Starting /dee2/code/volunteer_pipeline.sh SRR7170646 current disk space = 3089459339264 free memory = 1573840252 SRR7170646 SRAfilesize 4beb9a16cfa49ad2c2da559fede2f864 SRR7170646.sra SRR7170646.sra file validated SRR7170646 is paired end SRR7170646 is conventional basespace SRR7170646 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170646_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5315 30.0 18.0 32.0 18.0 33.0 2 24.77275 25.0 18.0 30.0 18.0 33.0 3 28.43775 29.0 27.0 31.0 18.0 33.0 4 31.18275 33.0 31.0 33.0 29.0 33.0 5 32.0295 33.0 32.0 33.0 31.0 33.0 6 36.12725 38.0 36.0 38.0 33.0 38.0 7 36.6445 38.0 37.0 38.0 34.0 38.0 8 37.019 38.0 38.0 38.0 35.0 38.0 9 37.19625 38.0 38.0 38.0 36.0 38.0 10-14 37.234700000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.2961 38.0 38.0 38.0 36.8 38.0 20-24 37.45485 38.0 38.0 38.0 37.0 38.0 25-29 37.4324 38.0 38.0 38.0 37.0 38.0 30-34 37.43195000000001 38.0 38.0 38.0 37.2 38.0 35-39 37.423649999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.37320000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.3317 38.0 38.0 38.0 37.0 38.0 50-54 37.2419 38.0 38.0 38.0 36.6 38.0 55-59 37.138349999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.1613 38.0 38.0 38.0 36.0 38.0 65-69 37.0787 38.0 38.0 38.0 36.0 38.0 70-74 37.001400000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.867349999999995 38.0 38.0 38.0 35.2 38.0 80-84 36.8317 38.0 38.0 38.0 35.0 38.0 85-89 36.65795 38.0 38.0 38.0 34.8 38.0 90-94 36.5313 38.0 38.0 38.0 34.2 38.0 95-99 36.44775 38.0 37.6 38.0 34.0 38.0 100-104 36.280199999999994 38.0 37.2 38.0 33.6 38.0 105-109 36.1808 38.0 37.2 38.0 33.2 38.0 110-114 35.8884 38.0 36.8 38.0 32.0 38.0 115-119 35.622699999999995 38.0 36.0 38.0 31.0 38.0 120-124 35.471799999999995 38.0 36.0 38.0 29.8 38.0 125-129 35.22435 38.0 35.8 38.0 28.8 38.0 130-134 34.82275 38.0 34.8 38.0 27.4 38.0 135-139 34.52305 38.0 34.2 38.0 26.4 38.0 140-144 33.90075 38.0 33.2 38.0 24.2 38.0 145-149 32.9009 38.0 33.0 38.0 18.6 38.0 150-151 28.524124999999998 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 3.0 19 4.0 20 0.0 21 5.0 22 3.0 23 7.0 24 10.0 25 15.0 26 14.0 27 20.0 28 25.0 29 28.0 30 59.0 31 68.0 32 81.0 33 137.0 34 211.0 35 401.0 36 1035.0 37 1869.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.76473590201582 17.147231436590967 13.013523858127074 32.07450880326614 2 19.975 22.925 36.075 21.025 3 17.150000000000002 28.675 29.275000000000002 24.9 4 19.3 36.1 24.349999999999998 20.25 5 20.31523642732049 38.028521391043284 23.092319239429575 18.563922942206652 6 16.85 35.75 24.075 23.325000000000003 7 12.925 19.425 46.45 21.2 8 17.474999999999998 20.45 27.775 34.300000000000004 9 16.975 21.099999999999998 31.25 30.675 10-14 19.64 29.220000000000002 26.665 24.474999999999998 15-19 20.14 28.645 27.37 23.845 20-24 20.195 28.494999999999997 27.33 23.98 25-29 19.42 29.32 27.365000000000002 23.895 30-34 19.755 28.970000000000002 27.485 23.79 35-39 19.79 28.854999999999997 27.305 24.05 40-44 19.925 28.265 28.110000000000003 23.7 45-49 19.52 28.88 27.765 23.835 50-54 20.265 28.38 27.58 23.775 55-59 19.81 28.67 27.68 23.84 60-64 19.475 28.865000000000002 27.939999999999998 23.72 65-69 19.905 27.92 27.76 24.415 70-74 19.615 28.29 28.105000000000004 23.990000000000002 75-79 20.200000000000003 28.275 27.68 23.845 80-84 19.78 28.38 27.49 24.349999999999998 85-89 19.975 28.325 27.889999999999997 23.810000000000002 90-94 19.735 27.62 28.225 24.42 95-99 20.29 28.305000000000003 27.474999999999998 23.93 100-104 21.005 28.655 27.310000000000002 23.03 105-109 20.485 28.470000000000002 27.560000000000002 23.485 110-114 20.51 27.915 27.834999999999997 23.74 115-119 20.385 28.675 27.169999999999998 23.77 120-124 20.87 28.82 27.11 23.200000000000003 125-129 20.555 28.155 27.255000000000003 24.035 130-134 20.28 28.310000000000002 27.775 23.635 135-139 20.89 27.63 27.565 23.915 140-144 20.855 28.12 26.905 24.12 145-149 20.555 28.02 27.22 24.205 150-151 20.6625 28.249999999999996 27.800000000000004 23.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.5 18 0.5 19 0.5 20 2.0 21 2.0 22 1.0 23 1.0 24 0.5 25 2.0 26 7.5 27 8.0 28 12.5 29 17.5 30 18.0 31 26.0 32 37.0 33 48.0 34 54.5 35 68.5 36 101.0 37 140.0 38 152.0 39 155.0 40 176.5 41 205.5 42 235.5 43 246.5 44 252.0 45 257.0 46 257.5 47 242.5 48 225.0 49 214.5 50 184.5 51 151.0 52 116.0 53 95.0 54 77.0 55 53.0 56 42.0 57 30.0 58 22.0 59 20.0 60 16.0 61 8.0 62 4.5 63 4.0 64 1.0 65 0.5 66 1.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06447534766119 97.95 2 0.8343868520859671 1.6500000000000001 3 0.025284450063211124 0.075 4 0.05056890012642225 0.2 5 0.025284450063211124 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.575 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGATG 10 0.006836113 144.9625 145 >>END_MODULE SRR7170646 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170646_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61925 33.0 33.0 34.0 32.0 34.0 2 32.7695 33.0 33.0 34.0 32.0 34.0 3 32.801 33.0 33.0 34.0 32.0 34.0 4 32.70075 34.0 33.0 34.0 32.0 34.0 5 32.77775 34.0 33.0 34.0 32.0 34.0 6 36.8855 38.0 38.0 38.0 36.0 38.0 7 36.81875 38.0 38.0 38.0 36.0 38.0 8 36.87475 38.0 38.0 38.0 36.0 38.0 9 36.8655 38.0 38.0 38.0 36.0 38.0 10-14 36.9197 38.0 38.0 38.0 36.0 38.0 15-19 36.857600000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.78845 38.0 38.0 38.0 36.0 38.0 25-29 36.79765 38.0 38.0 38.0 36.0 38.0 30-34 36.71210000000001 38.0 38.0 38.0 35.8 38.0 35-39 36.7895 38.0 38.0 38.0 36.0 38.0 40-44 36.72005 38.0 38.0 38.0 35.8 38.0 45-49 36.682750000000006 38.0 38.0 38.0 35.6 38.0 50-54 36.4777 38.0 38.0 38.0 34.4 38.0 55-59 36.45545 38.0 38.0 38.0 34.4 38.0 60-64 36.4839 38.0 38.0 38.0 34.8 38.0 65-69 36.37295 38.0 38.0 38.0 34.4 38.0 70-74 36.337950000000006 38.0 38.0 38.0 34.0 38.0 75-79 36.30735 38.0 38.0 38.0 34.0 38.0 80-84 36.208749999999995 38.0 38.0 38.0 34.0 38.0 85-89 35.997299999999996 38.0 38.0 38.0 33.2 38.0 90-94 35.85635 38.0 37.4 38.0 32.6 38.0 95-99 35.7495 38.0 37.0 38.0 32.2 38.0 100-104 35.62235 38.0 37.0 38.0 31.0 38.0 105-109 35.48145 38.0 37.0 38.0 30.2 38.0 110-114 35.18575 38.0 36.4 38.0 28.6 38.0 115-119 35.08155 38.0 36.0 38.0 28.2 38.0 120-124 34.80135 38.0 35.6 38.0 27.8 38.0 125-129 34.40429999999999 38.0 34.8 38.0 25.4 38.0 130-134 33.94225 38.0 33.2 38.0 23.0 38.0 135-139 33.366 38.0 33.0 38.0 20.8 38.0 140-144 32.7539 38.0 33.0 38.0 14.4 38.0 145-149 31.56085 38.0 31.4 38.0 10.6 38.0 150-151 26.240875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 10.0 4 7.0 5 0.0 6 2.0 7 5.0 8 2.0 9 2.0 10 3.0 11 2.0 12 2.0 13 3.0 14 2.0 15 5.0 16 3.0 17 2.0 18 4.0 19 13.0 20 8.0 21 4.0 22 8.0 23 19.0 24 25.0 25 25.0 26 25.0 27 29.0 28 27.0 29 57.0 30 49.0 31 65.0 32 89.0 33 123.0 34 180.0 35 341.0 36 757.0 37 2094.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.55 17.299999999999997 14.575 26.575 2 24.075 23.599999999999998 33.300000000000004 19.025 3 20.025000000000002 26.150000000000002 33.75 20.075000000000003 4 23.825 34.825 21.349999999999998 20.0 5 23.125 36.625 21.7 18.55 6 17.442442442442445 38.41341341341341 23.523523523523522 20.62062062062062 7 16.112084063047284 17.538153615211407 44.33324993745309 22.016512384288216 8 19.88991743807856 21.591193395046286 27.89592194145609 30.62296722541906 9 20.240180135101326 22.792094070552913 28.971728796597446 27.995996997748314 10-14 22.466850137603203 28.43632724543407 27.175381536152116 21.92144108081061 15-19 22.72750012506879 27.179948971934564 28.815848716794235 21.276702186202414 20-24 22.64745610085547 28.060433238281057 27.805292911101105 21.48681774976237 25-29 22.788673203922354 27.936762057234343 27.541524914948965 21.733039823894337 30-34 22.468481088653192 28.146888132879727 28.046828096858118 21.337802681608967 35-39 22.520764535174624 28.399879915941156 27.934554187931553 21.144801360952666 40-44 23.393393393393396 28.073073073073076 27.32232232232232 21.21121121121121 45-49 22.184419872917395 28.35342972932406 27.848101265822784 21.614049131935758 50-54 22.64972231950768 27.56291589533196 28.79871916745885 20.988642617701505 55-59 22.86715036277208 27.74080560420315 27.8558919189392 21.536152114085564 60-64 23.202401801351012 27.585689266950215 28.101075806855143 21.110833124843634 65-69 22.961480740370185 27.573786893446723 27.838919459729865 21.625812906453227 70-74 22.60743408874881 28.075441492821053 27.850317674721097 21.46680674370904 75-79 22.831415707853928 28.07903951975988 27.693846923461727 21.39569784892446 80-84 22.957626694682077 28.10045525038771 27.33503426884787 21.606883786082346 85-89 23.283970382229338 27.821693015809483 27.896738042825696 20.99759855913548 90-94 23.062684476462053 28.33558457151433 27.28000400220121 21.321726949822402 95-99 23.08385031018611 27.736641985191113 27.78166900140084 21.397838703221932 100-104 23.670385750737978 27.82808825736729 27.98819232501126 20.513333666883472 105-109 23.567675756817614 27.965974480860645 27.8558919189392 20.610457843382537 110-114 23.330997898108297 27.890101090981883 27.299569612651386 21.479331398258434 115-119 23.131191834284 28.104673271289904 28.294806364455116 20.46932852997098 120-124 23.39637746422496 27.209046332432703 28.019613729610725 21.374962473731614 125-129 23.698959167333868 27.26681345076061 28.332666132906326 20.7015612489992 130-134 24.058043532649485 27.280460345258945 28.14610958218664 20.515386539904927 135-139 23.71871871871872 27.65765765765766 27.70770770770771 20.915915915915917 140-144 24.128954745694834 27.843412094513415 27.422907488986787 20.604725670804967 145-149 24.3685289851448 27.879757915270343 27.59965988095833 20.15205321862652 150-151 24.72809101137642 27.640955119389925 28.178522315289413 19.452431553944244 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 2.5 22 3.0 23 2.0 24 6.0 25 6.5 26 4.0 27 5.0 28 7.0 29 10.5 30 12.5 31 17.5 32 26.0 33 37.5 34 47.0 35 60.5 36 78.0 37 102.5 38 148.0 39 177.5 40 185.0 41 212.0 42 235.0 43 236.5 44 258.0 45 275.0 46 253.0 47 243.5 48 250.0 49 213.0 50 177.0 51 148.0 52 108.5 53 97.0 54 83.5 55 71.5 56 60.5 57 42.0 58 29.5 59 21.5 60 14.5 61 8.0 62 6.0 63 3.5 64 2.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.075 8 0.075 9 0.075 10-14 0.075 15-19 0.055 20-24 0.055 25-29 0.06 30-34 0.06 35-39 0.06999999999999999 40-44 0.1 45-49 0.065 50-54 0.065 55-59 0.075 60-64 0.075 65-69 0.05 70-74 0.055 75-79 0.05 80-84 0.055 85-89 0.06 90-94 0.055 95-99 0.06 100-104 0.065 105-109 0.075 110-114 0.09 115-119 0.06999999999999999 120-124 0.06999999999999999 125-129 0.08 130-134 0.075 135-139 0.1 140-144 0.12 145-149 0.034999999999999996 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8840984022318 97.475 2 0.8622875982754248 1.7000000000000002 3 0.20289119959421759 0.6 4 0.025361399949277198 0.1 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGGT 10 0.0068502324 144.8625 8 >>END_MODULE Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780645 spots for SRR7170646.sra Written 780645 spots for SRR7170646.sra Read 780651 spots for SRR7170646.sra Written 780651 spots for SRR7170646.sra SRR ids: ['SRR7170646.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5qd8e29j SRR7170646.sra spots: 15612906 blocks: [[1, 780645], [780646, 1561290], [1561291, 2341935], [2341936, 3122580], [3122581, 3903225], [3903226, 4683870], [4683871, 5464515], [5464516, 6245160], [6245161, 7025805], [7025806, 7806450], [7806451, 8587095], [8587096, 9367740], [9367741, 10148385], [10148386, 10929030], [10929031, 11709675], [11709676, 12490320], [12490321, 13270965], [13270966, 14051610], [14051611, 14832255], [14832256, 15612906]] SRR7170646 file size 5269001 SRR7170646 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170646 SRR7170646_1.fastq SRR7170646_2.fastq Input file: SRR7170646_1.fastq Paired file: SRR7170646_2.fastq trimmed: SRR7170646-trimmed-pair1.fastq, SRR7170646-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:48:10 2025 >> started Thu Feb 13 14:48:27 2025 >> done (16.893s) 15612906 read pairs processed; of these: 25775 ( 0.17%) short read pairs filtered out after trimming by size control 35361 ( 0.23%) empty read pairs filtered out after trimming by size control 15551770 (99.61%) read pairs available; of these: 8225687 (52.89%) trimmed read pairs available after processing 7326083 (47.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 4 0.00% 21 10 0.00% 22 13 0.00% 23 9 0.00% 24 9 0.00% 25 8 0.00% 26 3 0.00% 27 6 0.00% 28 11 0.00% 29 8 0.00% 30 13 0.00% 31 14 0.00% 32 10 0.00% 33 15 0.00% 34 13 0.00% 35 15 0.00% 36 10 0.00% 37 15 0.00% 38 16 0.00% 39 19 0.00% 40 17 0.00% 41 26 0.00% 42 25 0.00% 43 19 0.00% 44 29 0.00% 45 31 0.00% 46 32 0.00% 47 37 0.00% 48 40 0.00% 49 43 0.00% 50 54 0.00% 51 68 0.00% 52 72 0.00% 53 80 0.00% 54 82 0.00% 55 101 0.00% 56 93 0.00% 57 119 0.00% 58 128 0.00% 59 155 0.00% 60 168 0.00% 61 188 0.00% 62 203 0.00% 63 249 0.00% 64 226 0.00% 65 285 0.00% 66 311 0.00% 67 361 0.00% 68 395 0.00% 69 435 0.00% 70 502 0.00% 71 536 0.00% 72 659 0.00% 73 714 0.00% 74 801 0.01% 75 878 0.01% 76 1150 0.01% 77 1144 0.01% 78 1180 0.01% 79 1305 0.01% 80 1500 0.01% 81 1699 0.01% 82 2029 0.01% 83 2266 0.01% 84 3521 0.02% 85 4149 0.03% 86 4533 0.03% 87 4552 0.03% 88 4598 0.03% 89 5097 0.03% 90 5291 0.03% 91 5312 0.03% 92 5707 0.04% 93 6026 0.04% 94 6403 0.04% 95 6814 0.04% 96 7249 0.05% 97 7382 0.05% 98 7599 0.05% 99 8108 0.05% 100 8480 0.05% 101 8999 0.06% 102 9703 0.06% 103 10098 0.06% 104 10488 0.07% 105 11273 0.07% 106 11634 0.07% 107 11767 0.08% 108 12415 0.08% 109 13113 0.08% 110 13580 0.09% 111 14318 0.09% 112 15017 0.10% 113 16028 0.10% 114 16440 0.11% 115 16993 0.11% 116 17831 0.11% 117 18338 0.12% 118 19425 0.12% 119 19776 0.13% 120 20580 0.13% 121 21682 0.14% 122 22780 0.15% 123 24344 0.16% 124 25454 0.16% 125 26788 0.17% 126 28068 0.18% 127 29888 0.19% 128 31805 0.20% 129 32877 0.21% 130 34555 0.22% 131 36330 0.23% 132 39482 0.25% 133 42583 0.27% 134 46152 0.30% 135 49419 0.32% 136 53821 0.35% 137 59569 0.38% 138 65660 0.42% 139 73183 0.47% 140 81425 0.52% 141 92830 0.60% 142 107403 0.69% 143 127065 0.82% 144 149883 0.96% 145 185465 1.19% 146 236105 1.52% 147 328333 2.11% 148 510536 3.28% 149 1011131 6.50% 150 4241767 27.28% 151 7326083 47.11% 15551770 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.70 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=346.91 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAAT criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=18 prefix-density=0.79 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=29.46 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.7 sequence=GTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7170646 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:49:11 Started mapping on | Feb 13 14:49:12 Finished on | Feb 13 14:51:15 Mapping speed, Million of reads per hour | 455.17 Number of input reads | 15551770 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14544251 Uniquely mapped reads % | 93.52% Average mapped length | 295.09 Number of splices: Total | 14768473 Number of splices: Annotated (sjdb) | 14468009 Number of splices: GT/AG | 14492893 Number of splices: GC/AG | 227193 Number of splices: AT/AC | 8374 Number of splices: Non-canonical | 40013 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403639 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 26443 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 625748 625748 625748 N_multimapping 403639 403639 403639 N_noFeature 434546 14281235 512181 N_ambiguous 300551 821 114717 UnstrandedReadsAssigned:13809154 PositiveStrandReadsAssigned:262195 NegativeStrandReadsAssigned:13917353 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170646 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170646-trimmed-pair1.fastq SRR7170646-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,551,770 reads, 13,799,399 reads pseudoaligned [quant] estimated average fragment length: 290.954 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7170646.ke.tsv 34699 SRR7170646.se.tsv 87100 total ==> SRR7170646.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.05 607 20.8362 Potri.005G024800.1.v4.1 1035 745.046 240 19.1079 Potri.004G059700.1.v4.1 961 671.156 3 0.265145 Potri.007G009000.2.v4.1 1416 1126.05 0 0 Potri.003G141000.2.v4.1 2943 2653.05 711.38 15.9053 Potri.016G087400.1.v4.1 270 69.189 825 707.298 Potri.015G069301.1.v4.1 564 286.148 0 0 Potri.010G195200.1.v4.1 1773 1483.05 134 5.35964 Potri.012G127500.1.v4.1 977 687.11 58 5.00711 ==> SRR7170646.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 804 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 271 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 29 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170646 completed mapping pipeline successfully