Starting /dee2/code/volunteer_pipeline.sh SRR7170645 current disk space = 3090401177600 free memory = 1411972220 SRR7170645 SRAfilesize b3b125198dce48e0a29e38d5b38cd02d SRR7170645.sra SRR7170645.sra file validated SRR7170645 is paired end SRR7170645 is conventional basespace SRR7170645 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170645_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.30175 30.0 18.0 33.0 18.0 33.0 2 25.727 27.0 18.0 31.0 18.0 33.0 3 29.46975 31.0 28.0 33.0 25.0 33.0 4 31.70075 33.0 31.0 33.0 29.0 33.0 5 32.52175 33.0 33.0 33.0 32.0 34.0 6 36.51075 38.0 37.0 38.0 34.0 38.0 7 36.82375 38.0 37.0 38.0 34.0 38.0 8 37.26475 38.0 38.0 38.0 36.0 38.0 9 37.382 38.0 38.0 38.0 37.0 38.0 10-14 37.3754 38.0 38.0 38.0 36.8 38.0 15-19 37.36305 38.0 38.0 38.0 37.0 38.0 20-24 37.471500000000006 38.0 38.0 38.0 37.2 38.0 25-29 37.4887 38.0 38.0 38.0 38.0 38.0 30-34 37.400999999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.4274 38.0 38.0 38.0 37.0 38.0 40-44 37.34544999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.25575 38.0 38.0 38.0 36.8 38.0 50-54 37.183550000000004 38.0 38.0 38.0 36.6 38.0 55-59 37.1246 38.0 38.0 38.0 36.0 38.0 60-64 37.11275 38.0 38.0 38.0 36.0 38.0 65-69 37.003750000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.86880000000001 38.0 38.0 38.0 35.6 38.0 75-79 36.76325 38.0 38.0 38.0 34.8 38.0 80-84 36.7821 38.0 38.0 38.0 35.2 38.0 85-89 36.5886 38.0 38.0 38.0 34.4 38.0 90-94 36.4428 38.0 38.0 38.0 34.0 38.0 95-99 36.39475 38.0 38.0 38.0 34.0 38.0 100-104 36.17475 38.0 37.2 38.0 33.2 38.0 105-109 36.134699999999995 38.0 37.0 38.0 33.2 38.0 110-114 35.90185 38.0 37.0 38.0 32.2 38.0 115-119 35.72815 38.0 36.8 38.0 31.0 38.0 120-124 35.608399999999996 38.0 36.4 38.0 30.6 38.0 125-129 35.1982 38.0 35.8 38.0 28.8 38.0 130-134 34.79795 38.0 35.0 38.0 27.2 38.0 135-139 34.1459 38.0 34.2 38.0 23.6 38.0 140-144 33.353750000000005 38.0 33.2 38.0 19.0 38.0 145-149 32.6925 38.0 33.2 38.0 15.2 38.0 150-151 28.696875 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 3.0 18 5.0 19 5.0 20 2.0 21 5.0 22 4.0 23 8.0 24 9.0 25 20.0 26 15.0 27 15.0 28 26.0 29 43.0 30 52.0 31 59.0 32 90.0 33 118.0 34 199.0 35 376.0 36 948.0 37 1991.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.785200411099694 16.44398766700925 14.362795477903392 36.40801644398767 2 18.375 25.5 36.85 19.275000000000002 3 16.725 31.0 28.425 23.849999999999998 4 20.8 37.175000000000004 21.725 20.3 5 19.208615076383673 38.94315051339844 22.814926120711245 19.033308289506635 6 15.875 35.875 25.85 22.400000000000002 7 12.950000000000001 20.4 46.45 20.200000000000003 8 18.0 21.8 28.1 32.1 9 16.675 22.7 30.575000000000003 30.049999999999997 10-14 18.98 30.43 26.655 23.935000000000002 15-19 18.94 30.035 27.405 23.62 20-24 19.0 29.485 28.015 23.5 25-29 18.845 30.035 27.584999999999997 23.535 30-34 19.994999999999997 29.349999999999998 27.415 23.24 35-39 19.17 30.214999999999996 27.310000000000002 23.305 40-44 19.715 29.365000000000002 27.224999999999998 23.695 45-49 19.725 30.009999999999998 26.889999999999997 23.375 50-54 19.384999999999998 29.125 27.32 24.169999999999998 55-59 19.455 30.035 27.025 23.485 60-64 19.6 29.235 27.92 23.244999999999997 65-69 19.56 29.525000000000002 27.029999999999998 23.885 70-74 19.07 29.235 27.88 23.815 75-79 19.59 28.970000000000002 27.295 24.145 80-84 19.67 28.77 27.450000000000003 24.11 85-89 19.93 28.910000000000004 27.284999999999997 23.875 90-94 20.34 29.2 26.795 23.665 95-99 19.994999999999997 29.23 27.22 23.555 100-104 20.075000000000003 28.384999999999998 27.77 23.77 105-109 20.465 28.715000000000003 27.095000000000002 23.724999999999998 110-114 20.455000000000002 28.439999999999998 27.495000000000005 23.61 115-119 20.335 28.71 27.189999999999998 23.765 120-124 20.830000000000002 28.025 27.47 23.674999999999997 125-129 20.765 27.37 27.48 24.385 130-134 20.385 28.68 27.339999999999996 23.595 135-139 20.71 27.88 27.735 23.674999999999997 140-144 20.875 28.08 27.66 23.385 145-149 20.7 27.750000000000004 26.865 24.685000000000002 150-151 20.875 28.499999999999996 27.05 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.5 19 2.0 20 1.0 21 1.0 22 1.5 23 5.0 24 5.5 25 4.0 26 9.5 27 13.5 28 19.0 29 27.5 30 32.0 31 36.5 32 48.5 33 64.5 34 86.0 35 113.5 36 123.5 37 123.0 38 143.0 39 167.0 40 190.0 41 217.0 42 227.0 43 220.5 44 234.0 45 248.5 46 225.0 47 209.0 48 213.0 49 190.0 50 163.5 51 137.0 52 109.5 53 98.0 54 77.5 55 64.0 56 50.0 57 24.5 58 13.5 59 15.5 60 14.0 61 10.5 62 8.0 63 3.5 64 1.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.7 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57069933639612 96.55 2 0.9443593670239917 1.8499999999999999 3 0.38284839203675347 1.125 4 0.0765696784073507 0.3 5 0.0 0.0 6 0.0 0.0 7 0.025523226135783564 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.1500000000000004 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.65 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.9 0.0 0.0 0.0 0.0 134-135 4.2125 0.0 0.0 0.0 0.0 136-137 4.575 0.0 0.0 0.0 0.0 138-139 4.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGGT 10 0.0063298983 148.6923 1 >>END_MODULE SRR7170645 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170645_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79775 33.0 33.0 34.0 32.0 34.0 2 32.88625 33.0 33.0 34.0 32.0 34.0 3 32.8755 34.0 33.0 34.0 32.0 34.0 4 32.86875 34.0 33.0 34.0 32.0 34.0 5 32.87725 34.0 33.0 34.0 32.0 34.0 6 37.04025 38.0 38.0 38.0 36.0 38.0 7 37.0165 38.0 38.0 38.0 36.0 38.0 8 37.068 38.0 38.0 38.0 37.0 38.0 9 37.004 38.0 38.0 38.0 36.0 38.0 10-14 37.042649999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.016299999999994 38.0 38.0 38.0 37.0 38.0 20-24 36.9666 38.0 38.0 38.0 36.2 38.0 25-29 36.925599999999996 38.0 38.0 38.0 36.2 38.0 30-34 36.926100000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.94715 38.0 38.0 38.0 36.2 38.0 40-44 36.9705 38.0 38.0 38.0 36.2 38.0 45-49 36.90845 38.0 38.0 38.0 36.2 38.0 50-54 36.82545 38.0 38.0 38.0 36.0 38.0 55-59 36.674299999999995 38.0 38.0 38.0 35.4 38.0 60-64 36.705650000000006 38.0 38.0 38.0 35.8 38.0 65-69 36.7054 38.0 38.0 38.0 35.6 38.0 70-74 36.638850000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.572199999999995 38.0 38.0 38.0 34.8 38.0 80-84 36.4579 38.0 38.0 38.0 34.8 38.0 85-89 36.256600000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.21265 38.0 38.0 38.0 34.0 38.0 95-99 36.0144 38.0 38.0 38.0 33.4 38.0 100-104 35.8114 38.0 37.6 38.0 32.2 38.0 105-109 35.73895 38.0 37.2 38.0 32.6 38.0 110-114 35.6661 38.0 37.0 38.0 32.2 38.0 115-119 35.392399999999995 38.0 36.8 38.0 30.6 38.0 120-124 35.1717 38.0 36.6 38.0 29.2 38.0 125-129 34.676550000000006 38.0 35.6 38.0 26.6 38.0 130-134 34.251400000000004 38.0 34.6 38.0 24.4 38.0 135-139 34.10235 38.0 33.8 38.0 24.6 38.0 140-144 33.3321 38.0 33.0 38.0 20.2 38.0 145-149 32.48995 38.0 33.0 38.0 13.4 38.0 150-151 27.271875 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 0.0 5 0.0 6 1.0 7 3.0 8 1.0 9 3.0 10 4.0 11 2.0 12 3.0 13 3.0 14 6.0 15 3.0 16 8.0 17 6.0 18 10.0 19 8.0 20 6.0 21 6.0 22 7.0 23 15.0 24 16.0 25 17.0 26 34.0 27 23.0 28 37.0 29 26.0 30 45.0 31 56.0 32 69.0 33 102.0 34 183.0 35 235.0 36 665.0 37 2384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.15 16.150000000000002 16.225 29.475 2 25.2 23.7 35.15 15.950000000000001 3 21.7 25.55 31.374999999999996 21.375 4 24.525 33.825 20.849999999999998 20.8 5 22.5 39.2 20.775 17.525 6 18.254563640910227 35.8589647411853 24.381095273818453 21.50537634408602 7 18.154538634658664 15.628907226806701 45.16129032258064 21.05526381595399 8 21.080270067516878 22.355588897224308 26.281570392598148 30.282570642660666 9 21.85546386596649 24.981245311327832 26.581645411352838 26.581645411352838 10-14 22.755688922230558 28.507126781695426 26.941735433858465 21.795448862215554 15-19 22.865716429107277 28.362090522630655 27.781945486371594 20.990247561890474 20-24 23.382338233823383 28.272827282728276 27.83278327832783 20.512051205120514 25-29 23.035758939734936 28.64216054013503 27.326831707926978 20.99524881220305 30-34 23.240810202550637 27.54688672168042 27.966991747936987 21.24531132783196 35-39 23.460865216304075 27.95198799699925 27.421855463865967 21.165291322830708 40-44 23.390847711927982 27.62190547636909 28.08702175543886 20.900225056264066 45-49 23.05076269067267 27.771942985746435 27.861965491372843 21.315328832208053 50-54 23.264652930586116 27.620524104820966 27.58551710342068 21.529305861172237 55-59 24.31107776944236 27.101775443860966 27.54688672168042 21.040260065016252 60-64 23.300825206301575 27.581895473868467 27.656914228557138 21.460365091272816 65-69 23.767376737673768 27.627762776277624 27.467746774677465 21.137113711371136 70-74 23.845 27.41 27.74 21.005 75-79 23.84238423842384 28.17781778177818 27.237723772377237 20.742074207420742 80-84 23.472347234723472 27.662766276627664 28.457845784578456 20.407040704070408 85-89 23.84119205960298 27.156357817890896 27.76138806940347 21.241062053102656 90-94 23.995 27.985 27.560000000000002 20.46 95-99 24.044999999999998 27.965 27.405 20.585 100-104 24.335 28.305000000000003 27.54 19.82 105-109 24.01740174017402 27.647764776477647 28.137813781378142 20.1970197019702 110-114 23.645911477869465 27.87696924231058 27.9869967491873 20.49012253063266 115-119 24.58368755313297 27.659148872330853 27.574136120418064 20.18302745411812 120-124 24.021201060053002 28.066403320166007 27.42137106855343 20.49102455122756 125-129 24.41 27.694999999999997 27.66 20.235 130-134 24.988748312246837 27.959193879081862 26.899034855228283 20.153022953443017 135-139 24.47611902975744 27.431857964491122 28.342085521380344 19.749937484371095 140-144 25.046261565391347 28.052013003250813 27.461865466366593 19.43985996499125 145-149 25.1 27.450000000000003 27.935 19.515 150-151 24.275 28.375 27.537499999999998 19.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.0 25 3.5 26 3.5 27 2.5 28 7.0 29 9.5 30 13.5 31 18.5 32 27.0 33 40.5 34 49.5 35 66.5 36 76.0 37 93.5 38 131.5 39 162.0 40 171.5 41 183.5 42 212.5 43 244.0 44 274.0 45 285.5 46 268.5 47 243.0 48 227.0 49 207.5 50 177.0 51 155.0 52 137.5 53 114.5 54 98.5 55 86.5 56 67.5 57 43.0 58 26.5 59 19.0 60 14.5 61 8.5 62 6.0 63 4.0 64 3.0 65 2.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.01 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.02 55-59 0.025 60-64 0.025 65-69 0.01 70-74 0.0 75-79 0.01 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.025 115-119 0.015 120-124 0.005 125-129 0.0 130-134 0.015 135-139 0.025 140-144 0.025 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61715749039692 96.275 2 0.9731113956466069 1.9 3 0.15364916773367476 0.44999999999999996 4 0.10243277848911651 0.4 5 0.07682458386683738 0.375 6 0.02560819462227913 0.15 7 0.0 0.0 8 0.02560819462227913 0.2 9 0.0 0.0 >10 0.02560819462227913 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 10 0.25 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (97% over 34bp) CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit CCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGT 5 0.125 No Hit GGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGG 5 0.125 No Hit CATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.3375 0.0 0.0 0.0 0.0 130-131 3.5374999999999996 0.0 0.0 0.0 0.0 132-133 3.825 0.0 0.0 0.0 0.0 134-135 4.1375 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138-139 4.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTCTT 10 0.006830828 145.0 2 GAGCAGC 10 0.006830828 145.0 9 >>END_MODULE Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802528 spots for SRR7170645.sra Written 802528 spots for SRR7170645.sra Read 802545 spots for SRR7170645.sra Written 802545 spots for SRR7170645.sra SRR ids: ['SRR7170645.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y4a4d4so SRR7170645.sra spots: 16050577 blocks: [[1, 802528], [802529, 1605056], [1605057, 2407584], [2407585, 3210112], [3210113, 4012640], [4012641, 4815168], [4815169, 5617696], [5617697, 6420224], [6420225, 7222752], [7222753, 8025280], [8025281, 8827808], [8827809, 9630336], [9630337, 10432864], [10432865, 11235392], [11235393, 12037920], [12037921, 12840448], [12840449, 13642976], [13642977, 14445504], [14445505, 15248032], [15248033, 16050577]] SRR7170645 file size 5417313 SRR7170645 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170645 SRR7170645_1.fastq SRR7170645_2.fastq Input file: SRR7170645_1.fastq Paired file: SRR7170645_2.fastq trimmed: SRR7170645-trimmed-pair1.fastq, SRR7170645-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:50:30 2025 >> started Thu Feb 13 13:50:58 2025 >> done (27.743s) 16050577 read pairs processed; of these: 18342 ( 0.11%) short read pairs filtered out after trimming by size control 32329 ( 0.20%) empty read pairs filtered out after trimming by size control 15999906 (99.68%) read pairs available; of these: 8130693 (50.82%) trimmed read pairs available after processing 7869213 (49.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 7 0.00% 21 14 0.00% 22 12 0.00% 23 8 0.00% 24 10 0.00% 25 5 0.00% 26 10 0.00% 27 12 0.00% 28 11 0.00% 29 13 0.00% 30 13 0.00% 31 7 0.00% 32 14 0.00% 33 16 0.00% 34 10 0.00% 35 12 0.00% 36 27 0.00% 37 13 0.00% 38 23 0.00% 39 14 0.00% 40 28 0.00% 41 23 0.00% 42 20 0.00% 43 36 0.00% 44 34 0.00% 45 40 0.00% 46 58 0.00% 47 73 0.00% 48 101 0.00% 49 66 0.00% 50 92 0.00% 51 94 0.00% 52 112 0.00% 53 143 0.00% 54 117 0.00% 55 132 0.00% 56 154 0.00% 57 182 0.00% 58 192 0.00% 59 237 0.00% 60 210 0.00% 61 260 0.00% 62 297 0.00% 63 359 0.00% 64 369 0.00% 65 391 0.00% 66 441 0.00% 67 530 0.00% 68 561 0.00% 69 654 0.00% 70 730 0.00% 71 811 0.01% 72 979 0.01% 73 1107 0.01% 74 1200 0.01% 75 1452 0.01% 76 1796 0.01% 77 2056 0.01% 78 1812 0.01% 79 1958 0.01% 80 2258 0.01% 81 2411 0.02% 82 2852 0.02% 83 3397 0.02% 84 4421 0.03% 85 4895 0.03% 86 5465 0.03% 87 6082 0.04% 88 5934 0.04% 89 6277 0.04% 90 6757 0.04% 91 6964 0.04% 92 7594 0.05% 93 8123 0.05% 94 8881 0.06% 95 9398 0.06% 96 9602 0.06% 97 10247 0.06% 98 10630 0.07% 99 11073 0.07% 100 11779 0.07% 101 12564 0.08% 102 13220 0.08% 103 13941 0.09% 104 14884 0.09% 105 16022 0.10% 106 16456 0.10% 107 16895 0.11% 108 17140 0.11% 109 18151 0.11% 110 18697 0.12% 111 19497 0.12% 112 20323 0.13% 113 22160 0.14% 114 22599 0.14% 115 22984 0.14% 116 23539 0.15% 117 24604 0.15% 118 25092 0.16% 119 25999 0.16% 120 26909 0.17% 121 27259 0.17% 122 28595 0.18% 123 30387 0.19% 124 31621 0.20% 125 32473 0.20% 126 34293 0.21% 127 35411 0.22% 128 37049 0.23% 129 37931 0.24% 130 38996 0.24% 131 41166 0.26% 132 43567 0.27% 133 45841 0.29% 134 48543 0.30% 135 51304 0.32% 136 54723 0.34% 137 58685 0.37% 138 63538 0.40% 139 69042 0.43% 140 75558 0.47% 141 84394 0.53% 142 95383 0.60% 143 111140 0.69% 144 131190 0.82% 145 158985 0.99% 146 203810 1.27% 147 287645 1.80% 148 447101 2.79% 149 915992 5.72% 150 4252185 26.58% 151 7869213 49.18% 15999906 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=19 prefix-density=0.82 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=78.78 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.0 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=10 prefix-density=0.77 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=44.71 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAA SRR7170645 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:51:53 Started mapping on | Feb 13 13:51:54 Finished on | Feb 13 13:54:10 Mapping speed, Million of reads per hour | 423.53 Number of input reads | 15999906 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15032990 Uniquely mapped reads % | 93.96% Average mapped length | 294.50 Number of splices: Total | 14246771 Number of splices: Annotated (sjdb) | 13933389 Number of splices: GT/AG | 13967894 Number of splices: GC/AG | 226623 Number of splices: AT/AC | 9216 Number of splices: Non-canonical | 43038 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421395 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 25441 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 560806 560806 560806 N_multimapping 421395 421395 421395 N_noFeature 491083 14613899 574437 N_ambiguous 456430 1024 120192 UnstrandedReadsAssigned:14085477 PositiveStrandReadsAssigned:418067 NegativeStrandReadsAssigned:14338361 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170645 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170645-trimmed-pair1.fastq SRR7170645-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,999,906 reads, 14,170,288 reads pseudoaligned [quant] estimated average fragment length: 260.055 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR7170645.ke.tsv 34699 SRR7170645.se.tsv 87100 total ==> SRR7170645.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.95 503 13.5507 Potri.005G024800.1.v4.1 1035 775.945 214 13.0686 Potri.004G059700.1.v4.1 961 701.987 12 0.810024 Potri.007G009000.2.v4.1 1416 1156.95 0 0 Potri.003G141000.2.v4.1 2943 2683.95 753 13.2943 Potri.016G087400.1.v4.1 270 75.1781 806.33 508.238 Potri.015G069301.1.v4.1 564 310.77 0 0 Potri.010G195200.1.v4.1 1773 1513.95 29 0.907681 Potri.012G127500.1.v4.1 977 717.962 110 7.26 ==> SRR7170645.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 840 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 477 Potri.001G212900.v4.1 77 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 49 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170645 completed mapping pipeline successfully