Starting /dee2/code/volunteer_pipeline.sh SRR7170647 current disk space = 3089449525248 free memory = 1574103844 SRR7170647 SRAfilesize b8d2fab2b46a5560e8d09f8464ee1eb3 SRR7170647.sra SRR7170647.sra file validated SRR7170647 is paired end SRR7170647 is conventional basespace SRR7170647 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170647_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.48 18.0 18.0 31.0 18.0 33.0 2 29.0585 30.0 27.0 33.0 25.0 33.0 3 31.103 33.0 31.0 33.0 27.0 33.0 4 32.2645 33.0 33.0 33.0 31.0 34.0 5 32.8085 33.0 33.0 34.0 32.0 34.0 6 36.88275 38.0 37.0 38.0 35.0 38.0 7 37.13075 38.0 38.0 38.0 36.0 38.0 8 37.353 38.0 38.0 38.0 37.0 38.0 9 37.4295 38.0 38.0 38.0 37.0 38.0 10-14 37.39275 38.0 38.0 38.0 37.0 38.0 15-19 37.450900000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.533849999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.512 38.0 38.0 38.0 37.8 38.0 30-34 37.50170000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.478500000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.44645 38.0 38.0 38.0 37.0 38.0 45-49 37.413 38.0 38.0 38.0 37.0 38.0 50-54 37.2875 38.0 38.0 38.0 37.0 38.0 55-59 37.2447 38.0 38.0 38.0 36.6 38.0 60-64 37.18900000000001 38.0 38.0 38.0 36.2 38.0 65-69 37.1023 38.0 38.0 38.0 36.0 38.0 70-74 37.06745 38.0 38.0 38.0 36.0 38.0 75-79 36.99425 38.0 38.0 38.0 35.6 38.0 80-84 36.8962 38.0 38.0 38.0 35.6 38.0 85-89 36.80545 38.0 38.0 38.0 35.0 38.0 90-94 36.6305 38.0 38.0 38.0 34.4 38.0 95-99 36.52765 38.0 38.0 38.0 34.2 38.0 100-104 36.380250000000004 38.0 38.0 38.0 33.8 38.0 105-109 36.32 38.0 37.4 38.0 33.8 38.0 110-114 36.1364 38.0 37.0 38.0 33.4 38.0 115-119 35.823249999999994 38.0 36.8 38.0 32.0 38.0 120-124 35.63934999999999 38.0 36.2 38.0 31.0 38.0 125-129 35.63825 38.0 36.2 38.0 31.2 38.0 130-134 35.33305 38.0 36.0 38.0 30.6 38.0 135-139 35.055099999999996 38.0 35.6 38.0 28.2 38.0 140-144 34.442750000000004 38.0 34.2 38.0 26.8 38.0 145-149 33.67425 38.0 33.2 38.0 23.2 38.0 150-151 29.527499999999996 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 7.0 18 1.0 19 5.0 20 3.0 21 4.0 22 9.0 23 8.0 24 1.0 25 7.0 26 9.0 27 18.0 28 20.0 29 24.0 30 39.0 31 60.0 32 76.0 33 120.0 34 175.0 35 341.0 36 816.0 37 2255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.005067139599696 22.295414238662275 10.818343045350899 26.88117557638713 2 19.675 25.0 36.6 18.725 3 16.150000000000002 30.175 29.325000000000003 24.349999999999998 4 19.925 37.65 22.775000000000002 19.650000000000002 5 21.04078058543908 36.25218914185639 23.117338003502628 19.5896922692019 6 16.1 37.325 24.224999999999998 22.35 7 14.2 20.05 44.875 20.875 8 17.2 21.475 28.375 32.95 9 17.5 21.55 30.8 30.15 10-14 19.7 29.270000000000003 26.669999999999998 24.36 15-19 19.6 28.455000000000002 28.139999999999997 23.805 20-24 20.0 28.185 28.405 23.41 25-29 20.14 28.744999999999997 27.685 23.43 30-34 19.41 28.82 28.18 23.59 35-39 19.919999999999998 28.499999999999996 28.044999999999998 23.535 40-44 19.715 28.68 27.465 24.14 45-49 19.915 28.794999999999998 27.6 23.69 50-54 20.105 28.78 27.155 23.96 55-59 19.63 28.799999999999997 27.855 23.715 60-64 19.935 28.265 27.860000000000003 23.94 65-69 19.665 28.255000000000003 28.185 23.895 70-74 20.0 28.255000000000003 28.09 23.655 75-79 19.650000000000002 28.105000000000004 28.035 24.21 80-84 19.93 27.915 27.985 24.169999999999998 85-89 20.215 28.78 27.700000000000003 23.305 90-94 20.064999999999998 28.544999999999998 28.110000000000003 23.28 95-99 20.175 27.939999999999998 28.13 23.755000000000003 100-104 20.395 28.17 27.705000000000002 23.73 105-109 20.125 28.83 27.439999999999998 23.605 110-114 20.44 28.12 27.584999999999997 23.855 115-119 20.21 28.044999999999998 27.66 24.085 120-124 20.244999999999997 29.145 27.355 23.255 125-129 20.13 28.08 27.975 23.815 130-134 20.54 28.38 27.765 23.315 135-139 20.7 27.345000000000002 27.925 24.03 140-144 20.235 28.16 27.815 23.79 145-149 20.895 28.07 27.884999999999998 23.150000000000002 150-151 20.6176544136034 28.569642410602654 27.619404851212803 23.193298324581146 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.5 22 2.0 23 3.5 24 3.0 25 2.5 26 7.0 27 9.5 28 11.0 29 17.5 30 22.5 31 36.0 32 47.5 33 56.0 34 66.0 35 75.0 36 100.5 37 113.0 38 122.5 39 154.0 40 185.0 41 222.5 42 240.5 43 266.5 44 293.5 45 272.0 46 239.0 47 230.5 48 223.0 49 200.0 50 173.5 51 141.0 52 105.0 53 79.0 54 69.5 55 52.5 56 39.5 57 35.0 58 24.0 59 17.5 60 14.0 61 8.5 62 6.0 63 3.5 64 2.0 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24318869828456 98.35000000000001 2 0.6559031281533804 1.3 3 0.07568113017154389 0.22499999999999998 4 0.0 0.0 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2750000000000004 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.9124999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTACCA 10 0.006832588 144.9875 3 ATCACTC 10 0.006832588 144.9875 2 >>END_MODULE SRR7170647 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170647_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.453 33.0 33.0 34.0 31.0 34.0 2 32.61275 33.0 33.0 34.0 31.0 34.0 3 32.68875 34.0 33.0 34.0 32.0 34.0 4 32.52325 34.0 33.0 34.0 32.0 34.0 5 32.59475 34.0 33.0 34.0 32.0 34.0 6 36.58275 38.0 38.0 38.0 35.0 38.0 7 36.6305 38.0 38.0 38.0 35.0 38.0 8 36.6425 38.0 38.0 38.0 35.0 38.0 9 36.64425 38.0 38.0 38.0 35.0 38.0 10-14 36.6798 38.0 38.0 38.0 35.6 38.0 15-19 36.614 38.0 38.0 38.0 35.2 38.0 20-24 36.6577 38.0 38.0 38.0 35.8 38.0 25-29 36.597300000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.520050000000005 38.0 38.0 38.0 35.2 38.0 35-39 36.54025 38.0 38.0 38.0 35.4 38.0 40-44 36.53295 38.0 38.0 38.0 35.8 38.0 45-49 36.3992 38.0 38.0 38.0 35.0 38.0 50-54 36.39335 38.0 38.0 38.0 34.8 38.0 55-59 36.34825 38.0 38.0 38.0 34.8 38.0 60-64 36.3198 38.0 38.0 38.0 34.4 38.0 65-69 36.2415 38.0 38.0 38.0 34.0 38.0 70-74 36.22395 38.0 38.0 38.0 34.0 38.0 75-79 36.05604999999999 38.0 38.0 38.0 33.8 38.0 80-84 35.96635 38.0 38.0 38.0 33.6 38.0 85-89 35.9068 38.0 38.0 38.0 33.4 38.0 90-94 35.82299999999999 38.0 38.0 38.0 33.4 38.0 95-99 35.7008 38.0 37.8 38.0 33.0 38.0 100-104 35.46975 38.0 37.0 38.0 31.0 38.0 105-109 35.41655 38.0 37.0 38.0 31.4 38.0 110-114 35.12095 38.0 37.0 38.0 28.8 38.0 115-119 34.9832 38.0 36.2 38.0 28.0 38.0 120-124 34.873799999999996 38.0 36.0 38.0 28.0 38.0 125-129 34.4628 38.0 35.6 38.0 25.6 38.0 130-134 34.085699999999996 38.0 34.4 38.0 23.8 38.0 135-139 33.7831 38.0 33.6 38.0 22.2 38.0 140-144 33.274249999999995 38.0 33.0 38.0 18.8 38.0 145-149 32.36215 38.0 33.0 38.0 11.6 38.0 150-151 26.81625 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 9.0 4 6.0 5 11.0 6 6.0 7 5.0 8 3.0 9 7.0 10 6.0 11 3.0 12 6.0 13 3.0 14 4.0 15 4.0 16 6.0 17 5.0 18 5.0 19 8.0 20 9.0 21 9.0 22 7.0 23 12.0 24 18.0 25 12.0 26 25.0 27 21.0 28 34.0 29 36.0 30 59.0 31 62.0 32 101.0 33 110.0 34 142.0 35 257.0 36 651.0 37 2324.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.9 16.875 14.725 25.5 2 23.05 24.625 33.300000000000004 19.025 3 21.025 25.6 32.5 20.875 4 22.2 35.3 23.175 19.325 5 21.975 37.724999999999994 22.575 17.724999999999998 6 17.125 36.55 25.45 20.875 7 17.4 16.925 43.425000000000004 22.25 8 20.599999999999998 21.425 27.224999999999998 30.75 9 20.375 23.0 29.825000000000003 26.8 10-14 21.875 28.32 27.400000000000002 22.405 15-19 21.86 27.575 29.235 21.33 20-24 22.17 28.505000000000003 28.42 20.905 25-29 22.31 27.775 28.52 21.395 30-34 22.305 28.095 28.71 20.89 35-39 22.765 27.63 28.65 20.955 40-44 22.71 28.04 28.07 21.18 45-49 22.56 28.000000000000004 28.439999999999998 21.0 50-54 23.125 27.445000000000004 28.24 21.19 55-59 22.755 27.82 28.29 21.135 60-64 22.455 27.744999999999997 28.22 21.58 65-69 22.645 27.905 28.505000000000003 20.945 70-74 22.6 28.199999999999996 28.15 21.05 75-79 23.39 28.199999999999996 27.675 20.735 80-84 23.544999999999998 28.09 27.634999999999998 20.73 85-89 22.895 28.084999999999997 28.055000000000003 20.965 90-94 22.955000000000002 27.68 28.485 20.880000000000003 95-99 22.99 27.72 28.34 20.95 100-104 23.455000000000002 27.815 28.205000000000002 20.525 105-109 22.965 28.599999999999998 27.67 20.765 110-114 23.49 27.805000000000003 27.889999999999997 20.815 115-119 23.36 28.044999999999998 28.115000000000002 20.48 120-124 23.31 27.96 28.1 20.630000000000003 125-129 23.89 28.139999999999997 27.779999999999998 20.19 130-134 23.74 28.110000000000003 27.725 20.424999999999997 135-139 23.98 28.42 27.47 20.13 140-144 23.935000000000002 28.24 27.565 20.26 145-149 24.09 27.61 27.925 20.375 150-151 24.290536317039628 28.20352544068008 27.17839729966246 20.327540942617826 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 4.0 22 3.0 23 2.0 24 4.5 25 7.5 26 7.0 27 10.0 28 13.5 29 15.5 30 21.0 31 29.5 32 38.0 33 44.5 34 56.0 35 60.0 36 77.0 37 103.0 38 125.0 39 165.5 40 190.0 41 205.5 42 237.5 43 266.0 44 277.0 45 275.5 46 273.0 47 256.0 48 219.0 49 192.5 50 175.0 51 144.5 52 107.5 53 76.5 54 64.5 55 60.0 56 60.0 57 45.5 58 23.0 59 19.5 60 15.5 61 10.0 62 6.0 63 2.5 64 2.0 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6811301715438951 1.35 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.8875000000000002 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATTG 10 0.006830828 145.0 3 GATTGTT 10 0.006830828 145.0 7 AAGATTG 10 0.006830828 145.0 5 TCTTCCG 10 0.006830828 145.0 9 AATTGAA 10 0.006830828 145.0 5 >>END_MODULE Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979339 spots for SRR7170647.sra Written 979339 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra Read 979324 spots for SRR7170647.sra Written 979324 spots for SRR7170647.sra SRR ids: ['SRR7170647.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dosrj3lx SRR7170647.sra spots: 19586495 blocks: [[1, 979324], [979325, 1958648], [1958649, 2937972], [2937973, 3917296], [3917297, 4896620], [4896621, 5875944], [5875945, 6855268], [6855269, 7834592], [7834593, 8813916], [8813917, 9793240], [9793241, 10772564], [10772565, 11751888], [11751889, 12731212], [12731213, 13710536], [13710537, 14689860], [14689861, 15669184], [15669185, 16648508], [16648509, 17627832], [17627833, 18607156], [18607157, 19586495]] SRR7170647 file size 6615520 SRR7170647 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170647 SRR7170647_1.fastq SRR7170647_2.fastq Input file: SRR7170647_1.fastq Paired file: SRR7170647_2.fastq trimmed: SRR7170647-trimmed-pair1.fastq, SRR7170647-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:48:11 2025 >> started Thu Feb 13 14:48:34 2025 >> done (22.819s) 19586495 read pairs processed; of these: 34707 ( 0.18%) short read pairs filtered out after trimming by size control 34862 ( 0.18%) empty read pairs filtered out after trimming by size control 19516926 (99.64%) read pairs available; of these: 9597849 (49.18%) trimmed read pairs available after processing 9919077 (50.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 11 0.00% 21 19 0.00% 22 14 0.00% 23 11 0.00% 24 15 0.00% 25 16 0.00% 26 12 0.00% 27 24 0.00% 28 18 0.00% 29 13 0.00% 30 14 0.00% 31 23 0.00% 32 16 0.00% 33 12 0.00% 34 15 0.00% 35 26 0.00% 36 13 0.00% 37 20 0.00% 38 18 0.00% 39 26 0.00% 40 23 0.00% 41 28 0.00% 42 38 0.00% 43 35 0.00% 44 45 0.00% 45 43 0.00% 46 50 0.00% 47 54 0.00% 48 59 0.00% 49 76 0.00% 50 89 0.00% 51 88 0.00% 52 101 0.00% 53 125 0.00% 54 140 0.00% 55 155 0.00% 56 163 0.00% 57 166 0.00% 58 196 0.00% 59 179 0.00% 60 234 0.00% 61 255 0.00% 62 310 0.00% 63 335 0.00% 64 355 0.00% 65 411 0.00% 66 501 0.00% 67 467 0.00% 68 518 0.00% 69 612 0.00% 70 679 0.00% 71 755 0.00% 72 952 0.00% 73 1022 0.01% 74 1182 0.01% 75 1580 0.01% 76 2467 0.01% 77 2253 0.01% 78 1761 0.01% 79 1847 0.01% 80 2057 0.01% 81 2356 0.01% 82 2509 0.01% 83 3044 0.02% 84 4873 0.02% 85 5889 0.03% 86 6220 0.03% 87 6501 0.03% 88 6674 0.03% 89 7038 0.04% 90 7206 0.04% 91 7469 0.04% 92 8144 0.04% 93 8361 0.04% 94 8655 0.04% 95 9155 0.05% 96 9411 0.05% 97 9623 0.05% 98 10371 0.05% 99 10625 0.05% 100 11259 0.06% 101 11756 0.06% 102 12627 0.06% 103 13087 0.07% 104 13800 0.07% 105 14418 0.07% 106 15022 0.08% 107 15406 0.08% 108 15893 0.08% 109 16774 0.09% 110 17126 0.09% 111 18258 0.09% 112 18785 0.10% 113 19429 0.10% 114 20485 0.10% 115 21090 0.11% 116 21828 0.11% 117 22898 0.12% 118 23007 0.12% 119 23973 0.12% 120 25425 0.13% 121 26273 0.13% 122 27519 0.14% 123 29507 0.15% 124 30611 0.16% 125 31214 0.16% 126 32940 0.17% 127 34307 0.18% 128 36009 0.18% 129 37497 0.19% 130 39722 0.20% 131 41542 0.21% 132 44617 0.23% 133 48382 0.25% 134 51256 0.26% 135 54918 0.28% 136 59038 0.30% 137 63698 0.33% 138 69758 0.36% 139 77600 0.40% 140 87011 0.45% 141 99458 0.51% 142 115026 0.59% 143 132806 0.68% 144 158096 0.81% 145 193125 0.99% 146 251599 1.29% 147 352561 1.81% 148 553226 2.83% 149 1086611 5.57% 150 5202689 26.66% 151 9919077 50.82% 19516926 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=395.37 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=24 prefix-density=0.98 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=27.26 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.6 sequence=TGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGTACCTAAAACACCAAGAGGTTGCCCAAATCCTTACAA SRR7170647 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:49:16 Started mapping on | Feb 13 14:49:17 Finished on | Feb 13 14:51:15 Mapping speed, Million of reads per hour | 595.43 Number of input reads | 19516926 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18379007 Uniquely mapped reads % | 94.17% Average mapped length | 295.30 Number of splices: Total | 18618056 Number of splices: Annotated (sjdb) | 18199187 Number of splices: GT/AG | 18268435 Number of splices: GC/AG | 288608 Number of splices: AT/AC | 10821 Number of splices: Non-canonical | 50192 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 499320 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 52579 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 675863 675863 675863 N_multimapping 499320 499320 499320 N_noFeature 758558 18055354 864522 N_ambiguous 356665 1371 138133 UnstrandedReadsAssigned:17263784 PositiveStrandReadsAssigned:322282 NegativeStrandReadsAssigned:17376352 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170647 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170647-trimmed-pair1.fastq SRR7170647-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,516,926 reads, 17,219,486 reads pseudoaligned [quant] estimated average fragment length: 295.443 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR7170647.ke.tsv 34699 SRR7170647.se.tsv 87100 total ==> SRR7170647.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.56 1173 36.4496 Potri.005G024800.1.v4.1 1035 740.557 242 17.5016 Potri.004G059700.1.v4.1 961 666.775 19 1.52614 Potri.007G009000.2.v4.1 1416 1121.56 0 0 Potri.003G141000.2.v4.1 2943 2648.56 1218.99 24.6498 Potri.016G087400.1.v4.1 270 69.7473 783 601.25 Potri.015G069301.1.v4.1 564 284.869 0 0 Potri.010G195200.1.v4.1 1773 1478.56 28 1.01424 Potri.012G127500.1.v4.1 977 682.681 120 9.41421 ==> SRR7170647.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 869 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 37 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7170647 completed mapping pipeline successfully