Starting /dee2/code/volunteer_pipeline.sh SRR7170651 current disk space = 3089728954368 free memory = 1581781800 SRR7170651 SRAfilesize c519c38130f4933b25bf4881dd8ef348 SRR7170651.sra SRR7170651.sra file validated SRR7170651 is paired end SRR7170651 is conventional basespace SRR7170651 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170651_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.52975 27.0 18.0 32.0 18.0 33.0 2 24.9245 25.0 18.0 30.0 18.0 33.0 3 28.05725 29.0 27.0 31.0 18.0 33.0 4 30.67325 31.0 30.0 33.0 27.0 33.0 5 31.7935 33.0 32.0 33.0 30.0 33.0 6 35.76475 37.0 36.0 38.0 31.0 38.0 7 36.41925 38.0 37.0 38.0 34.0 38.0 8 36.78075 38.0 38.0 38.0 34.0 38.0 9 37.072 38.0 38.0 38.0 36.0 38.0 10-14 37.147400000000005 38.0 38.0 38.0 36.0 38.0 15-19 37.17125 38.0 38.0 38.0 36.0 38.0 20-24 37.1736 38.0 38.0 38.0 36.2 38.0 25-29 37.2288 38.0 38.0 38.0 36.8 38.0 30-34 37.20635 38.0 38.0 38.0 36.8 38.0 35-39 37.24505 38.0 38.0 38.0 37.0 38.0 40-44 37.13825 38.0 38.0 38.0 36.2 38.0 45-49 37.122699999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.98115 38.0 38.0 38.0 36.0 38.0 55-59 36.87094999999999 38.0 38.0 38.0 35.4 38.0 60-64 36.8506 38.0 38.0 38.0 35.2 38.0 65-69 36.716499999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.68755 38.0 38.0 38.0 34.4 38.0 75-79 36.49145 38.0 38.0 38.0 34.0 38.0 80-84 36.3319 38.0 37.8 38.0 33.8 38.0 85-89 36.29995000000001 38.0 37.8 38.0 33.6 38.0 90-94 36.016650000000006 38.0 37.0 38.0 33.0 38.0 95-99 36.015049999999995 38.0 37.0 38.0 32.4 38.0 100-104 35.7853 38.0 37.0 38.0 31.2 38.0 105-109 35.712450000000004 38.0 37.0 38.0 31.0 38.0 110-114 35.635450000000006 38.0 36.8 38.0 31.0 38.0 115-119 35.468450000000004 38.0 36.2 38.0 29.8 38.0 120-124 35.0137 38.0 35.6 38.0 27.8 38.0 125-129 34.6367 38.0 35.0 38.0 26.4 38.0 130-134 34.4952 38.0 34.6 38.0 25.6 38.0 135-139 33.7023 38.0 33.2 38.0 22.6 38.0 140-144 33.1381 38.0 33.0 38.0 20.8 38.0 145-149 32.00065 38.0 32.6 38.0 11.6 38.0 150-151 25.701 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 3.0 18 3.0 19 7.0 20 3.0 21 8.0 22 11.0 23 12.0 24 14.0 25 21.0 26 16.0 27 30.0 28 40.0 29 48.0 30 64.0 31 79.0 32 106.0 33 181.0 34 235.0 35 420.0 36 975.0 37 1715.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.68481890572823 15.489339840739788 13.126123811970203 32.69971744156177 2 20.525 22.900000000000002 34.625 21.95 3 15.35 30.099999999999998 30.75 23.799999999999997 4 19.025 36.475 24.375 20.125 5 19.325 36.85 24.425 19.400000000000002 6 15.925 36.125 25.525 22.425 7 12.925 19.675 45.574999999999996 21.825 8 18.5 21.85 27.675 31.974999999999998 9 18.175 21.85 30.275000000000002 29.7 10-14 19.075 30.020000000000003 26.76 24.145 15-19 19.1 29.38 28.24 23.28 20-24 19.235 29.885 27.555000000000003 23.325000000000003 25-29 19.189999999999998 28.615000000000002 28.549999999999997 23.645 30-34 19.52 29.285 27.889999999999997 23.305 35-39 19.125 30.09 26.755000000000003 24.03 40-44 19.43 28.744999999999997 27.935 23.89 45-49 19.900000000000002 29.14 27.215 23.745 50-54 19.825 29.24 26.88 24.055 55-59 19.665 29.175 27.52 23.64 60-64 19.435 28.775000000000002 28.16 23.630000000000003 65-69 19.919999999999998 29.195 27.255000000000003 23.630000000000003 70-74 19.755 29.054999999999996 27.33 23.86 75-79 19.650000000000002 29.349999999999998 27.36 23.64 80-84 19.405 29.175 27.02 24.4 85-89 19.994999999999997 29.15 27.24 23.615 90-94 19.825 28.88 27.52 23.775 95-99 19.955000000000002 28.599999999999998 27.810000000000002 23.635 100-104 20.005 28.46 27.165 24.37 105-109 20.05 28.015 27.61 24.325 110-114 20.45 28.23 27.400000000000002 23.919999999999998 115-119 20.145 28.389999999999997 27.139999999999997 24.325 120-124 20.705000000000002 28.48 26.805 24.01 125-129 20.46 27.925 27.76 23.855 130-134 21.115000000000002 27.605 27.505000000000003 23.775 135-139 20.549999999999997 28.26 27.105 24.085 140-144 21.035 27.87 27.655 23.44 145-149 20.715 28.634999999999998 26.51 24.14 150-151 20.599999999999998 27.925 26.424999999999997 25.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 1.5 20 2.0 21 1.0 22 1.0 23 3.0 24 5.5 25 5.5 26 10.5 27 13.5 28 15.5 29 27.5 30 35.0 31 45.5 32 52.5 33 59.0 34 86.0 35 103.5 36 111.0 37 129.0 38 138.5 39 156.0 40 188.0 41 212.0 42 232.0 43 237.5 44 231.0 45 225.5 46 215.0 47 222.5 48 219.0 49 180.5 50 164.0 51 139.0 52 106.5 53 94.0 54 76.5 55 68.5 56 58.0 57 34.5 58 21.5 59 20.0 60 18.5 61 14.0 62 7.0 63 2.5 64 1.0 65 1.5 66 2.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.56520625160134 96.175 2 1.1017166282346913 2.15 3 0.10248526774276198 0.3 4 0.10248526774276198 0.4 5 0.0 0.0 6 0.05124263387138099 0.3 7 0.0 0.0 8 0.05124263387138099 0.4 9 0.0 0.0 >10 0.025621316935690495 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 11 0.27499999999999997 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 8 0.2 TruSeq Adapter, Index 1 (97% over 36bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit CAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 1.9625000000000001 0.0 0.0 0.0 0.0 120-121 2.2249999999999996 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.4000000000000004 0.0 0.0 0.0 0.0 130-131 3.575 0.0 0.0 0.0 0.0 132-133 3.8625 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAC 20 0.005942617 28.992498 55-59 >>END_MODULE SRR7170651 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170651_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47125 33.0 33.0 34.0 32.0 34.0 2 32.60775 33.0 33.0 34.0 32.0 34.0 3 32.63325 33.0 33.0 34.0 32.0 34.0 4 32.47975 33.0 33.0 34.0 32.0 34.0 5 32.4935 33.0 33.0 34.0 32.0 34.0 6 36.606 38.0 38.0 38.0 35.0 38.0 7 36.72325 38.0 38.0 38.0 35.0 38.0 8 36.6545 38.0 38.0 38.0 35.0 38.0 9 36.699 38.0 38.0 38.0 35.0 38.0 10-14 36.59525 38.0 38.0 38.0 34.8 38.0 15-19 36.5591 38.0 38.0 38.0 34.8 38.0 20-24 36.591300000000004 38.0 38.0 38.0 35.0 38.0 25-29 36.52925 38.0 38.0 38.0 34.6 38.0 30-34 36.49005 38.0 38.0 38.0 34.8 38.0 35-39 36.35475 38.0 38.0 38.0 34.0 38.0 40-44 36.39065 38.0 38.0 38.0 34.4 38.0 45-49 36.228300000000004 38.0 38.0 38.0 33.8 38.0 50-54 36.2721 38.0 38.0 38.0 34.0 38.0 55-59 36.195 38.0 38.0 38.0 34.0 38.0 60-64 36.17620000000001 38.0 38.0 38.0 33.6 38.0 65-69 36.1047 38.0 38.0 38.0 33.6 38.0 70-74 36.025 38.0 38.0 38.0 33.0 38.0 75-79 35.916549999999994 38.0 38.0 38.0 33.0 38.0 80-84 35.80585 38.0 37.6 38.0 32.6 38.0 85-89 35.6289 38.0 37.2 38.0 31.0 38.0 90-94 35.5087 38.0 37.0 38.0 30.6 38.0 95-99 35.439049999999995 38.0 37.0 38.0 30.2 38.0 100-104 35.187149999999995 38.0 36.8 38.0 29.4 38.0 105-109 35.0492 38.0 36.6 38.0 28.4 38.0 110-114 34.9242 38.0 36.2 38.0 27.8 38.0 115-119 34.53185 38.0 35.2 38.0 24.8 38.0 120-124 34.297399999999996 38.0 34.8 38.0 24.0 38.0 125-129 33.91665 38.0 33.8 38.0 22.6 38.0 130-134 33.376799999999996 38.0 33.0 38.0 19.8 38.0 135-139 32.7913 38.0 33.0 38.0 14.4 38.0 140-144 31.788149999999995 38.0 31.4 38.0 12.6 38.0 145-149 30.5245 37.2 29.4 38.0 3.8 38.0 150-151 24.913249999999998 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 11.0 4 4.0 5 6.0 6 2.0 7 2.0 8 3.0 9 3.0 10 4.0 11 4.0 12 3.0 13 7.0 14 2.0 15 7.0 16 2.0 17 9.0 18 12.0 19 6.0 20 8.0 21 16.0 22 19.0 23 20.0 24 24.0 25 14.0 26 30.0 27 30.0 28 42.0 29 57.0 30 76.0 31 95.0 32 109.0 33 140.0 34 219.0 35 334.0 36 753.0 37 1916.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.2 17.25 15.7 23.849999999999998 2 24.375 22.925 33.650000000000006 19.05 3 20.674999999999997 27.0 32.5 19.825 4 23.875 34.625 22.775000000000002 18.725 5 21.375 37.724999999999994 20.974999999999998 19.925 6 18.15 38.3 24.45 19.1 7 18.224999999999998 15.425 44.425 21.925 8 20.974999999999998 22.075 26.075 30.875000000000004 9 21.3 24.525 27.400000000000002 26.775 10-14 22.84 28.384999999999998 27.01 21.765 15-19 23.175 26.96 28.499999999999996 21.365000000000002 20-24 23.080000000000002 28.605000000000004 27.634999999999998 20.68 25-29 23.215 27.775 28.044999999999998 20.965 30-34 23.23 27.99 27.794999999999998 20.985 35-39 23.705000000000002 28.115000000000002 27.685 20.495 40-44 22.935 27.889999999999997 28.095 21.08 45-49 22.82 28.38 27.705000000000002 21.095 50-54 23.265 27.544999999999998 28.09 21.099999999999998 55-59 23.465 27.705000000000002 27.615000000000002 21.215 60-64 23.405 27.150000000000002 27.775 21.67 65-69 23.405 27.705000000000002 27.975 20.915 70-74 23.595 27.595 27.76 21.05 75-79 23.96 27.650000000000002 27.85 20.54 80-84 23.835 27.375 27.785 21.005 85-89 23.9 28.13 27.425 20.544999999999998 90-94 24.044999999999998 27.250000000000004 28.395 20.31 95-99 24.044999999999998 27.83 27.6 20.525 100-104 24.545 27.634999999999998 27.845 19.975 105-109 23.97 27.534999999999997 27.815 20.68 110-114 23.915 28.015 27.99 20.080000000000002 115-119 24.815 27.415 27.98 19.79 120-124 24.169999999999998 27.939999999999998 27.99 19.900000000000002 125-129 24.474999999999998 28.595 27.215 19.715 130-134 24.610000000000003 27.005000000000003 28.585 19.8 135-139 24.385 27.72 27.66 20.235 140-144 25.145 27.794999999999998 27.18 19.88 145-149 24.98 28.7 27.060000000000002 19.259999999999998 150-151 25.0 28.675 27.3375 18.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 3.5 20 2.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 3.5 27 5.5 28 8.0 29 12.0 30 19.5 31 23.5 32 22.5 33 29.0 34 48.5 35 66.0 36 76.5 37 95.0 38 132.5 39 166.0 40 181.5 41 194.0 42 217.5 43 250.0 44 271.5 45 274.0 46 264.0 47 257.5 48 233.5 49 207.0 50 189.0 51 143.5 52 111.0 53 103.5 54 97.5 55 86.5 56 64.0 57 42.0 58 26.0 59 16.5 60 12.5 61 12.0 62 9.0 63 4.5 64 2.5 65 3.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61857252494244 96.375 2 0.9976976208749041 1.95 3 0.17907393195190585 0.525 4 0.051163980557687394 0.2 5 0.051163980557687394 0.25 6 0.051163980557687394 0.3 7 0.0 0.0 8 0.051163980557687394 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 8 0.2 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 8 0.2 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 6 0.15 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) GTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.0999999999999996 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATACA 10 0.006830828 145.0 4 GCAACCG 10 0.006830828 145.0 3 >>END_MODULE Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564261 spots for SRR7170651.sra Written 564261 spots for SRR7170651.sra Read 564269 spots for SRR7170651.sra Written 564269 spots for SRR7170651.sra SRR ids: ['SRR7170651.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g0sfpbmg SRR7170651.sra spots: 11285228 blocks: [[1, 564261], [564262, 1128522], [1128523, 1692783], [1692784, 2257044], [2257045, 2821305], [2821306, 3385566], [3385567, 3949827], [3949828, 4514088], [4514089, 5078349], [5078350, 5642610], [5642611, 6206871], [6206872, 6771132], [6771133, 7335393], [7335394, 7899654], [7899655, 8463915], [8463916, 9028176], [9028177, 9592437], [9592438, 10156698], [10156699, 10720959], [10720960, 11285228]] SRR7170651 file size 3802493 SRR7170651 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170651 SRR7170651_1.fastq SRR7170651_2.fastq Input file: SRR7170651_1.fastq Paired file: SRR7170651_2.fastq trimmed: SRR7170651-trimmed-pair1.fastq, SRR7170651-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:30:21 2025 >> started Thu Feb 13 14:30:33 2025 >> done (12.227s) 11285228 read pairs processed; of these: 23404 ( 0.21%) short read pairs filtered out after trimming by size control 35233 ( 0.31%) empty read pairs filtered out after trimming by size control 11226591 (99.48%) read pairs available; of these: 6823443 (60.78%) trimmed read pairs available after processing 4403148 (39.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 8 0.00% 21 7 0.00% 22 12 0.00% 23 10 0.00% 24 11 0.00% 25 9 0.00% 26 11 0.00% 27 13 0.00% 28 20 0.00% 29 14 0.00% 30 12 0.00% 31 13 0.00% 32 21 0.00% 33 12 0.00% 34 6 0.00% 35 15 0.00% 36 13 0.00% 37 17 0.00% 38 19 0.00% 39 11 0.00% 40 23 0.00% 41 14 0.00% 42 22 0.00% 43 21 0.00% 44 31 0.00% 45 37 0.00% 46 48 0.00% 47 46 0.00% 48 49 0.00% 49 53 0.00% 50 61 0.00% 51 76 0.00% 52 63 0.00% 53 75 0.00% 54 85 0.00% 55 109 0.00% 56 117 0.00% 57 108 0.00% 58 154 0.00% 59 185 0.00% 60 179 0.00% 61 197 0.00% 62 247 0.00% 63 253 0.00% 64 312 0.00% 65 296 0.00% 66 308 0.00% 67 363 0.00% 68 385 0.00% 69 503 0.00% 70 526 0.00% 71 610 0.01% 72 768 0.01% 73 865 0.01% 74 895 0.01% 75 965 0.01% 76 1151 0.01% 77 1257 0.01% 78 1358 0.01% 79 1563 0.01% 80 1851 0.02% 81 2021 0.02% 82 2341 0.02% 83 2702 0.02% 84 4080 0.04% 85 4587 0.04% 86 4904 0.04% 87 4887 0.04% 88 5053 0.05% 89 5339 0.05% 90 5497 0.05% 91 5928 0.05% 92 6254 0.06% 93 6805 0.06% 94 7133 0.06% 95 7552 0.07% 96 7883 0.07% 97 8110 0.07% 98 8609 0.08% 99 9004 0.08% 100 9265 0.08% 101 9996 0.09% 102 10613 0.09% 103 11328 0.10% 104 11923 0.11% 105 12339 0.11% 106 12848 0.11% 107 13421 0.12% 108 13580 0.12% 109 14421 0.13% 110 14871 0.13% 111 15491 0.14% 112 16273 0.14% 113 16982 0.15% 114 17902 0.16% 115 18363 0.16% 116 19087 0.17% 117 19659 0.18% 118 20432 0.18% 119 21182 0.19% 120 22154 0.20% 121 22848 0.20% 122 23821 0.21% 123 25378 0.23% 124 26735 0.24% 125 28008 0.25% 126 29215 0.26% 127 30853 0.27% 128 32412 0.29% 129 34242 0.31% 130 35956 0.32% 131 38207 0.34% 132 41185 0.37% 133 44358 0.40% 134 48277 0.43% 135 51618 0.46% 136 56810 0.51% 137 62092 0.55% 138 67338 0.60% 139 75223 0.67% 140 82131 0.73% 141 92827 0.83% 142 104636 0.93% 143 122077 1.09% 144 142399 1.27% 145 169358 1.51% 146 217386 1.94% 147 289176 2.58% 148 441103 3.93% 149 848604 7.56% 150 3091856 27.54% 151 4403148 39.22% 11226591 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=11 prefix-density=0.70 prefix-fanout=2.6 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=84.46 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=13 prefix-density=0.65 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=48.05 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170651 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:31:23 Started mapping on | Feb 13 14:31:23 Finished on | Feb 13 14:32:45 Mapping speed, Million of reads per hour | 492.87 Number of input reads | 11226591 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10491718 Uniquely mapped reads % | 93.45% Average mapped length | 292.72 Number of splices: Total | 10096407 Number of splices: Annotated (sjdb) | 9871250 Number of splices: GT/AG | 9905481 Number of splices: GC/AG | 150277 Number of splices: AT/AC | 8345 Number of splices: Non-canonical | 32304 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298763 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 15473 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 457133 457133 457133 N_multimapping 298763 298763 298763 N_noFeature 347256 10191136 401282 N_ambiguous 329256 650 82530 UnstrandedReadsAssigned:9815206 PositiveStrandReadsAssigned:299932 NegativeStrandReadsAssigned:10007906 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170651 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170651-trimmed-pair1.fastq SRR7170651-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,226,591 reads, 9,839,944 reads pseudoaligned [quant] estimated average fragment length: 258.295 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7170651.ke.tsv 34699 SRR7170651.se.tsv 87100 total ==> SRR7170651.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.71 612 21.7789 Potri.005G024800.1.v4.1 1035 777.705 353 28.4401 Potri.004G059700.1.v4.1 961 703.735 3 0.267106 Potri.007G009000.2.v4.1 1416 1158.71 0 0 Potri.003G141000.2.v4.1 2943 2685.71 627.498 14.6395 Potri.016G087400.1.v4.1 270 75.6677 822 680.665 Potri.015G069301.1.v4.1 564 312.525 0 0 Potri.010G195200.1.v4.1 1773 1515.71 102 4.21655 Potri.012G127500.1.v4.1 977 719.726 74 6.44224 ==> SRR7170651.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 422 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 343 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170651 completed mapping pipeline successfully