Starting /dee2/code/volunteer_pipeline.sh SRR7170648 current disk space = 3089914060800 free memory = 1452495668 SRR7170648 SRAfilesize 573f9b3cdfbc676d4044e0b762c033c8 SRR7170648.sra SRR7170648.sra file validated SRR7170648 is paired end SRR7170648 is conventional basespace SRR7170648 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170648_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.21925 18.0 18.0 25.0 18.0 32.0 2 27.95 29.0 27.0 31.0 25.0 33.0 3 29.93425 31.0 29.0 33.0 27.0 33.0 4 31.64075 33.0 31.0 33.0 29.0 33.0 5 32.16375 33.0 33.0 33.0 31.0 33.0 6 36.31725 38.0 36.0 38.0 33.0 38.0 7 36.82625 38.0 37.0 38.0 34.0 38.0 8 37.19475 38.0 38.0 38.0 36.0 38.0 9 37.39875 38.0 38.0 38.0 37.0 38.0 10-14 37.397450000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.42995 38.0 38.0 38.0 37.0 38.0 20-24 37.54615 38.0 38.0 38.0 37.8 38.0 25-29 37.51174999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.436400000000006 38.0 38.0 38.0 37.4 38.0 35-39 37.4766 38.0 38.0 38.0 37.4 38.0 40-44 37.374900000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.380700000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.284800000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.20555 38.0 38.0 38.0 36.2 38.0 60-64 37.1958 38.0 38.0 38.0 36.0 38.0 65-69 37.0321 38.0 38.0 38.0 36.0 38.0 70-74 36.92415 38.0 38.0 38.0 35.6 38.0 75-79 36.800200000000004 38.0 38.0 38.0 34.8 38.0 80-84 36.8439 38.0 38.0 38.0 35.2 38.0 85-89 36.68815 38.0 38.0 38.0 34.6 38.0 90-94 36.4456 38.0 37.8 38.0 33.8 38.0 95-99 36.35875 38.0 37.2 38.0 34.0 38.0 100-104 36.121249999999996 38.0 37.0 38.0 33.0 38.0 105-109 36.107299999999995 38.0 37.0 38.0 33.2 38.0 110-114 35.94785 38.0 37.0 38.0 32.6 38.0 115-119 35.71405 38.0 36.4 38.0 31.0 38.0 120-124 35.69225 38.0 36.2 38.0 31.0 38.0 125-129 35.296 38.0 36.0 38.0 29.6 38.0 130-134 34.86825 38.0 35.0 38.0 27.8 38.0 135-139 34.16585 38.0 34.2 38.0 24.0 38.0 140-144 33.388149999999996 38.0 33.4 38.0 19.4 38.0 145-149 32.73895 38.0 33.2 38.0 15.2 38.0 150-151 28.896250000000002 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 3.0 18 2.0 19 2.0 20 2.0 21 9.0 22 5.0 23 5.0 24 10.0 25 13.0 26 21.0 27 27.0 28 34.0 29 28.0 30 47.0 31 61.0 32 73.0 33 124.0 34 207.0 35 396.0 36 979.0 37 1948.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.600413543551305 22.693202377875423 11.088136469371932 32.61824760920135 2 20.05 25.724999999999998 37.525 16.7 3 16.875 31.175000000000004 28.050000000000004 23.9 4 21.3 36.775000000000006 21.975 19.950000000000003 5 21.11055527763882 38.19409704852426 22.586293146573286 18.10905452726363 6 15.675 35.6 25.650000000000002 23.075000000000003 7 13.825000000000001 19.55 44.025 22.6 8 18.15 19.025 28.499999999999996 34.325 9 17.224999999999998 22.425 30.85 29.5 10-14 19.28 29.299999999999997 26.884999999999998 24.535 15-19 20.23 28.21 27.500000000000004 24.060000000000002 20-24 19.955000000000002 28.16 28.015 23.87 25-29 20.185 28.575 27.689999999999998 23.549999999999997 30-34 20.169999999999998 28.115000000000002 27.505000000000003 24.21 35-39 20.205000000000002 28.384999999999998 27.16 24.25 40-44 20.275000000000002 28.455000000000002 28.015 23.255 45-49 20.075000000000003 28.249999999999996 27.534999999999997 24.14 50-54 20.474999999999998 28.349999999999998 27.61 23.565 55-59 20.51 28.235 27.589999999999996 23.665 60-64 20.195 28.549999999999997 27.665 23.59 65-69 19.8 28.055000000000003 27.884999999999998 24.26 70-74 19.66 28.29 28.044999999999998 24.005000000000003 75-79 19.925 28.24 27.894999999999996 23.94 80-84 20.335 27.755000000000003 27.884999999999998 24.025 85-89 20.435 27.985 28.044999999999998 23.535 90-94 20.61 27.884999999999998 27.985 23.52 95-99 20.669999999999998 28.23 27.505000000000003 23.595 100-104 20.64 28.03 27.615000000000002 23.715 105-109 21.060000000000002 28.144999999999996 27.250000000000004 23.544999999999998 110-114 21.115000000000002 27.6 27.625 23.66 115-119 21.205 28.015 27.525 23.255 120-124 20.945 27.255000000000003 27.99 23.810000000000002 125-129 21.065 27.58 27.685 23.669999999999998 130-134 20.705000000000002 27.515 27.485 24.295 135-139 21.05 27.1 27.685 24.165 140-144 21.465 27.944999999999997 26.83 23.76 145-149 21.165 28.675 26.88 23.28 150-151 21.6 27.500000000000004 27.5875 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 2.0 24 2.5 25 3.0 26 7.5 27 10.5 28 11.0 29 15.5 30 21.5 31 24.5 32 32.5 33 49.0 34 55.0 35 69.5 36 91.0 37 102.0 38 119.5 39 147.5 40 179.0 41 219.0 42 243.0 43 261.5 44 280.5 45 264.5 46 250.0 47 258.5 48 240.0 49 216.5 50 193.0 51 141.5 52 106.5 53 95.0 54 78.5 55 55.0 56 41.0 57 31.5 58 21.5 59 18.0 60 14.0 61 7.0 62 6.0 63 3.5 64 0.5 65 1.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03919089759798 97.925 2 0.8343868520859671 1.6500000000000001 3 0.07585335018963338 0.22499999999999998 4 0.05056890012642225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.1 0.0 0.0 0.0 0.0 122-123 2.225 0.0 0.0 0.0 0.0 124-125 2.4749999999999996 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.1500000000000004 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.375 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGCA 10 0.0068343505 144.975 7 >>END_MODULE SRR7170648 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170648_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.726 33.0 33.0 34.0 32.0 34.0 2 32.76675 33.0 33.0 34.0 32.0 34.0 3 32.802 34.0 33.0 34.0 32.0 34.0 4 32.718 34.0 33.0 34.0 32.0 34.0 5 32.73825 34.0 33.0 34.0 32.0 34.0 6 36.94375 38.0 38.0 38.0 36.0 38.0 7 36.918 38.0 38.0 38.0 36.0 38.0 8 36.90675 38.0 38.0 38.0 36.0 38.0 9 36.85825 38.0 38.0 38.0 36.0 38.0 10-14 36.8814 38.0 38.0 38.0 36.0 38.0 15-19 36.784749999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.78515 38.0 38.0 38.0 36.0 38.0 25-29 36.74405 38.0 38.0 38.0 35.6 38.0 30-34 36.74980000000001 38.0 38.0 38.0 35.8 38.0 35-39 36.7428 38.0 38.0 38.0 36.0 38.0 40-44 36.737100000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.6466 38.0 38.0 38.0 35.6 38.0 50-54 36.64815 38.0 38.0 38.0 35.6 38.0 55-59 36.538500000000006 38.0 38.0 38.0 34.8 38.0 60-64 36.4844 38.0 38.0 38.0 34.2 38.0 65-69 36.456649999999996 38.0 38.0 38.0 34.4 38.0 70-74 36.4134 38.0 38.0 38.0 34.0 38.0 75-79 36.276149999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.14035 38.0 38.0 38.0 33.8 38.0 85-89 35.97125 38.0 38.0 38.0 33.2 38.0 90-94 35.9258 38.0 38.0 38.0 33.2 38.0 95-99 35.71375 38.0 37.2 38.0 31.8 38.0 100-104 35.4876 38.0 37.0 38.0 30.2 38.0 105-109 35.4404 38.0 37.0 38.0 30.6 38.0 110-114 35.328050000000005 38.0 37.0 38.0 29.8 38.0 115-119 35.09275 38.0 36.2 38.0 28.2 38.0 120-124 34.74550000000001 38.0 35.8 38.0 26.8 38.0 125-129 34.17545 38.0 34.6 38.0 23.2 38.0 130-134 33.788149999999995 38.0 33.2 38.0 22.2 38.0 135-139 33.42225 38.0 33.0 38.0 21.4 38.0 140-144 32.76955 38.0 33.0 38.0 16.0 38.0 145-149 31.62375 38.0 32.2 38.0 8.4 38.0 150-151 26.070999999999998 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 8.0 4 1.0 5 2.0 6 1.0 7 1.0 8 6.0 9 3.0 10 2.0 11 4.0 12 5.0 13 4.0 14 2.0 15 4.0 16 8.0 17 7.0 18 9.0 19 12.0 20 10.0 21 15.0 22 14.0 23 16.0 24 21.0 25 14.0 26 22.0 27 23.0 28 27.0 29 48.0 30 59.0 31 61.0 32 84.0 33 118.0 34 195.0 35 318.0 36 731.0 37 2137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.725 15.5 15.225 30.55 2 24.075 22.35 36.025 17.549999999999997 3 20.974999999999998 26.25 31.0 21.775 4 22.05 35.875 21.349999999999998 20.724999999999998 5 22.825 37.0 21.349999999999998 18.825 6 17.31731731731732 37.512512512512515 24.1991991991992 20.97097097097097 7 15.836877658243683 15.686765073805354 46.30973229922442 22.166624968726545 8 20.545545545545547 21.596596596596594 26.726726726726728 31.131131131131127 9 22.42242242242242 23.54854854854855 27.72772772772773 26.3013013013013 10-14 22.21221221221221 28.083083083083082 26.731731731731735 22.972972972972975 15-19 23.08231173380035 27.110332749562172 28.45634225669252 21.35101325994496 20-24 22.42008904006803 28.027612425591514 27.727477364814167 21.824821169526288 25-29 22.681340670335167 28.30915457728864 27.5887943971986 21.42071035517759 30-34 22.589200820697595 27.82865435620277 28.39913926837812 21.18300555472151 35-39 22.78778778778779 27.68268268268268 27.73773773773774 21.79179179179179 40-44 22.83783783783784 27.85785785785786 27.68268268268268 21.62162162162162 45-49 22.65812650120096 27.572057646116892 28.087469975980785 21.682345876701362 50-54 23.040368165674554 27.872542644189885 27.377319793907258 21.709769396228303 55-59 22.924485812941 27.44833108141921 27.588450182655254 22.038732922984536 60-64 22.810967677374162 28.499949964975485 26.868808165716 21.820274191934356 65-69 23.4332016205672 27.629670384634625 27.259540839293756 21.677587155504426 70-74 23.499699939987998 27.60552110422084 27.515503100620126 21.379275855171034 75-79 23.338168358925625 27.63967388586005 27.90476666833392 21.117391086880406 80-84 23.775943985996502 27.651912978244564 27.701925481370342 20.8702175543886 85-89 23.14347152072811 26.929039355903384 27.86417962694404 22.063309496424463 90-94 23.05615280764038 27.946397319865994 27.636381819090953 21.361068053402672 95-99 23.49 27.785 27.72 21.005 100-104 22.672267226722674 27.707770777077705 28.08780878087809 21.532153215321532 105-109 23.593257640174063 27.259540839293756 27.874756164657633 21.272445355874556 110-114 23.794276565939565 27.536521913147887 27.331398839303585 21.337802681608967 115-119 23.321660830415208 28.169084542271133 27.158579289644823 21.350675337668832 120-124 23.605901475368842 27.7569392348087 27.251812953238307 21.385346336584146 125-129 23.810000000000002 27.634999999999998 27.575 20.979999999999997 130-134 24.04221266379914 27.18815644693408 28.023407022106632 20.74622386716015 135-139 23.956560904814335 28.130317285557 27.22450205184666 20.688619757782003 140-144 23.922726590260748 27.421049997497622 27.796406586256943 20.859816825984687 145-149 24.526226311315565 27.426371318565927 27.1963598179909 20.85104255212761 150-151 24.474999999999998 27.875 27.400000000000002 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 1.0 23 1.0 24 2.0 25 1.5 26 2.0 27 5.0 28 9.0 29 9.5 30 13.0 31 21.0 32 27.0 33 34.0 34 48.0 35 63.5 36 76.0 37 89.0 38 112.5 39 144.5 40 172.5 41 213.5 42 242.0 43 252.0 44 266.5 45 283.5 46 274.0 47 237.0 48 227.5 49 222.0 50 207.0 51 157.5 52 110.0 53 94.5 54 83.5 55 72.5 56 52.0 57 42.5 58 35.5 59 32.5 60 22.0 61 12.5 62 8.5 63 2.0 64 3.0 65 3.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.075 8 0.1 9 0.1 10-14 0.1 15-19 0.075 20-24 0.045 25-29 0.05 30-34 0.08499999999999999 35-39 0.1 40-44 0.1 45-49 0.08 50-54 0.045 55-59 0.08499999999999999 60-64 0.06999999999999999 65-69 0.034999999999999996 70-74 0.02 75-79 0.034999999999999996 80-84 0.025 85-89 0.015 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.034999999999999996 110-114 0.06 115-119 0.05 120-124 0.025 125-129 0.0 130-134 0.03 135-139 0.09 140-144 0.095 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60015271061339 96.85000000000001 2 1.0435225248154747 2.0500000000000003 3 0.3054212267752609 0.8999999999999999 4 0.050903537795876815 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.1500000000000004 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.4000000000000004 0.0 0.0 0.0 0.0 136-137 3.7125000000000004 0.0 0.0 0.0 0.0 138-139 4.112500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923271 spots for SRR7170648.sra Written 923271 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra Read 923269 spots for SRR7170648.sra Written 923269 spots for SRR7170648.sra SRR ids: ['SRR7170648.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4y55bpiq SRR7170648.sra spots: 18465382 blocks: [[1, 923269], [923270, 1846538], [1846539, 2769807], [2769808, 3693076], [3693077, 4616345], [4616346, 5539614], [5539615, 6462883], [6462884, 7386152], [7386153, 8309421], [8309422, 9232690], [9232691, 10155959], [10155960, 11079228], [11079229, 12002497], [12002498, 12925766], [12925767, 13849035], [13849036, 14772304], [14772305, 15695573], [15695574, 16618842], [16618843, 17542111], [17542112, 18465382]] SRR7170648 file size 6235611 SRR7170648 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170648 SRR7170648_1.fastq SRR7170648_2.fastq Input file: SRR7170648_1.fastq Paired file: SRR7170648_2.fastq trimmed: SRR7170648-trimmed-pair1.fastq, SRR7170648-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:25:32 2025 >> started Thu Feb 13 14:25:52 2025 >> done (20.074s) 18465382 read pairs processed; of these: 22515 ( 0.12%) short read pairs filtered out after trimming by size control 20850 ( 0.11%) empty read pairs filtered out after trimming by size control 18422017 (99.77%) read pairs available; of these: 9464447 (51.38%) trimmed read pairs available after processing 8957570 (48.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 8 0.00% 21 6 0.00% 22 9 0.00% 23 6 0.00% 24 9 0.00% 25 8 0.00% 26 5 0.00% 27 7 0.00% 28 14 0.00% 29 10 0.00% 30 8 0.00% 31 10 0.00% 32 12 0.00% 33 8 0.00% 34 10 0.00% 35 18 0.00% 36 24 0.00% 37 25 0.00% 38 17 0.00% 39 10 0.00% 40 26 0.00% 41 25 0.00% 42 19 0.00% 43 31 0.00% 44 35 0.00% 45 38 0.00% 46 40 0.00% 47 50 0.00% 48 64 0.00% 49 69 0.00% 50 91 0.00% 51 88 0.00% 52 108 0.00% 53 122 0.00% 54 125 0.00% 55 117 0.00% 56 167 0.00% 57 158 0.00% 58 199 0.00% 59 199 0.00% 60 243 0.00% 61 284 0.00% 62 312 0.00% 63 353 0.00% 64 398 0.00% 65 409 0.00% 66 458 0.00% 67 533 0.00% 68 536 0.00% 69 668 0.00% 70 718 0.00% 71 849 0.00% 72 1044 0.01% 73 1219 0.01% 74 1326 0.01% 75 1540 0.01% 76 1895 0.01% 77 1892 0.01% 78 1823 0.01% 79 2044 0.01% 80 2258 0.01% 81 2547 0.01% 82 2863 0.02% 83 3317 0.02% 84 4409 0.02% 85 5101 0.03% 86 5615 0.03% 87 6332 0.03% 88 6037 0.03% 89 6251 0.03% 90 6616 0.04% 91 7160 0.04% 92 7447 0.04% 93 8302 0.05% 94 9008 0.05% 95 9290 0.05% 96 9495 0.05% 97 9628 0.05% 98 10026 0.05% 99 10596 0.06% 100 11047 0.06% 101 11674 0.06% 102 12609 0.07% 103 13214 0.07% 104 13977 0.08% 105 14666 0.08% 106 15210 0.08% 107 15564 0.08% 108 15906 0.09% 109 16681 0.09% 110 17054 0.09% 111 17832 0.10% 112 18800 0.10% 113 19707 0.11% 114 20825 0.11% 115 21232 0.12% 116 21998 0.12% 117 22818 0.12% 118 23470 0.13% 119 23657 0.13% 120 25040 0.14% 121 25842 0.14% 122 27251 0.15% 123 29773 0.16% 124 30480 0.17% 125 32093 0.17% 126 33818 0.18% 127 35303 0.19% 128 37307 0.20% 129 38415 0.21% 130 40180 0.22% 131 42121 0.23% 132 45495 0.25% 133 48209 0.26% 134 52235 0.28% 135 55754 0.30% 136 59895 0.33% 137 65654 0.36% 138 72370 0.39% 139 80535 0.44% 140 89287 0.48% 141 101196 0.55% 142 116808 0.63% 143 137494 0.75% 144 164552 0.89% 145 202910 1.10% 146 259423 1.41% 147 368384 2.00% 148 566251 3.07% 149 1133852 6.15% 150 4945730 26.85% 151 8957570 48.62% 18422017 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=15 prefix-density=0.97 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=22 fanout-score=33.09 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=10.6 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=1.47 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=20 prefix-density=1.47 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=89.59 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR7170648 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:26:38 Started mapping on | Feb 13 14:26:38 Finished on | Feb 13 14:28:26 Mapping speed, Million of reads per hour | 614.07 Number of input reads | 18422017 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17542644 Uniquely mapped reads % | 95.23% Average mapped length | 295.10 Number of splices: Total | 17339108 Number of splices: Annotated (sjdb) | 17008944 Number of splices: GT/AG | 16983580 Number of splices: GC/AG | 304796 Number of splices: AT/AC | 9427 Number of splices: Non-canonical | 41305 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485769 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 31200 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 412956 412956 412956 N_multimapping 485769 485769 485769 N_noFeature 516882 17302778 601152 N_ambiguous 278540 963 122339 UnstrandedReadsAssigned:16747222 PositiveStrandReadsAssigned:238903 NegativeStrandReadsAssigned:16819153 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170648 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170648-trimmed-pair1.fastq SRR7170648-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,422,017 reads, 16,792,844 reads pseudoaligned [quant] estimated average fragment length: 287.291 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR7170648.ke.tsv 34699 SRR7170648.se.tsv 87100 total ==> SRR7170648.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.71 426 14.4555 Potri.005G024800.1.v4.1 1035 748.709 102 8.00542 Potri.004G059700.1.v4.1 961 674.865 3 0.261217 Potri.007G009000.2.v4.1 1416 1129.71 0 0 Potri.003G141000.2.v4.1 2943 2656.71 591.262 13.0777 Potri.016G087400.1.v4.1 270 71.6928 619 507.356 Potri.015G069301.1.v4.1 564 290.395 0 0 Potri.010G195200.1.v4.1 1773 1486.71 4 0.1581 Potri.012G127500.1.v4.1 977 690.794 269 22.8824 ==> SRR7170648.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 57 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170648 completed mapping pipeline successfully