Starting /dee2/code/volunteer_pipeline.sh SRR7170649 current disk space = 3090095050752 free memory = 1413142756 SRR7170649 SRAfilesize 444023211ee8c93cc4bf9f3269997adc SRR7170649.sra SRR7170649.sra file validated SRR7170649 is paired end SRR7170649 is conventional basespace SRR7170649 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170649_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.668 18.0 18.0 27.0 18.0 33.0 2 27.829 29.0 27.0 31.0 18.0 33.0 3 29.843 31.0 29.0 33.0 25.0 33.0 4 31.5 33.0 31.0 33.0 29.0 33.0 5 32.1315 33.0 32.0 33.0 31.0 33.0 6 36.13975 38.0 36.0 38.0 33.0 38.0 7 36.77625 38.0 37.0 38.0 34.0 38.0 8 37.12925 38.0 38.0 38.0 36.0 38.0 9 37.34625 38.0 38.0 38.0 37.0 38.0 10-14 37.29715 38.0 38.0 38.0 36.8 38.0 15-19 37.2482 38.0 38.0 38.0 36.8 38.0 20-24 37.3992 38.0 38.0 38.0 37.0 38.0 25-29 37.34775 38.0 38.0 38.0 37.2 38.0 30-34 37.291900000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.282799999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.12095 38.0 38.0 38.0 36.6 38.0 45-49 37.14905 38.0 38.0 38.0 36.8 38.0 50-54 37.0093 38.0 38.0 38.0 36.0 38.0 55-59 36.862100000000005 38.0 38.0 38.0 35.4 38.0 60-64 36.91445 38.0 38.0 38.0 35.6 38.0 65-69 36.790000000000006 38.0 38.0 38.0 35.2 38.0 70-74 36.6072 38.0 38.0 38.0 34.6 38.0 75-79 36.27955 38.0 38.0 38.0 34.0 38.0 80-84 36.2046 38.0 38.0 38.0 34.0 38.0 85-89 35.98735 38.0 38.0 38.0 33.4 38.0 90-94 35.7866 38.0 37.2 38.0 32.2 38.0 95-99 35.7607 38.0 37.0 38.0 32.4 38.0 100-104 35.41295 38.0 37.0 38.0 29.8 38.0 105-109 35.446600000000004 38.0 37.0 38.0 30.6 38.0 110-114 35.35435 38.0 36.8 38.0 30.0 38.0 115-119 35.13005 38.0 36.0 38.0 28.8 38.0 120-124 34.95035 38.0 36.0 38.0 28.6 38.0 125-129 34.42615000000001 38.0 35.2 38.0 25.4 38.0 130-134 34.002050000000004 38.0 34.8 38.0 22.6 38.0 135-139 33.324799999999996 38.0 33.6 38.0 18.6 38.0 140-144 32.6725 38.0 33.0 38.0 15.4 38.0 145-149 32.0004 37.8 32.0 38.0 13.2 38.0 150-151 28.052500000000002 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 3.0 7 1.0 8 0.0 9 1.0 10 0.0 11 3.0 12 4.0 13 2.0 14 1.0 15 1.0 16 1.0 17 6.0 18 11.0 19 34.0 20 7.0 21 9.0 22 9.0 23 13.0 24 12.0 25 12.0 26 19.0 27 26.0 28 30.0 29 36.0 30 58.0 31 67.0 32 111.0 33 146.0 34 191.0 35 337.0 36 1002.0 37 1844.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.17453069507864 24.3531202435312 13.521055301877219 25.95129375951294 2 19.1 23.35 37.574999999999996 19.975 3 16.125 30.775000000000002 32.15 20.95 4 18.65 36.3 26.150000000000002 18.9 5 20.655163790947736 36.40910227556889 25.131282820705174 17.804451112778192 6 16.2 35.699999999999996 26.275 21.825 7 13.075000000000001 21.325 46.125 19.475 8 17.175 23.200000000000003 29.9 29.725 9 18.5 23.525 30.175 27.800000000000004 10-14 19.35 31.16 25.88 23.61 15-19 19.435 29.67 27.425 23.47 20-24 19.46 29.94 27.505000000000003 23.095 25-29 19.305 29.575000000000003 27.76 23.36 30-34 19.685 29.439999999999998 27.529999999999998 23.345 35-39 19.835 30.630000000000003 26.479999999999997 23.055 40-44 20.69 29.630000000000003 26.8 22.88 45-49 19.97 29.4 27.43 23.200000000000003 50-54 20.265 29.099999999999998 27.21 23.425 55-59 19.33 29.25 28.04 23.380000000000003 60-64 19.72 28.775000000000002 28.000000000000004 23.505000000000003 65-69 20.435 29.685 26.605 23.275000000000002 70-74 20.015 29.825000000000003 26.724999999999998 23.435 75-79 19.425 30.294999999999998 26.775 23.505000000000003 80-84 19.665 29.505 26.77 24.060000000000002 85-89 20.765 29.39 26.605 23.24 90-94 20.09 29.154999999999998 27.034999999999997 23.72 95-99 20.49 28.405 27.02 24.085 100-104 20.0 28.610000000000003 26.82 24.57 105-109 20.175 28.08 27.21 24.535 110-114 21.12 28.99 26.169999999999998 23.72 115-119 20.395 29.060000000000002 26.305 24.240000000000002 120-124 20.45 29.310000000000002 26.284999999999997 23.955000000000002 125-129 20.955 27.93 26.845000000000002 24.27 130-134 20.595 28.7 26.47 24.235 135-139 21.224999999999998 28.675 26.08 24.02 140-144 20.66 28.455000000000002 26.424999999999997 24.46 145-149 20.87 28.23 26.55 24.349999999999998 150-151 21.2875 27.5625 26.75 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.5 12 1.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.5 23 6.5 24 7.5 25 8.5 26 13.0 27 17.0 28 22.0 29 31.0 30 44.0 31 55.0 32 66.5 33 82.5 34 104.5 35 128.0 36 141.0 37 159.0 38 179.5 39 175.0 40 168.5 41 176.0 42 181.0 43 184.5 44 206.5 45 206.0 46 169.5 47 164.0 48 171.0 49 157.5 50 138.0 51 124.5 52 121.5 53 117.0 54 107.0 55 86.5 56 61.0 57 50.5 58 48.5 59 36.0 60 20.5 61 15.5 62 13.5 63 7.5 64 4.0 65 4.0 66 2.0 67 0.0 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 96.49723465894127 91.60000000000001 2 2.739004477218857 5.2 3 0.5530682117461154 1.575 4 0.15801948907031868 0.6 5 0.02633658151171978 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02633658151171978 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 36 0.8999999999999999 TruSeq Adapter, Index 3 (97% over 36bp) GATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.45 0.0 0.0 0.0 0.0 120-121 3.85 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.65 0.0 0.0 0.0 0.0 126-127 4.862500000000001 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.125 0.0 0.0 0.0 0.0 134-135 6.5875 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 7.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCTTC 10 0.006830828 145.0 3 TTCGCCA 10 0.006830828 145.0 7 TCGCCAC 10 0.006830828 145.0 8 CCTTCGC 10 0.006830828 145.0 5 CTTCGCC 10 0.006830828 145.0 6 GCCGCCT 10 0.006830828 145.0 1 >>END_MODULE SRR7170649 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170649_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63225 33.0 33.0 34.0 32.0 34.0 2 32.7005 33.0 33.0 34.0 32.0 34.0 3 32.70475 34.0 33.0 34.0 32.0 34.0 4 32.62825 34.0 33.0 34.0 32.0 34.0 5 32.591 34.0 33.0 34.0 32.0 34.0 6 36.73225 38.0 38.0 38.0 36.0 38.0 7 36.63675 38.0 38.0 38.0 36.0 38.0 8 36.674 38.0 38.0 38.0 36.0 38.0 9 36.6555 38.0 38.0 38.0 36.0 38.0 10-14 36.6429 38.0 38.0 38.0 35.8 38.0 15-19 36.558949999999996 38.0 38.0 38.0 35.4 38.0 20-24 36.50995 38.0 38.0 38.0 35.2 38.0 25-29 36.52395 38.0 38.0 38.0 35.4 38.0 30-34 36.44865 38.0 38.0 38.0 35.0 38.0 35-39 36.47535 38.0 38.0 38.0 35.4 38.0 40-44 36.4375 38.0 38.0 38.0 35.4 38.0 45-49 36.3649 38.0 38.0 38.0 35.0 38.0 50-54 36.3794 38.0 38.0 38.0 35.0 38.0 55-59 36.206450000000004 38.0 38.0 38.0 34.2 38.0 60-64 36.168549999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.14020000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.0751 38.0 38.0 38.0 34.0 38.0 75-79 36.000299999999996 38.0 38.0 38.0 33.8 38.0 80-84 35.5826 38.0 38.0 38.0 32.8 38.0 85-89 35.385 38.0 37.8 38.0 31.2 38.0 90-94 35.2555 38.0 37.6 38.0 30.8 38.0 95-99 35.04695 38.0 37.0 38.0 29.2 38.0 100-104 34.881099999999996 38.0 36.8 38.0 28.0 38.0 105-109 34.8071 38.0 37.0 38.0 28.0 38.0 110-114 34.694399999999995 38.0 36.6 38.0 27.4 38.0 115-119 34.349450000000004 38.0 35.8 38.0 25.0 38.0 120-124 34.2305 38.0 35.8 38.0 24.6 38.0 125-129 33.7148 38.0 34.8 38.0 20.2 38.0 130-134 33.3096 38.0 33.2 38.0 17.4 38.0 135-139 33.03425 38.0 33.0 38.0 14.6 38.0 140-144 32.425650000000005 38.0 33.0 38.0 12.8 38.0 145-149 31.3137 38.0 31.8 38.0 6.0 38.0 150-151 25.911375 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 12.0 4 8.0 5 4.0 6 5.0 7 4.0 8 5.0 9 5.0 10 7.0 11 6.0 12 6.0 13 7.0 14 3.0 15 11.0 16 12.0 17 7.0 18 17.0 19 16.0 20 25.0 21 8.0 22 12.0 23 5.0 24 21.0 25 11.0 26 25.0 27 25.0 28 28.0 29 40.0 30 63.0 31 61.0 32 90.0 33 96.0 34 158.0 35 264.0 36 695.0 37 2216.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.475 17.224999999999998 14.274999999999999 22.025 2 25.55 22.5 31.724999999999998 20.225 3 21.25 25.974999999999998 32.6 20.175 4 24.474999999999998 34.949999999999996 20.075000000000003 20.5 5 26.375 35.949999999999996 20.175 17.5 6 20.955238809702426 35.00875218804701 24.20605151287822 19.829957489372344 7 19.479869967491872 17.504376094023506 40.610152538134535 22.405601400350086 8 21.680420105026258 22.330582645661416 26.906726681670417 29.08227056764191 9 23.967975981986488 23.46760070052539 26.870152614460846 25.69427070302727 10-14 24.264705882352942 27.71608643457383 26.215486194477787 21.803721488595436 15-19 24.28607151787947 27.196799199799948 27.326831707926978 21.1902975743936 20-24 25.1025102510251 27.707770777077705 26.567656765676567 20.622062206220622 25-29 24.23121156057803 27.951397569878495 27.11635581779089 20.701035051752587 30-34 24.63115778944736 27.04176044011003 27.481870467616904 20.845211302825707 35-39 24.14207103551776 27.028514257128567 27.753876938469237 21.07553776888444 40-44 24.84987990392314 26.556244995996796 28.067453963170536 20.52642113690953 45-49 24.111027756939237 27.536884221055264 27.136784196049014 21.21530382595649 50-54 24.041202060103007 27.051352567628385 27.531376568828442 21.37606880344017 55-59 24.7749549909982 27.045409081816363 27.315463092618526 20.86417283456691 60-64 23.65854878231735 27.49412411861779 27.77916687503125 21.068160224033605 65-69 23.746187309365467 27.366368318415923 27.52637631881594 21.361068053402672 70-74 23.72 28.555000000000003 26.995 20.73 75-79 23.537353735373536 27.827782778277825 27.41774177417742 21.217121712171217 80-84 23.72737273727373 28.267826782678267 27.507750775077504 20.497049704970497 85-89 24.65123256162808 27.501375068753436 27.611380569028455 20.236011800590028 90-94 24.395 27.845 27.165 20.595 95-99 24.25 27.22 28.02 20.51 100-104 24.85 27.38 27.765 20.005 105-109 24.601230061503074 27.84639231961598 27.301365068253414 20.251012550627532 110-114 24.279855971194237 28.355671134226846 26.925385077015402 20.43908781756351 115-119 24.67870180527079 27.759163874581187 27.229084362654397 20.333049957493625 120-124 23.94 28.015 27.779999999999998 20.265 125-129 24.54 27.515 27.810000000000002 20.135 130-134 24.785 28.07 27.425 19.72 135-139 25.271317829457363 27.061765441360343 27.93198299574894 19.73493373343336 140-144 25.111277819454862 27.4368592148037 27.85696424106027 19.59489872468117 145-149 25.669999999999998 27.529999999999998 27.215 19.585 150-151 25.5 26.4125 27.625 20.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.5 16 1.5 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 1.5 25 2.0 26 2.5 27 7.0 28 9.0 29 9.5 30 19.5 31 24.5 32 24.5 33 34.5 34 58.0 35 73.5 36 78.0 37 102.0 38 126.5 39 145.5 40 162.5 41 168.5 42 190.5 43 200.0 44 216.5 45 231.0 46 214.5 47 238.0 48 245.0 49 206.5 50 182.0 51 150.5 52 129.0 53 134.0 54 132.5 55 126.0 56 101.5 57 71.5 58 52.5 59 35.5 60 25.0 61 17.0 62 14.0 63 9.0 64 4.5 65 3.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.075 10-14 0.04 15-19 0.025 20-24 0.01 25-29 0.005 30-34 0.025 35-39 0.05 40-44 0.08 45-49 0.025 50-54 0.005 55-59 0.02 60-64 0.015 65-69 0.005 70-74 0.0 75-79 0.01 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.02 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.025 140-144 0.025 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 96.723044397463 91.5 2 2.4841437632135306 4.7 3 0.5021141649048625 1.425 4 0.15856236786469344 0.6 5 0.026427061310782242 0.125 6 0.052854122621564484 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.052854122621564484 1.35 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 41 1.0250000000000001 Illumina Single End PCR Primer 1 (96% over 32bp) GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 13 0.325 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 6 0.15 No Hit GGAAGAGCTAGCATCTCTGACGAAAACAGCAGACGGAAAAGTACTGACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9875 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.15 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.199999999999999 0.0 0.0 0.0 0.0 124-125 4.6875 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.15 0.0 0.0 0.0 0.0 134-135 6.612500000000001 0.0 0.0 0.0 0.0 136-137 7.1 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATAAT 10 0.006843168 144.91249 1 >>END_MODULE Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485293 spots for SRR7170649.sra Written 485293 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra Read 485279 spots for SRR7170649.sra Written 485279 spots for SRR7170649.sra SRR ids: ['SRR7170649.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6t_knauq SRR7170649.sra spots: 9705594 blocks: [[1, 485279], [485280, 970558], [970559, 1455837], [1455838, 1941116], [1941117, 2426395], [2426396, 2911674], [2911675, 3396953], [3396954, 3882232], [3882233, 4367511], [4367512, 4852790], [4852791, 5338069], [5338070, 5823348], [5823349, 6308627], [6308628, 6793906], [6793907, 7279185], [7279186, 7764464], [7764465, 8249743], [8249744, 8735022], [8735023, 9220301], [9220302, 9705594]] SRR7170649 file size 3267781 SRR7170649 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170649 SRR7170649_1.fastq SRR7170649_2.fastq Input file: SRR7170649_1.fastq Paired file: SRR7170649_2.fastq trimmed: SRR7170649-trimmed-pair1.fastq, SRR7170649-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:04:32 2025 >> started Thu Feb 13 14:04:49 2025 >> done (17.057s) 9705594 read pairs processed; of these: 29191 ( 0.30%) short read pairs filtered out after trimming by size control 134242 ( 1.38%) empty read pairs filtered out after trimming by size control 9542161 (98.32%) read pairs available; of these: 5189220 (54.38%) trimmed read pairs available after processing 4352941 (45.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 16 0.00% 20 13 0.00% 21 10 0.00% 22 14 0.00% 23 15 0.00% 24 25 0.00% 25 14 0.00% 26 22 0.00% 27 21 0.00% 28 16 0.00% 29 20 0.00% 30 28 0.00% 31 26 0.00% 32 24 0.00% 33 15 0.00% 34 17 0.00% 35 16 0.00% 36 32 0.00% 37 33 0.00% 38 40 0.00% 39 31 0.00% 40 35 0.00% 41 41 0.00% 42 34 0.00% 43 64 0.00% 44 62 0.00% 45 87 0.00% 46 110 0.00% 47 124 0.00% 48 162 0.00% 49 155 0.00% 50 186 0.00% 51 175 0.00% 52 177 0.00% 53 223 0.00% 54 194 0.00% 55 227 0.00% 56 278 0.00% 57 291 0.00% 58 339 0.00% 59 374 0.00% 60 425 0.00% 61 441 0.00% 62 477 0.00% 63 535 0.01% 64 589 0.01% 65 671 0.01% 66 609 0.01% 67 646 0.01% 68 770 0.01% 69 826 0.01% 70 1014 0.01% 71 1160 0.01% 72 1530 0.02% 73 1740 0.02% 74 2083 0.02% 75 3581 0.04% 76 7229 0.08% 77 7649 0.08% 78 3468 0.04% 79 3052 0.03% 80 3100 0.03% 81 3236 0.03% 82 3700 0.04% 83 4136 0.04% 84 5649 0.06% 85 6352 0.07% 86 6837 0.07% 87 7439 0.08% 88 7287 0.08% 89 7155 0.07% 90 7563 0.08% 91 7806 0.08% 92 8458 0.09% 93 9145 0.10% 94 9244 0.10% 95 9891 0.10% 96 10267 0.11% 97 10271 0.11% 98 10533 0.11% 99 11198 0.12% 100 11489 0.12% 101 12111 0.13% 102 13200 0.14% 103 14286 0.15% 104 14668 0.15% 105 15340 0.16% 106 15624 0.16% 107 15646 0.16% 108 16241 0.17% 109 17310 0.18% 110 17230 0.18% 111 18005 0.19% 112 19297 0.20% 113 21188 0.22% 114 20863 0.22% 115 20806 0.22% 116 21413 0.22% 117 21304 0.22% 118 21956 0.23% 119 22188 0.23% 120 23082 0.24% 121 23696 0.25% 122 24464 0.26% 123 25471 0.27% 124 26383 0.28% 125 27213 0.29% 126 27890 0.29% 127 28409 0.30% 128 29587 0.31% 129 30546 0.32% 130 31297 0.33% 131 31478 0.33% 132 33673 0.35% 133 35265 0.37% 134 36600 0.38% 135 38763 0.41% 136 41202 0.43% 137 43715 0.46% 138 46185 0.48% 139 49547 0.52% 140 52502 0.55% 141 59101 0.62% 142 64831 0.68% 143 74369 0.78% 144 85780 0.90% 145 103612 1.09% 146 128757 1.35% 147 179151 1.88% 148 273378 2.86% 149 544561 5.71% 150 2426990 25.43% 151 4352941 45.62% 9542161 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=24 prefix-density=0.63 prefix-fanout=2.3 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=73.45 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.2 sequence=TTTTTTTTCTCGTTCTTTGGTCGCAATCCTGCGTAATCAACGCCGCAACTTTACGTCGGATTAGCTCTTCTTTGATTAGCATGAAACTCCAAGGTCCGGGGGGGTCACTTATCCTGGGCTTCATCCAATGGTGGGTGCTAACTCTTTAATAGCCTTCAGTGACTGTGAGATGCCGTCTACGAGTGGCACGAATCGCACGGATGTTTGGTTAAAGAACAGTCGCAGTTTTCCTCAAATCCCGCCACGAAACTAAGCGATTGAACTCTTGCCTGGTTACTGTATGCCCCTGTGTTATTGCAGCGTCTCGATTAGGGGGAAACCTTGTCACCGTCAGCTTATTCCCGAGGCATATGGCCCTACTTAACTGATCTGAAGTATTACGGTAACCGCGACGATAATAACCCGGACCAAATATAGCCTGATATGAGCGTGCCCGTCCATAGTCCCAGAGACGGGCGGAGGCTC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=16 prefix-density=0.95 prefix-fanout=2.8 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=34.11 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170649 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:06:10 Started mapping on | Feb 13 14:06:11 Finished on | Feb 13 14:13:10 Mapping speed, Million of reads per hour | 81.99 Number of input reads | 9542161 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 7168326 Uniquely mapped reads % | 75.12% Average mapped length | 291.52 Number of splices: Total | 5540528 Number of splices: Annotated (sjdb) | 5414814 Number of splices: GT/AG | 5416334 Number of splices: GC/AG | 99994 Number of splices: AT/AC | 4776 Number of splices: Non-canonical | 19424 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.59 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 208953 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 10108 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 22.48% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2183705 2183705 2183705 N_multimapping 208953 208953 208953 N_noFeature 182347 6953628 228273 N_ambiguous 225621 694 56505 UnstrandedReadsAssigned:6760358 PositiveStrandReadsAssigned:214004 NegativeStrandReadsAssigned:6883548 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170649 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170649-trimmed-pair1.fastq SRR7170649-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,542,161 reads, 6,886,594 reads pseudoaligned [quant] estimated average fragment length: 238.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52401 SRR7170649.ke.tsv 34699 SRR7170649.se.tsv 87100 total ==> SRR7170649.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.34 299 18.3406 Potri.005G024800.1.v4.1 1035 797.337 130 17.8052 Potri.004G059700.1.v4.1 961 723.343 4 0.603893 Potri.007G009000.2.v4.1 1416 1178.34 0 0 Potri.003G141000.2.v4.1 2943 2705.34 394 15.9045 Potri.016G087400.1.v4.1 270 81.449 228 305.699 Potri.015G069301.1.v4.1 564 329.431 0 0 Potri.010G195200.1.v4.1 1773 1535.34 18 1.2803 Potri.012G127500.1.v4.1 977 739.343 61 9.01007 ==> SRR7170649.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 304 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 27 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7170649 completed mapping pipeline successfully