Starting /dee2/code/volunteer_pipeline.sh SRR7170644 current disk space = 3090308022272 free memory = 1460353100 SRR7170644 SRAfilesize d6700b14ea04b97f9bca6a2b8e4d7a9e SRR7170644.sra SRR7170644.sra file validated SRR7170644 is paired end SRR7170644 is conventional basespace SRR7170644 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170644_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.10525 31.0 18.0 33.0 18.0 33.0 2 25.87 27.0 18.0 31.0 18.0 33.0 3 29.372 31.0 28.0 33.0 25.0 33.0 4 31.47275 33.0 31.0 33.0 29.0 33.0 5 32.10925 33.0 33.0 33.0 31.0 33.0 6 36.58525 38.0 37.0 38.0 34.0 38.0 7 36.79125 38.0 37.0 38.0 34.0 38.0 8 37.147 38.0 38.0 38.0 36.0 38.0 9 37.343 38.0 38.0 38.0 36.0 38.0 10-14 37.315200000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.3543 38.0 38.0 38.0 36.8 38.0 20-24 37.4388 38.0 38.0 38.0 37.0 38.0 25-29 37.48049999999999 38.0 38.0 38.0 37.2 38.0 30-34 37.452999999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.439499999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.4002 38.0 38.0 38.0 37.0 38.0 45-49 37.3258 38.0 38.0 38.0 37.0 38.0 50-54 37.253499999999995 38.0 38.0 38.0 36.6 38.0 55-59 37.149800000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.1444 38.0 38.0 38.0 36.0 38.0 65-69 37.07785 38.0 38.0 38.0 36.0 38.0 70-74 36.990449999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.885000000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.82545 38.0 38.0 38.0 35.0 38.0 85-89 36.70185 38.0 38.0 38.0 34.6 38.0 90-94 36.578050000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.46225 38.0 38.0 38.0 34.0 38.0 100-104 36.28935 38.0 37.2 38.0 33.8 38.0 105-109 36.1586 38.0 37.0 38.0 33.2 38.0 110-114 35.95175 38.0 37.0 38.0 32.6 38.0 115-119 35.72525 38.0 36.2 38.0 31.0 38.0 120-124 35.59305 38.0 36.0 38.0 31.0 38.0 125-129 35.33534999999999 38.0 35.8 38.0 30.0 38.0 130-134 35.095099999999995 38.0 35.0 38.0 28.6 38.0 135-139 34.77455 38.0 35.0 38.0 27.6 38.0 140-144 34.17130000000001 38.0 34.4 38.0 24.4 38.0 145-149 33.24680000000001 38.0 33.2 38.0 20.6 38.0 150-151 28.035375000000002 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 2.0 16 2.0 17 0.0 18 1.0 19 3.0 20 3.0 21 4.0 22 3.0 23 9.0 24 10.0 25 6.0 26 8.0 27 11.0 28 22.0 29 37.0 30 33.0 31 71.0 32 97.0 33 124.0 34 217.0 35 385.0 36 1055.0 37 1895.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.19324289736371 17.71179933452777 10.570770412080881 36.524187356027646 2 19.05 24.075 38.224999999999994 18.65 3 17.474999999999998 29.425 29.049999999999997 24.05 4 21.375 36.5 21.9 20.225 5 19.754324392078214 37.152168463274 23.289044873401853 19.804462271245924 6 16.425 36.875 24.85 21.85 7 13.55 17.8 46.575 22.075 8 16.925 19.775000000000002 28.000000000000004 35.3 9 17.474999999999998 22.425 30.95 29.15 10-14 18.98 29.465000000000003 27.150000000000002 24.404999999999998 15-19 19.345000000000002 27.994999999999997 28.325 24.335 20-24 19.715 28.815 27.575 23.895 25-29 19.43 28.34 28.144999999999996 24.085 30-34 20.080000000000002 28.71 27.694999999999997 23.515 35-39 20.285 28.485 27.250000000000004 23.98 40-44 19.96 28.815 27.425 23.799999999999997 45-49 20.06 28.23 27.889999999999997 23.82 50-54 20.325 28.555000000000003 27.855 23.265 55-59 20.380000000000003 28.884999999999998 27.37 23.365 60-64 20.13 28.325 27.805000000000003 23.74 65-69 19.81 29.054999999999996 27.345000000000002 23.79 70-74 19.99 28.125 28.07 23.815 75-79 20.26 28.215 27.625 23.9 80-84 19.945 27.99 28.134999999999998 23.93 85-89 20.19 28.310000000000002 27.779999999999998 23.72 90-94 20.285 28.305000000000003 27.655 23.755000000000003 95-99 19.71 28.685 27.655 23.95 100-104 20.28 28.62 27.625 23.474999999999998 105-109 20.255000000000003 28.555000000000003 27.905 23.285 110-114 20.11 28.249999999999996 28.12 23.52 115-119 20.695 28.165000000000003 27.845 23.294999999999998 120-124 20.395 28.084999999999997 27.565 23.955000000000002 125-129 19.97 28.89 26.950000000000003 24.19 130-134 20.635 28.53 27.325 23.51 135-139 20.345 28.439999999999998 27.16 24.055 140-144 20.5 28.525 27.3 23.674999999999997 145-149 20.805 28.33 27.54 23.325000000000003 150-151 20.778083562672002 27.87090317738304 27.32049036777583 24.030522892169127 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 1.0 24 2.0 25 4.5 26 9.0 27 8.5 28 7.5 29 12.0 30 24.5 31 36.0 32 41.0 33 45.5 34 59.5 35 80.0 36 85.0 37 96.5 38 135.0 39 164.0 40 182.0 41 222.0 42 248.0 43 251.5 44 266.5 45 275.5 46 266.0 47 261.0 48 238.5 49 200.5 50 174.0 51 135.0 52 94.5 53 83.0 54 80.0 55 60.0 56 42.5 57 33.0 58 22.5 59 15.0 60 10.0 61 8.5 62 7.0 63 3.0 64 2.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19069296914516 98.05 2 0.6069802731411229 1.2 3 0.10116337885685382 0.3 4 0.07587253414264036 0.3 5 0.0 0.0 6 0.025290844714213456 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.0250000000000004 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7375 0.0 0.0 0.0 0.0 134-135 2.9375 0.0 0.0 0.0 0.0 136-137 3.2 0.0 0.0 0.0 0.0 138-139 3.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATTT 10 0.006095082 150.55844 1 ATTCTAG 10 0.0065874006 146.74684 5 AGACATT 10 0.0065874006 146.74684 3 >>END_MODULE SRR7170644 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170644_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.617 33.0 33.0 34.0 32.0 34.0 2 32.82475 33.0 33.0 34.0 32.0 34.0 3 32.88025 34.0 33.0 34.0 32.0 34.0 4 32.80675 33.0 33.0 34.0 32.0 34.0 5 32.87875 33.0 33.0 34.0 32.0 34.0 6 36.95525 38.0 38.0 38.0 36.0 38.0 7 37.10575 38.0 38.0 38.0 37.0 38.0 8 37.104 38.0 38.0 38.0 36.0 38.0 9 37.045 38.0 38.0 38.0 36.0 38.0 10-14 37.00205 38.0 38.0 38.0 36.0 38.0 15-19 37.0176 38.0 38.0 38.0 36.0 38.0 20-24 36.95385 38.0 38.0 38.0 36.0 38.0 25-29 36.9326 38.0 38.0 38.0 36.0 38.0 30-34 36.83284999999999 38.0 38.0 38.0 35.8 38.0 35-39 36.89855 38.0 38.0 38.0 36.0 38.0 40-44 36.87865 38.0 38.0 38.0 36.0 38.0 45-49 36.8644 38.0 38.0 38.0 36.0 38.0 50-54 36.709 38.0 38.0 38.0 35.6 38.0 55-59 36.67575 38.0 38.0 38.0 35.0 38.0 60-64 36.63675 38.0 38.0 38.0 34.8 38.0 65-69 36.63845 38.0 38.0 38.0 34.8 38.0 70-74 36.578199999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.548300000000005 38.0 38.0 38.0 34.8 38.0 80-84 36.4472 38.0 38.0 38.0 34.4 38.0 85-89 36.2693 38.0 38.0 38.0 34.0 38.0 90-94 36.2074 38.0 38.0 38.0 34.0 38.0 95-99 35.986900000000006 38.0 37.4 38.0 33.2 38.0 100-104 35.8754 38.0 37.0 38.0 33.0 38.0 105-109 35.7638 38.0 37.0 38.0 32.4 38.0 110-114 35.501400000000004 38.0 37.0 38.0 30.6 38.0 115-119 35.10235 38.0 36.0 38.0 28.6 38.0 120-124 35.16915 38.0 36.0 38.0 30.0 38.0 125-129 34.72945 38.0 35.4 38.0 27.0 38.0 130-134 34.4146 38.0 34.2 38.0 26.4 38.0 135-139 34.02875 38.0 33.4 38.0 23.6 38.0 140-144 33.392599999999995 38.0 33.0 38.0 20.6 38.0 145-149 32.3718 38.0 33.0 38.0 12.8 38.0 150-151 26.822625000000002 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 8.0 4 4.0 5 1.0 6 1.0 7 0.0 8 2.0 9 2.0 10 2.0 11 2.0 12 2.0 13 4.0 14 1.0 15 4.0 16 6.0 17 6.0 18 5.0 19 7.0 20 11.0 21 17.0 22 6.0 23 6.0 24 10.0 25 19.0 26 19.0 27 27.0 28 38.0 29 32.0 30 47.0 31 64.0 32 96.0 33 118.0 34 184.0 35 317.0 36 705.0 37 2225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.775 16.900000000000002 13.4 30.925000000000004 2 22.15 25.025 36.175000000000004 16.650000000000002 3 20.1 26.575 32.725 20.599999999999998 4 23.45 35.425000000000004 21.4 19.725 5 22.625 38.475 22.15 16.75 6 17.208604302151077 38.61930965482742 24.137068534267133 20.035017508754375 7 15.857928964482241 15.257628814407203 47.19859929964982 21.68584292146073 8 19.384692346173086 21.860930465232617 28.38919459729865 30.365182591295646 9 21.435717858929465 24.412206103051524 27.51375687843922 26.638319159579787 10-14 22.28780073025559 28.845095783524233 27.429600360126045 21.437503126094132 15-19 22.82184655396619 28.253476042812842 27.72331699509853 21.201360408122436 20-24 22.816845053516055 27.813344003200964 28.26848054416325 21.101330399119735 25-29 22.35670701210363 28.19845953786136 28.15344603381014 21.291387416224865 30-34 22.41672501750525 28.163449034710414 28.423527058117436 20.9962988896669 35-39 22.991495747873934 28.31415707853927 27.823911955977987 20.870435217608804 40-44 22.017109410175596 27.635199359647807 28.52068637750763 21.827004852668967 45-49 22.453981592637053 28.59643857543017 28.416366546618647 20.533213285314126 50-54 22.281684505351606 27.82334700410123 28.24847454236271 21.646493948184457 55-59 23.261630815407706 28.059029514757377 28.114057028514257 20.56528264132066 60-64 22.564025610244098 28.17627050820328 28.11124449779912 21.1484593837535 65-69 22.740685171292824 27.851962990747687 27.796949237309327 21.610402600650165 70-74 23.59117955897795 28.39641982099105 27.486374318715935 20.526026301315063 75-79 22.635658914728683 28.64216054013503 28.097024256064017 20.62515628907227 80-84 22.854570914182837 27.860572114422883 28.185637127425483 21.099219843968793 85-89 23.168475271290696 28.05420813121968 27.529129369405407 21.248187228084213 90-94 22.48224822482248 28.95789578957896 27.95779577957796 20.602060206020603 95-99 23.26 27.505000000000003 28.425 20.810000000000002 100-104 23.086154307715386 27.40137006850343 28.906445322266112 20.606030301515077 105-109 23.054610922184438 28.010602120424082 28.32066413282657 20.614122824564912 110-114 23.881940970485243 27.673836918459227 28.23911955977989 20.20510255127564 115-119 23.328164857700195 27.799729905466915 28.054819186715353 20.81728605011754 120-124 23.346167308365416 28.381419070953545 27.60638031901595 20.66603330166508 125-129 23.54853227984198 28.354253137970698 27.57913687053058 20.518077711656748 130-134 24.207420742074206 28.182818281828183 27.482748274827486 20.12701270127013 135-139 24.157078539269637 28.31415707853927 27.888944472236116 19.639819909954976 140-144 24.16208104052026 28.099049524762382 27.63881940970485 20.100050025012507 145-149 24.03 28.075 27.37 20.525 150-151 24.224999999999998 27.6125 28.512500000000003 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 1.5 20 2.5 21 2.5 22 2.0 23 2.0 24 1.0 25 3.5 26 7.5 27 7.0 28 9.0 29 17.5 30 23.0 31 27.0 32 31.0 33 37.0 34 51.0 35 70.5 36 83.0 37 109.5 38 154.5 39 178.5 40 202.0 41 225.5 42 235.0 43 253.5 44 273.5 45 258.0 46 256.5 47 252.0 48 222.5 49 209.0 50 171.5 51 126.5 52 100.5 53 80.5 54 72.0 55 64.0 56 52.0 57 39.5 58 23.5 59 18.0 60 15.0 61 10.5 62 5.5 63 2.5 64 1.0 65 0.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.034999999999999996 15-19 0.03 20-24 0.03 25-29 0.03 30-34 0.03 35-39 0.05 40-44 0.055 45-49 0.04 50-54 0.03 55-59 0.05 60-64 0.04 65-69 0.025 70-74 0.005 75-79 0.025 80-84 0.02 85-89 0.015 90-94 0.01 95-99 0.0 100-104 0.005 105-109 0.02 110-114 0.05 115-119 0.034999999999999996 120-124 0.005 125-129 0.015 130-134 0.01 135-139 0.05 140-144 0.05 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88438133874239 97.5 2 0.8620689655172413 1.7000000000000002 3 0.2028397565922921 0.6 4 0.05070993914807302 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.8875 0.0 0.0 0.0 0.0 136-137 3.1500000000000004 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra Read 744701 spots for SRR7170644.sra Written 744701 spots for SRR7170644.sra Read 744687 spots for SRR7170644.sra Written 744687 spots for SRR7170644.sra SRR ids: ['SRR7170644.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ixtcqn1z SRR7170644.sra spots: 14893754 blocks: [[1, 744687], [744688, 1489374], [1489375, 2234061], [2234062, 2978748], [2978749, 3723435], [3723436, 4468122], [4468123, 5212809], [5212810, 5957496], [5957497, 6702183], [6702184, 7446870], [7446871, 8191557], [8191558, 8936244], [8936245, 9680931], [9680932, 10425618], [10425619, 11170305], [11170306, 11914992], [11914993, 12659679], [12659680, 13404366], [13404367, 14149053], [14149054, 14893754]] SRR7170644 file size 5025304 SRR7170644 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170644 SRR7170644_1.fastq SRR7170644_2.fastq Input file: SRR7170644_1.fastq Paired file: SRR7170644_2.fastq trimmed: SRR7170644-trimmed-pair1.fastq, SRR7170644-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:55:31 2025 >> started Thu Feb 13 13:55:48 2025 >> done (16.978s) 14893754 read pairs processed; of these: 11330 ( 0.08%) short read pairs filtered out after trimming by size control 17124 ( 0.11%) empty read pairs filtered out after trimming by size control 14865300 (99.81%) read pairs available; of these: 7605639 (51.16%) trimmed read pairs available after processing 7259661 (48.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 5 0.00% 23 5 0.00% 24 3 0.00% 25 3 0.00% 26 6 0.00% 27 4 0.00% 28 10 0.00% 29 2 0.00% 30 7 0.00% 31 6 0.00% 32 5 0.00% 33 9 0.00% 34 9 0.00% 35 11 0.00% 36 12 0.00% 37 8 0.00% 38 9 0.00% 39 7 0.00% 40 12 0.00% 41 8 0.00% 42 6 0.00% 43 10 0.00% 44 17 0.00% 45 18 0.00% 46 24 0.00% 47 17 0.00% 48 31 0.00% 49 30 0.00% 50 33 0.00% 51 49 0.00% 52 42 0.00% 53 53 0.00% 54 45 0.00% 55 54 0.00% 56 62 0.00% 57 94 0.00% 58 88 0.00% 59 89 0.00% 60 98 0.00% 61 135 0.00% 62 113 0.00% 63 151 0.00% 64 174 0.00% 65 203 0.00% 66 222 0.00% 67 247 0.00% 68 281 0.00% 69 355 0.00% 70 343 0.00% 71 414 0.00% 72 485 0.00% 73 565 0.00% 74 610 0.00% 75 652 0.00% 76 729 0.00% 77 881 0.01% 78 948 0.01% 79 1071 0.01% 80 1147 0.01% 81 1477 0.01% 82 1671 0.01% 83 1836 0.01% 84 2586 0.02% 85 3027 0.02% 86 3199 0.02% 87 3343 0.02% 88 3802 0.03% 89 3985 0.03% 90 4095 0.03% 91 4585 0.03% 92 4829 0.03% 93 5047 0.03% 94 5584 0.04% 95 5892 0.04% 96 6453 0.04% 97 6618 0.04% 98 6915 0.05% 99 7229 0.05% 100 7637 0.05% 101 8135 0.05% 102 8782 0.06% 103 9150 0.06% 104 9922 0.07% 105 10309 0.07% 106 10891 0.07% 107 11225 0.08% 108 11724 0.08% 109 11984 0.08% 110 12820 0.09% 111 13470 0.09% 112 14056 0.09% 113 14922 0.10% 114 15564 0.10% 115 16071 0.11% 116 16426 0.11% 117 17434 0.12% 118 17943 0.12% 119 18579 0.12% 120 19382 0.13% 121 20490 0.14% 122 21472 0.14% 123 22816 0.15% 124 23837 0.16% 125 24926 0.17% 126 25942 0.17% 127 27546 0.19% 128 28306 0.19% 129 30135 0.20% 130 31226 0.21% 131 33422 0.22% 132 35470 0.24% 133 37899 0.25% 134 41341 0.28% 135 44014 0.30% 136 48293 0.32% 137 52235 0.35% 138 57585 0.39% 139 64027 0.43% 140 71618 0.48% 141 82453 0.55% 142 95199 0.64% 143 111963 0.75% 144 130769 0.88% 145 164496 1.11% 146 213697 1.44% 147 306564 2.06% 148 464921 3.13% 149 906312 6.10% 150 4017320 27.02% 151 7259661 48.84% 14865300 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=15 prefix-density=0.63 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=47.39 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.4 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=8 prefix-density=0.85 prefix-fanout=2.5 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=38.19 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.1 sequence=CAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170644 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:56:33 Started mapping on | Feb 13 13:56:34 Finished on | Feb 13 13:58:26 Mapping speed, Million of reads per hour | 477.81 Number of input reads | 14865300 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14080020 Uniquely mapped reads % | 94.72% Average mapped length | 295.53 Number of splices: Total | 14599331 Number of splices: Annotated (sjdb) | 14278754 Number of splices: GT/AG | 14329682 Number of splices: GC/AG | 223060 Number of splices: AT/AC | 8200 Number of splices: Non-canonical | 38389 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390574 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 45023 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 407441 407441 407441 N_multimapping 390574 390574 390574 N_noFeature 564735 13826202 636937 N_ambiguous 276616 782 94535 UnstrandedReadsAssigned:13238669 PositiveStrandReadsAssigned:253036 NegativeStrandReadsAssigned:13348548 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170644 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170644-trimmed-pair1.fastq SRR7170644-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,865,300 reads, 13,258,052 reads pseudoaligned [quant] estimated average fragment length: 285.982 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7170644.ke.tsv 34699 SRR7170644.se.tsv 87100 total ==> SRR7170644.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.02 496 18.7206 Potri.005G024800.1.v4.1 1035 750.018 119 10.378 Potri.004G059700.1.v4.1 961 676.105 4 0.386978 Potri.007G009000.2.v4.1 1416 1131.02 0 0 Potri.003G141000.2.v4.1 2943 2658.02 847.87 20.8647 Potri.016G087400.1.v4.1 270 70.5 433.675 402.361 Potri.015G069301.1.v4.1 564 290.566 0 0 Potri.010G195200.1.v4.1 1773 1488.02 11 0.483532 Potri.012G127500.1.v4.1 977 692.059 99 9.35691 ==> SRR7170644.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 527 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 201 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170644 completed mapping pipeline successfully