38.0 35.0 38.0 60-64 36.37365 38.0 38.0 38.0 35.4 38.0 65-69 36.405649999999994 38.0 38.0 38.0 35.4 38.0 70-74 36.4049 38.0 38.0 38.0 35.4 38.0 75-79 36.329449999999994 38.0 38.0 38.0 35.0 38.0 80-84 35.9808 38.0 38.0 38.0 34.0 38.0 85-89 35.9033 38.0 38.0 38.0 34.0 38.0 90-94 35.81825 38.0 38.0 38.0 33.8 38.0 95-99 35.72885 38.0 38.0 38.0 33.6 38.0 100-104 35.4673 38.0 38.0 38.0 32.0 38.0 105-109 35.45675000000001 38.0 38.0 38.0 32.4 38.0 110-114 35.24335000000001 38.0 37.2 38.0 31.0 38.0 115-119 35.033100000000005 38.0 37.0 38.0 28.8 38.0 120-124 35.020050000000005 38.0 37.0 38.0 29.2 38.0 125-129 34.67865 38.0 36.2 38.0 28.0 38.0 130-134 34.22745 38.0 36.0 38.0 24.6 38.0 135-139 33.9381 38.0 35.2 38.0 22.2 38.0 140-144 33.40585 38.0 33.6 38.0 18.4 38.0 145-149 32.6905 38.0 33.2 38.0 10.6 38.0 150-151 27.483 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 13.0 4 15.0 5 2.0 6 3.0 7 4.0 8 1.0 9 4.0 10 2.0 11 3.0 12 2.0 13 4.0 14 6.0 15 14.0 16 4.0 17 5.0 18 9.0 19 28.0 20 18.0 21 6.0 22 12.0 23 6.0 24 24.0 25 19.0 26 15.0 27 18.0 28 27.0 29 29.0 30 23.0 31 46.0 32 58.0 33 105.0 34 135.0 35 203.0 36 550.0 37 2570.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.974999999999994 18.025 15.024999999999999 22.975 2 26.200000000000003 23.799999999999997 30.575000000000003 19.425 3 21.55 26.525 31.874999999999996 20.05 4 24.675 34.699999999999996 20.95 19.675 5 24.275 36.775000000000006 21.175 17.775 6 20.424999999999997 35.475 23.625 20.474999999999998 7 18.675 17.724999999999998 41.825 21.775 8 20.349999999999998 23.05 26.474999999999998 30.125 9 22.725 23.325000000000003 28.050000000000004 25.900000000000002 10-14 23.369999999999997 28.205000000000002 26.435 21.990000000000002 15-19 24.51 27.284999999999997 27.839999999999996 20.365 20-24 24.055 28.265 27.195000000000004 20.485 25-29 23.595 28.115000000000002 27.279999999999998 21.01 30-34 24.025 27.63 27.689999999999998 20.655 35-39 24.15 28.035 27.145000000000003 20.669999999999998 40-44 23.895 28.52 26.884999999999998 20.7 45-49 23.29 27.73 27.825 21.154999999999998 50-54 24.2 27.57 27.325 20.905 55-59 24.635 26.51 28.13 20.724999999999998 60-64 24.03 27.395000000000003 27.560000000000002 21.015 65-69 23.395 27.250000000000004 28.27 21.085 70-74 23.575 28.465 27.365000000000002 20.595 75-79 23.735 28.415000000000003 27.07 20.78 80-84 23.66 27.685 27.96 20.695 85-89 23.185 28.115000000000002 27.595 21.105 90-94 23.195 27.85 27.965 20.990000000000002 95-99 24.13 27.605 27.439999999999998 20.825 100-104 24.415 27.93 27.544999999999998 20.11 105-109 24.625 27.525 27.73 20.119999999999997 110-114 24.08 27.755000000000003 27.875 20.29 115-119 24.38 28.105000000000004 27.61 19.905 120-124 24.23 28.355000000000004 27.779999999999998 19.634999999999998 125-129 24.310000000000002 27.860000000000003 27.389999999999997 20.44 130-134 24.98 27.765 27.450000000000003 19.805 135-139 25.025 27.644999999999996 27.305 20.025000000000002 140-144 25.195 27.355 28.439999999999998 19.009999999999998 145-149 25.86 28.185 27.01 18.945 150-151 26.578322290286287 27.55344418052256 26.753344168021005 19.114889361170146 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 2.5 21 2.5 22 3.5 23 3.5 24 1.5 25 3.0 26 8.5 27 9.5 28 9.5 29 16.5 30 19.0 31 20.0 32 24.5 33 32.0 34 40.5 35 52.0 36 69.0 37 97.5 38 127.5 39 156.0 40 172.5 41 183.0 42 211.0 43 232.5 44 245.5 45 278.0 46 263.5 47 230.5 48 228.5 49 216.5 50 199.0 51 149.5 52 126.0 53 129.5 54 100.5 55 76.0 56 69.0 57 52.5 58 32.5 59 27.5 60 25.0 61 16.5 62 9.5 63 5.0 64 4.0 65 3.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55892949047865 95.75 2 1.1837364899639733 2.3 3 0.1029336078229542 0.3 4 0.0514668039114771 0.2 5 0.02573340195573855 0.125 6 0.0514668039114771 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02573340195573855 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 41 1.0250000000000001 Illumina Single End PCR Primer 1 (97% over 34bp) GGCAGTCAGAGGCGATGAAGGACGTGCTAATCTGCGATAAGCGTCGGTAA 6 0.15 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.6500000000000004 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.325 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.324999999999999 0.0 0.0 0.0 0.0 136-137 6.6875 0.0 0.0 0.0 0.0 138-139 7.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAGC 10 0.006830828 145.0 2 GGGGGGG 25 4.977651E-4 29.0 90-94 AAAAAAA 125 3.2420918E-5 11.6 70-74 >>END_MODULE Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678741 spots for SRR7170643.sra Written 678741 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra Read 678735 spots for SRR7170643.sra Written 678735 spots for SRR7170643.sra SRR ids: ['SRR7170643.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nr_3g0sb SRR7170643.sra spots: 13574706 blocks: [[1, 678735], [678736, 1357470], [1357471, 2036205], [2036206, 2714940], [2714941, 3393675], [3393676, 4072410], [4072411, 4751145], [4751146, 5429880], [5429881, 6108615], [6108616, 6787350], [6787351, 7466085], [7466086, 8144820], [8144821, 8823555], [8823556, 9502290], [9502291, 10181025], [10181026, 10859760], [10859761, 11538495], [11538496, 12217230], [12217231, 12895965], [12895966, 13574706]] SRR7170643 file size 4578322 SRR7170643 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170643 SRR7170643_1.fastq SRR7170643_2.fastq Input file: SRR7170643_1.fastq Paired file: SRR7170643_2.fastq trimmed: SRR7170643-trimmed-pair1.fastq, SRR7170643-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:47:09 2025 >> started Thu Feb 13 14:47:24 2025 >> done (14.999s) 13574706 read pairs processed; of these: 32754 ( 0.24%) short read pairs filtered out after trimming by size control 177806 ( 1.31%) empty read pairs filtered out after trimming by size control 13364146 (98.45%) read pairs available; of these: 6690180 (50.06%) trimmed read pairs available after processing 6673966 (49.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 18 0.00% 21 21 0.00% 22 23 0.00% 23 25 0.00% 24 32 0.00% 25 15 0.00% 26 29 0.00% 27 32 0.00% 28 29 0.00% 29 33 0.00% 30 24 0.00% 31 41 0.00% 32 29 0.00% 33 26 0.00% 34 27 0.00% 35 35 0.00% 36 27 0.00% 37 31 0.00% 38 40 0.00% 39 44 0.00% 40 38 0.00% 41 40 0.00% 42 64 0.00% 43 56 0.00% 44 65 0.00% 45 84 0.00% 46 116 0.00% 47 117 0.00% 48 149 0.00% 49 145 0.00% 50 192 0.00% 51 169 0.00% 52 185 0.00% 53 190 0.00% 54 215 0.00% 55 230 0.00% 56 256 0.00% 57 285 0.00% 58 353 0.00% 59 384 0.00% 60 441 0.00% 61 485 0.00% 62 564 0.00% 63 571 0.00% 64 633 0.00% 65 630 0.00% 66 796 0.01% 67 793 0.01% 68 906 0.01% 69 1065 0.01% 70 1138 0.01% 71 1337 0.01% 72 1679 0.01% 73 1792 0.01% 74 2044 0.02% 75 2837 0.02% 76 5898 0.04% 77 5319 0.04% 78 3093 0.02% 79 3254 0.02% 80 3321 0.02% 81 3953 0.03% 82 4416 0.03% 83 4939 0.04% 84 6582 0.05% 85 7984 0.06% 86 8827 0.07% 87 9229 0.07% 88 9944 0.07% 89 9676 0.07% 90 10044 0.08% 91 10260 0.08% 92 11102 0.08% 93 11740 0.09% 94 11809 0.09% 95 12725 0.10% 96 13398 0.10% 97 13468 0.10% 98 13684 0.10% 99 14774 0.11% 100 15013 0.11% 101 15928 0.12% 102 16839 0.13% 103 17720 0.13% 104 18888 0.14% 105 19554 0.15% 106 20200 0.15% 107 20624 0.15% 108 21004 0.16% 109 22145 0.17% 110 22553 0.17% 111 23361 0.17% 112 24762 0.19% 113 26033 0.19% 114 26414 0.20% 115 26619 0.20% 116 27701 0.21% 117 27797 0.21% 118 28401 0.21% 119 29222 0.22% 120 29809 0.22% 121 30468 0.23% 122 31354 0.23% 123 32735 0.24% 124 33825 0.25% 125 34912 0.26% 126 36091 0.27% 127 36500 0.27% 128 37664 0.28% 129 38720 0.29% 130 39941 0.30% 131 40610 0.30% 132 43323 0.32% 133 44961 0.34% 134 46668 0.35% 135 48709 0.36% 136 51246 0.38% 137 53881 0.40% 138 56550 0.42% 139 60066 0.45% 140 64152 0.48% 141 70861 0.53% 142 78879 0.59% 143 88959 0.67% 144 100074 0.75% 145 119315 0.89% 146 149540 1.12% 147 205310 1.54% 148 317841 2.38% 149 630737 4.72% 150 3354607 25.10% 151 6673966 49.94% 13364146 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=15 prefix-density=0.84 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=44.97 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=15 prefix-density=0.86 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=59.10 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=1.1 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGA SRR7170643 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:48:16 Started mapping on | Feb 13 14:48:16 Finished on | Feb 13 14:51:26 Mapping speed, Million of reads per hour | 253.22 Number of input reads | 13364146 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11666855 Uniquely mapped reads % | 87.30% Average mapped length | 292.65 Number of splices: Total | 10263239 Number of splices: Annotated (sjdb) | 10053913 Number of splices: GT/AG | 10054081 Number of splices: GC/AG | 168153 Number of splices: AT/AC | 9102 Number of splices: Non-canonical | 31903 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.35 Insertion rate per base | 0.03% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328090 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 20612 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.01% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1400301 1400301 1400301 N_multimapping 328090 328090 328090 N_noFeature 283668 11418897 343047 N_ambiguous 286748 632 97945 UnstrandedReadsAssigned:11096439 PositiveStrandReadsAssigned:247326 NegativeStrandReadsAssigned:11225863 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170643 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170643-trimmed-pair1.fastq SRR7170643-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,364,146 reads, 11,249,898 reads pseudoaligned [quant] estimated average fragment length: 243.565 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR7170643.ke.tsv 34699 SRR7170643.se.tsv 87100 total ==> SRR7170643.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.43 440 16.9641 Potri.005G024800.1.v4.1 1035 792.435 117 10.1066 Potri.004G059700.1.v4.1 961 718.465 6 0.571648 Potri.007G009000.2.v4.1 1416 1173.43 0 0 Potri.003G141000.2.v4.1 2943 2700.43 345.25 8.75151 Potri.016G087400.1.v4.1 270 81.4897 699.008 587.167 Potri.015G069301.1.v4.1 564 326.349 0 0 Potri.010G195200.1.v4.1 1773 1530.43 18 0.805082 Potri.012G127500.1.v4.1 977 734.46 265 24.6979 ==> SRR7170643.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 591 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170643 completed mapping pipeline successfully