Starting /dee2/code/volunteer_pipeline.sh SRR7170650 current disk space = 3090020470784 free memory = 1398977084 SRR7170650 SRAfilesize 6a5beecd886d21ae2314e12916509327 SRR7170650.sra SRR7170650.sra file validated SRR7170650 is paired end SRR7170650 is conventional basespace SRR7170650 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170650_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.317 18.0 18.0 25.0 18.0 33.0 2 27.49525 28.0 25.0 31.0 18.0 33.0 3 30.1075 31.0 29.0 33.0 27.0 33.0 4 31.60425 33.0 31.0 33.0 29.0 33.0 5 32.34375 33.0 33.0 33.0 32.0 34.0 6 36.4675 38.0 37.0 38.0 34.0 38.0 7 36.98625 38.0 38.0 38.0 35.0 38.0 8 37.2165 38.0 38.0 38.0 36.0 38.0 9 37.3385 38.0 38.0 38.0 37.0 38.0 10-14 37.3395 38.0 38.0 38.0 36.8 38.0 15-19 37.404199999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.5125 38.0 38.0 38.0 37.4 38.0 25-29 37.45375 38.0 38.0 38.0 37.2 38.0 30-34 37.43145 38.0 38.0 38.0 37.0 38.0 35-39 37.38955 38.0 38.0 38.0 37.0 38.0 40-44 37.380849999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.34485000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.20805 38.0 38.0 38.0 36.4 38.0 55-59 37.08655 38.0 38.0 38.0 36.0 38.0 60-64 37.086349999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.99855 38.0 38.0 38.0 35.8 38.0 70-74 36.88235 38.0 38.0 38.0 35.2 38.0 75-79 36.873799999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.78625 38.0 38.0 38.0 34.8 38.0 85-89 36.6218 38.0 38.0 38.0 34.2 38.0 90-94 36.495 38.0 37.6 38.0 34.2 38.0 95-99 36.402249999999995 38.0 37.6 38.0 33.8 38.0 100-104 36.242000000000004 38.0 37.0 38.0 33.8 38.0 105-109 36.13995 38.0 37.0 38.0 33.2 38.0 110-114 35.83895 38.0 37.0 38.0 31.8 38.0 115-119 35.6274 38.0 36.2 38.0 31.0 38.0 120-124 35.39915 38.0 36.0 38.0 29.4 38.0 125-129 35.1357 38.0 35.6 38.0 28.2 38.0 130-134 34.83295 38.0 35.0 38.0 28.0 38.0 135-139 34.55655 38.0 34.2 38.0 27.4 38.0 140-144 33.8822 38.0 33.2 38.0 23.2 38.0 145-149 32.957800000000006 38.0 33.0 38.0 19.4 38.0 150-151 28.532375000000002 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 0.0 16 3.0 17 0.0 18 3.0 19 3.0 20 5.0 21 3.0 22 2.0 23 4.0 24 11.0 25 15.0 26 13.0 27 21.0 28 24.0 29 49.0 30 29.0 31 56.0 32 87.0 33 124.0 34 234.0 35 382.0 36 1075.0 37 1852.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.73052362707535 23.34610472541507 11.519795657726691 28.403575989782887 2 20.9 24.45 36.675000000000004 17.974999999999998 3 15.275 32.625 28.199999999999996 23.9 4 20.0 35.65 24.224999999999998 20.125 5 20.075000000000003 36.425000000000004 24.224999999999998 19.275000000000002 6 17.95 35.225 24.45 22.375 7 13.4 19.35 45.074999999999996 22.175 8 17.825 21.5 28.95 31.724999999999998 9 17.9 21.425 30.275000000000002 30.4 10-14 19.355 29.28 27.26 24.104999999999997 15-19 20.275000000000002 28.799999999999997 27.675 23.25 20-24 19.72 28.82 28.025 23.435 25-29 19.650000000000002 28.660000000000004 28.345 23.345 30-34 19.875 28.910000000000004 27.405 23.810000000000002 35-39 20.36 28.765 27.415 23.46 40-44 19.82 28.455000000000002 28.12 23.605 45-49 20.115 28.425 28.03 23.43 50-54 20.119999999999997 28.435 27.655 23.79 55-59 19.805 28.675 27.92 23.599999999999998 60-64 20.495 28.360000000000003 27.58 23.565 65-69 19.415 28.475 28.03 24.08 70-74 20.41 27.855 27.83 23.905 75-79 19.45 28.515 28.144999999999996 23.89 80-84 19.975 27.375 28.62 24.03 85-89 20.23 28.42 27.915 23.435 90-94 20.244999999999997 27.860000000000003 28.084999999999997 23.810000000000002 95-99 19.875 28.360000000000003 27.85 23.915 100-104 20.349999999999998 28.1 27.565 23.985 105-109 20.345 28.02 27.800000000000004 23.835 110-114 20.244999999999997 28.315 27.615000000000002 23.825 115-119 19.73 28.26 27.925 24.085 120-124 20.75 28.144999999999996 27.200000000000003 23.905 125-129 20.085 28.37 27.735 23.810000000000002 130-134 20.73 28.265 27.279999999999998 23.724999999999998 135-139 20.485 27.965 27.944999999999997 23.605 140-144 20.755000000000003 28.23 27.395000000000003 23.62 145-149 20.23 28.144999999999996 27.98 23.645 150-151 21.375 27.3125 27.025 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 1.0 20 1.0 21 0.5 22 2.0 23 5.5 24 5.0 25 4.0 26 5.5 27 7.0 28 10.0 29 14.0 30 21.0 31 32.0 32 32.0 33 46.0 34 67.0 35 68.5 36 81.5 37 116.5 38 137.0 39 160.5 40 209.0 41 236.0 42 243.0 43 257.5 44 275.0 45 277.0 46 264.5 47 255.0 48 235.0 49 199.0 50 170.0 51 132.0 52 101.0 53 79.5 54 56.5 55 48.0 56 38.0 57 33.5 58 24.5 59 11.5 60 10.0 61 6.5 62 4.0 63 4.5 64 2.5 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.2125000000000004 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.7125 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCCTC 10 0.0068343505 144.975 3 >>END_MODULE SRR7170650 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170650_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62975 33.0 33.0 34.0 32.0 34.0 2 32.6845 33.0 33.0 34.0 32.0 34.0 3 32.74075 33.0 33.0 34.0 32.0 34.0 4 32.69675 33.0 33.0 34.0 32.0 34.0 5 32.7185 34.0 33.0 34.0 32.0 34.0 6 36.83875 38.0 38.0 38.0 35.0 38.0 7 36.91375 38.0 38.0 38.0 36.0 38.0 8 36.8455 38.0 38.0 38.0 36.0 38.0 9 36.841 38.0 38.0 38.0 36.0 38.0 10-14 36.825149999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.807900000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.77035 38.0 38.0 38.0 36.0 38.0 25-29 36.728750000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.7379 38.0 38.0 38.0 35.8 38.0 35-39 36.73055 38.0 38.0 38.0 35.8 38.0 40-44 36.66915 38.0 38.0 38.0 35.6 38.0 45-49 36.60510000000001 38.0 38.0 38.0 35.0 38.0 50-54 36.544349999999994 38.0 38.0 38.0 34.8 38.0 55-59 36.41165 38.0 38.0 38.0 34.2 38.0 60-64 36.4565 38.0 38.0 38.0 34.4 38.0 65-69 36.3568 38.0 38.0 38.0 34.0 38.0 70-74 36.3054 38.0 38.0 38.0 34.0 38.0 75-79 36.244150000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.12885 38.0 38.0 38.0 34.0 38.0 85-89 36.0201 38.0 38.0 38.0 33.2 38.0 90-94 35.83095 38.0 37.0 38.0 32.6 38.0 95-99 35.66330000000001 38.0 37.0 38.0 31.8 38.0 100-104 35.467999999999996 38.0 37.0 38.0 30.6 38.0 105-109 35.371050000000004 38.0 36.8 38.0 30.0 38.0 110-114 35.1118 38.0 36.2 38.0 28.4 38.0 115-119 34.84224999999999 38.0 36.0 38.0 27.4 38.0 120-124 34.62085 38.0 35.2 38.0 27.0 38.0 125-129 34.1403 38.0 34.8 38.0 24.0 38.0 130-134 33.62595 38.0 33.0 38.0 21.0 38.0 135-139 33.10895000000001 38.0 33.0 38.0 18.4 38.0 140-144 32.437850000000005 38.0 33.0 38.0 13.4 38.0 145-149 31.291199999999996 37.4 30.8 38.0 8.4 38.0 150-151 26.132875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 13.0 4 3.0 5 1.0 6 1.0 7 4.0 8 1.0 9 6.0 10 5.0 11 2.0 12 0.0 13 6.0 14 3.0 15 6.0 16 6.0 17 2.0 18 8.0 19 8.0 20 4.0 21 9.0 22 10.0 23 16.0 24 15.0 25 31.0 26 20.0 27 24.0 28 37.0 29 41.0 30 57.0 31 70.0 32 101.0 33 140.0 34 190.0 35 362.0 36 792.0 37 1996.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.8 17.1 14.549999999999999 25.55 2 23.925 23.05 33.95 19.075 3 20.625 26.1 33.074999999999996 20.200000000000003 4 22.8 34.449999999999996 23.3 19.45 5 22.575 38.65 22.225 16.55 6 17.555722514400202 37.91635361883296 24.64312546957175 19.88479839719509 7 17.192192192192195 16.116116116116117 46.171171171171174 20.52052052052052 8 19.249061326658325 23.329161451814766 26.733416770963704 30.688360450563202 9 20.92092092092092 24.5995995995996 28.97897897897898 25.5005005005005 10-14 22.375732091905693 28.362617009561 27.671822595985386 21.589828302547932 15-19 22.897172879659745 27.50562922191644 28.241180885664246 21.35601701275957 20-24 22.758206565252202 28.747998398718977 27.562049639711773 20.93174539631705 25-29 22.77549794815334 27.995195676108498 28.54569112200981 20.683615253728355 30-34 22.500250225202684 27.835051546391753 28.555700130117106 21.10899809828846 35-39 22.662662662662665 28.468468468468465 27.42242242242242 21.446446446446448 40-44 22.688570569968945 28.77391565661625 27.356506060302515 21.18100771311229 45-49 22.008108513939636 28.01441513589269 28.62505630912458 21.352420041043096 50-54 22.840124136550205 28.100911002102315 27.665431975172687 21.393532886174793 55-59 22.29787234042553 28.44055068836045 27.789737171464328 21.471839799749688 60-64 23.314142678347935 27.60450563204005 27.939924906132667 21.14142678347935 65-69 22.858715229137484 27.70662397438463 28.607164298579146 20.82749649789874 70-74 23.191233863704593 28.35985189632743 27.509256479535676 20.939657760432304 75-79 22.49962475609146 27.83309150948116 28.578576074448392 21.088707659978986 80-84 22.682011508631476 27.88091068301226 28.36627470602952 21.070803102326746 85-89 23.288630904723778 28.557846277021614 27.321857485988794 20.83166533226581 90-94 23.208566853482786 27.522017614091272 27.982385908726982 21.28702962369896 95-99 23.251275893125186 27.56429500650455 28.039627739417593 21.144801360952666 100-104 23.424911174498323 28.09888405144373 27.718560776660162 20.757643997397786 105-109 23.470511665164715 27.896265144688094 27.63592670471613 20.99729648543106 110-114 23.024536805207813 28.03204807210816 27.691537305958942 21.251877816725088 115-119 23.04534988487336 28.000800880969066 27.97076784462909 20.983081389528483 120-124 23.729916412232843 28.199609590069574 27.784173382051154 20.28630061564643 125-129 23.431632704150605 27.93771591648726 27.79752666099234 20.8331247183698 130-134 23.246733743805375 27.952144966711717 27.867047104169796 20.934074185313108 135-139 24.092343131854374 27.92328108568281 27.773048224748358 20.211327557714455 140-144 23.79020138262699 27.47720669271616 28.073339344755034 20.659252579901814 145-149 24.003201760968533 27.770273650507782 27.650207614187806 20.576316974335885 150-151 23.605901475368842 27.031757939484873 28.95723930982746 20.40510127531883 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 2.0 20 2.0 21 1.5 22 1.5 23 2.5 24 4.5 25 6.0 26 7.5 27 9.0 28 10.5 29 11.5 30 15.0 31 23.0 32 33.5 33 36.5 34 49.0 35 75.5 36 94.0 37 114.0 38 131.0 39 158.5 40 197.0 41 218.0 42 250.5 43 265.5 44 266.0 45 273.0 46 261.0 47 240.0 48 220.5 49 201.0 50 165.0 51 128.5 52 99.5 53 84.0 54 78.5 55 62.0 56 52.5 57 44.5 58 29.5 59 22.0 60 15.0 61 9.5 62 7.5 63 5.5 64 3.0 65 1.5 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.17500000000000002 7 0.1 8 0.125 9 0.1 10-14 0.11499999999999999 15-19 0.075 20-24 0.08 25-29 0.09 30-34 0.09 35-39 0.1 40-44 0.16999999999999998 45-49 0.105 50-54 0.11 55-59 0.125 60-64 0.125 65-69 0.06 70-74 0.06999999999999999 75-79 0.065 80-84 0.075 85-89 0.08 90-94 0.08 95-99 0.06999999999999999 100-104 0.08499999999999999 105-109 0.13 110-114 0.15 115-119 0.11 120-124 0.105 125-129 0.135 130-134 0.11499999999999999 135-139 0.155 140-144 0.19 145-149 0.055 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7070707070707071 1.4000000000000001 3 0.15151515151515152 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.2999999999999998 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.2874999999999996 0.0 0.0 0.0 0.0 130-131 2.4000000000000004 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.8125 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGATT 10 0.006830828 145.0 2 >>END_MODULE Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867996 spots for SRR7170650.sra Written 867996 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra Read 867979 spots for SRR7170650.sra Written 867979 spots for SRR7170650.sra SRR ids: ['SRR7170650.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cz34aky3 SRR7170650.sra spots: 17359597 blocks: [[1, 867979], [867980, 1735958], [1735959, 2603937], [2603938, 3471916], [3471917, 4339895], [4339896, 5207874], [5207875, 6075853], [6075854, 6943832], [6943833, 7811811], [7811812, 8679790], [8679791, 9547769], [9547770, 10415748], [10415749, 11283727], [11283728, 12151706], [12151707, 13019685], [13019686, 13887664], [13887665, 14755643], [14755644, 15623622], [15623623, 16491601], [16491602, 17359597]] SRR7170650 file size 5860897 SRR7170650 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170650 SRR7170650_1.fastq SRR7170650_2.fastq Input file: SRR7170650_1.fastq Paired file: SRR7170650_2.fastq trimmed: SRR7170650-trimmed-pair1.fastq, SRR7170650-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:17:42 2025 >> started Thu Feb 13 14:18:01 2025 >> done (18.716s) 17359597 read pairs processed; of these: 30936 ( 0.18%) short read pairs filtered out after trimming by size control 31341 ( 0.18%) empty read pairs filtered out after trimming by size control 17297320 (99.64%) read pairs available; of these: 9324025 (53.90%) trimmed read pairs available after processing 7973295 (46.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 9 0.00% 21 7 0.00% 22 11 0.00% 23 12 0.00% 24 6 0.00% 25 13 0.00% 26 16 0.00% 27 11 0.00% 28 12 0.00% 29 9 0.00% 30 5 0.00% 31 9 0.00% 32 9 0.00% 33 15 0.00% 34 16 0.00% 35 29 0.00% 36 10 0.00% 37 12 0.00% 38 15 0.00% 39 20 0.00% 40 25 0.00% 41 20 0.00% 42 28 0.00% 43 29 0.00% 44 44 0.00% 45 29 0.00% 46 44 0.00% 47 57 0.00% 48 60 0.00% 49 68 0.00% 50 77 0.00% 51 76 0.00% 52 73 0.00% 53 96 0.00% 54 115 0.00% 55 117 0.00% 56 124 0.00% 57 141 0.00% 58 133 0.00% 59 155 0.00% 60 204 0.00% 61 247 0.00% 62 232 0.00% 63 290 0.00% 64 328 0.00% 65 348 0.00% 66 376 0.00% 67 420 0.00% 68 490 0.00% 69 514 0.00% 70 623 0.00% 71 713 0.00% 72 802 0.00% 73 880 0.01% 74 1059 0.01% 75 1228 0.01% 76 1597 0.01% 77 1624 0.01% 78 1482 0.01% 79 1714 0.01% 80 1934 0.01% 81 2106 0.01% 82 2422 0.01% 83 2728 0.02% 84 4158 0.02% 85 5076 0.03% 86 5311 0.03% 87 5454 0.03% 88 5696 0.03% 89 5869 0.03% 90 6163 0.04% 91 6514 0.04% 92 6730 0.04% 93 7304 0.04% 94 7644 0.04% 95 8043 0.05% 96 8280 0.05% 97 8493 0.05% 98 8963 0.05% 99 9427 0.05% 100 9939 0.06% 101 10619 0.06% 102 11056 0.06% 103 11750 0.07% 104 12401 0.07% 105 12773 0.07% 106 13529 0.08% 107 13974 0.08% 108 14393 0.08% 109 14986 0.09% 110 15796 0.09% 111 16600 0.10% 112 17446 0.10% 113 18214 0.11% 114 18936 0.11% 115 19755 0.11% 116 20296 0.12% 117 21096 0.12% 118 22051 0.13% 119 22375 0.13% 120 24006 0.14% 121 25168 0.15% 122 26201 0.15% 123 28413 0.16% 124 29538 0.17% 125 31023 0.18% 126 32611 0.19% 127 34831 0.20% 128 37005 0.21% 129 37963 0.22% 130 40290 0.23% 131 42862 0.25% 132 46249 0.27% 133 49424 0.29% 134 53894 0.31% 135 58087 0.34% 136 63041 0.36% 137 70224 0.41% 138 76779 0.44% 139 85854 0.50% 140 96239 0.56% 141 109958 0.64% 142 126387 0.73% 143 148313 0.86% 144 175276 1.01% 145 217865 1.26% 146 276841 1.60% 147 382850 2.21% 148 590613 3.41% 149 1156943 6.69% 150 4696038 27.15% 151 7973295 46.10% 17297320 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=14 prefix-density=0.69 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=28.04 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.0 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=14 prefix-density=0.92 prefix-fanout=2.5 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=113.12 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170650 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:18:44 Started mapping on | Feb 13 14:18:45 Finished on | Feb 13 14:20:33 Mapping speed, Million of reads per hour | 576.58 Number of input reads | 17297320 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16254535 Uniquely mapped reads % | 93.97% Average mapped length | 294.73 Number of splices: Total | 16443003 Number of splices: Annotated (sjdb) | 16086967 Number of splices: GT/AG | 16123720 Number of splices: GC/AG | 264041 Number of splices: AT/AC | 9401 Number of splices: Non-canonical | 45841 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465952 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 54595 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 602964 602964 602964 N_multimapping 465952 465952 465952 N_noFeature 577014 16026521 663816 N_ambiguous 278356 1054 136465 UnstrandedReadsAssigned:15399165 PositiveStrandReadsAssigned:226960 NegativeStrandReadsAssigned:15454254 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170650 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170650-trimmed-pair1.fastq SRR7170650-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,297,320 reads, 15,430,209 reads pseudoaligned [quant] estimated average fragment length: 293.056 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7170650.ke.tsv 34699 SRR7170650.se.tsv 87100 total ==> SRR7170650.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.94 727 27.5291 Potri.005G024800.1.v4.1 1035 742.944 138 12.1397 Potri.004G059700.1.v4.1 961 669.098 6 0.586065 Potri.007G009000.2.v4.1 1416 1123.94 0 0 Potri.003G141000.2.v4.1 2943 2650.94 1062 26.1823 Potri.016G087400.1.v4.1 270 69.9957 581 542.487 Potri.015G069301.1.v4.1 564 285.715 0 0 Potri.010G195200.1.v4.1 1773 1480.94 13 0.573706 Potri.012G127500.1.v4.1 977 685.034 86 8.20486 ==> SRR7170650.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 708 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 73 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR7170650 completed mapping pipeline successfully