Starting /dee2/code/volunteer_pipeline.sh SRR7170652 current disk space = 3089734561792 free memory = 1581773488 SRR7170652 SRAfilesize b3812a706abd24581b71b186282dc5f3 SRR7170652.sra SRR7170652.sra file validated SRR7170652 is paired end SRR7170652 is conventional basespace SRR7170652 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170652_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.98275 25.0 18.0 32.0 18.0 33.0 2 24.00425 25.0 18.0 29.0 18.0 33.0 3 28.2245 29.0 27.0 31.0 25.0 33.0 4 30.63625 31.0 29.0 33.0 27.0 33.0 5 31.523 33.0 31.0 33.0 29.0 33.0 6 36.446 38.0 37.0 38.0 34.0 38.0 7 36.9305 38.0 37.0 38.0 35.0 38.0 8 37.18175 38.0 38.0 38.0 36.0 38.0 9 37.33925 38.0 38.0 38.0 37.0 38.0 10-14 37.32185 38.0 38.0 38.0 37.0 38.0 15-19 37.3344 38.0 38.0 38.0 37.0 38.0 20-24 37.46255 38.0 38.0 38.0 37.2 38.0 25-29 37.4567 38.0 38.0 38.0 37.4 38.0 30-34 37.392999999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.3611 38.0 38.0 38.0 37.0 38.0 40-44 37.3474 38.0 38.0 38.0 37.0 38.0 45-49 37.2717 38.0 38.0 38.0 37.0 38.0 50-54 37.19815000000001 38.0 38.0 38.0 36.2 38.0 55-59 37.1 38.0 38.0 38.0 36.0 38.0 60-64 37.093599999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.0347 38.0 38.0 38.0 36.0 38.0 70-74 36.9461 38.0 38.0 38.0 35.8 38.0 75-79 36.807900000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.67515 38.0 38.0 38.0 34.8 38.0 85-89 36.63175 38.0 38.0 38.0 34.4 38.0 90-94 36.5358 38.0 38.0 38.0 34.0 38.0 95-99 36.3902 38.0 37.6 38.0 34.0 38.0 100-104 36.1945 38.0 37.0 38.0 33.8 38.0 105-109 36.0774 38.0 37.0 38.0 33.2 38.0 110-114 35.8014 38.0 36.8 38.0 31.8 38.0 115-119 35.6243 38.0 36.0 38.0 30.6 38.0 120-124 35.449749999999995 38.0 36.0 38.0 29.8 38.0 125-129 35.294050000000006 38.0 36.0 38.0 28.8 38.0 130-134 35.0015 38.0 35.0 38.0 28.0 38.0 135-139 34.606049999999996 38.0 35.0 38.0 26.8 38.0 140-144 34.1692 38.0 34.4 38.0 24.6 38.0 145-149 33.1248 38.0 33.2 38.0 20.2 38.0 150-151 28.14425 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 3.0 19 6.0 20 2.0 21 6.0 22 2.0 23 5.0 24 3.0 25 8.0 26 9.0 27 19.0 28 30.0 29 42.0 30 63.0 31 56.0 32 85.0 33 114.0 34 223.0 35 405.0 36 1008.0 37 1901.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.16445352400409 17.23697650663943 12.461695607763023 29.136874361593463 2 22.95 22.45 37.5 17.1 3 17.4 28.7 28.075 25.825 4 20.625 36.199999999999996 24.15 19.025 5 20.450563204005007 36.69586983729662 22.778473091364205 20.075093867334168 6 16.025 35.425000000000004 26.724999999999998 21.825 7 13.4 18.725 46.425 21.45 8 17.8 21.6 27.725 32.875 9 17.05 22.775000000000002 31.25 28.925 10-14 19.195 29.549999999999997 26.82 24.435000000000002 15-19 20.015 28.32 27.839999999999996 23.825 20-24 19.175 28.849999999999998 28.305000000000003 23.669999999999998 25-29 20.485 28.744999999999997 27.744999999999997 23.025000000000002 30-34 19.8 28.585 28.005000000000003 23.61 35-39 19.744999999999997 28.715000000000003 27.595 23.945 40-44 19.875 28.73 27.744999999999997 23.65 45-49 19.79 28.48 28.13 23.599999999999998 50-54 19.475 28.705000000000002 27.894999999999996 23.925 55-59 19.805 28.07 27.855 24.27 60-64 20.07 28.475 27.91 23.544999999999998 65-69 19.675 28.575 27.675 24.075 70-74 19.775000000000002 29.104999999999997 27.515 23.605 75-79 19.8 29.104999999999997 27.334999999999997 23.76 80-84 20.47 28.139999999999997 27.605 23.785 85-89 20.544999999999998 28.970000000000002 26.83 23.655 90-94 19.545 28.685 27.839999999999996 23.93 95-99 20.555 28.16 27.725 23.56 100-104 20.915 28.244999999999997 27.74 23.1 105-109 20.59 28.299999999999997 27.605 23.505000000000003 110-114 20.580000000000002 27.889999999999997 27.639999999999997 23.89 115-119 19.755 28.92 27.750000000000004 23.575 120-124 20.86 28.32 27.43 23.39 125-129 20.985 28.115000000000002 27.32 23.580000000000002 130-134 20.28 28.265 27.625 23.830000000000002 135-139 20.595 28.115000000000002 27.295 23.995 140-144 20.990000000000002 27.965 27.224999999999998 23.82 145-149 20.405 28.439999999999998 27.27 23.885 150-151 20.64008001000125 27.528441055131893 27.590948868608578 24.24053006625828 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 3.0 23 2.5 24 2.0 25 3.0 26 5.5 27 9.5 28 13.0 29 16.0 30 24.5 31 33.5 32 43.0 33 50.0 34 60.5 35 96.0 36 105.0 37 101.5 38 138.0 39 162.5 40 172.0 41 203.5 42 232.5 43 258.5 44 279.0 45 262.0 46 245.0 47 249.5 48 234.5 49 192.0 50 158.5 51 133.5 52 111.0 53 94.5 54 78.0 55 63.5 56 47.0 57 33.5 58 24.0 59 15.5 60 11.5 61 9.0 62 5.5 63 2.5 64 1.0 65 0.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08698960182602 97.675 2 0.6593963986812071 1.3 3 0.1521683996956632 0.44999999999999996 4 0.025361399949277198 0.1 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.050722799898554397 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 27 (97% over 39bp) CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 2.9124999999999996 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170652 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170652_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5345 33.0 33.0 34.0 32.0 34.0 2 32.6545 33.0 33.0 34.0 32.0 34.0 3 32.70825 33.0 33.0 34.0 32.0 34.0 4 32.542 33.0 33.0 34.0 31.0 34.0 5 32.66275 33.0 33.0 34.0 32.0 34.0 6 36.79625 38.0 38.0 38.0 36.0 38.0 7 36.94225 38.0 38.0 38.0 36.0 38.0 8 36.8435 38.0 38.0 38.0 36.0 38.0 9 36.795 38.0 38.0 38.0 36.0 38.0 10-14 36.81609999999999 38.0 38.0 38.0 36.0 38.0 15-19 36.804449999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.799 38.0 38.0 38.0 35.8 38.0 25-29 36.71319999999999 38.0 38.0 38.0 35.6 38.0 30-34 36.7019 38.0 38.0 38.0 35.2 38.0 35-39 36.708850000000005 38.0 38.0 38.0 35.4 38.0 40-44 36.68990000000001 38.0 38.0 38.0 35.4 38.0 45-49 36.6392 38.0 38.0 38.0 35.0 38.0 50-54 36.58104999999999 38.0 38.0 38.0 34.6 38.0 55-59 36.46255 38.0 38.0 38.0 34.0 38.0 60-64 36.48355 38.0 38.0 38.0 34.2 38.0 65-69 36.44605 38.0 38.0 38.0 34.2 38.0 70-74 36.38365 38.0 38.0 38.0 34.0 38.0 75-79 36.384350000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.2362 38.0 38.0 38.0 33.6 38.0 85-89 36.0972 38.0 38.0 38.0 33.4 38.0 90-94 35.98565 38.0 37.8 38.0 33.0 38.0 95-99 35.79785 38.0 37.0 38.0 31.8 38.0 100-104 35.7029 38.0 37.0 38.0 31.4 38.0 105-109 35.57705 38.0 37.0 38.0 31.0 38.0 110-114 35.22415 38.0 36.4 38.0 29.0 38.0 115-119 34.806 38.0 35.6 38.0 26.8 38.0 120-124 34.825149999999994 38.0 36.0 38.0 27.6 38.0 125-129 34.4132 38.0 34.8 38.0 24.8 38.0 130-134 34.07045 38.0 33.6 38.0 24.0 38.0 135-139 33.59535 38.0 33.0 38.0 21.4 38.0 140-144 32.87735 38.0 33.0 38.0 15.2 38.0 145-149 31.81955 38.0 32.6 38.0 8.6 38.0 150-151 26.37575 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 7.0 4 3.0 5 2.0 6 1.0 7 0.0 8 0.0 9 2.0 10 0.0 11 2.0 12 0.0 13 2.0 14 1.0 15 5.0 16 6.0 17 3.0 18 8.0 19 10.0 20 11.0 21 9.0 22 18.0 23 15.0 24 14.0 25 31.0 26 17.0 27 39.0 28 44.0 29 41.0 30 48.0 31 82.0 32 88.0 33 142.0 34 225.0 35 295.0 36 721.0 37 2098.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.975 17.45 15.4 27.175 2 24.525 24.325 34.925 16.225 3 20.95 26.174999999999997 31.974999999999998 20.9 4 23.1 34.5 21.45 20.95 5 22.3 37.425000000000004 22.175 18.099999999999998 6 18.143143143143142 38.16316316316316 23.523523523523522 20.17017017017017 7 17.538153615211407 15.961971478608957 45.10883162371779 21.391043282461847 8 19.81981981981982 22.722722722722725 27.05205205205205 30.405405405405407 9 21.240930698023515 24.518388791593697 29.146860145108832 25.093820365273956 10-14 22.29283426741393 29.038230584467573 26.85648518815052 21.812449959967974 15-19 22.942206654991242 27.550662997247937 28.226169627220415 21.280960720540406 20-24 23.2424318238679 28.446334751063297 27.790843132349263 20.52039029271954 25-29 23.34250688016012 27.875906930197647 27.935951963972975 20.84563422566925 30-34 22.166624968726545 28.386289717287966 28.006004503377536 21.441080810607957 35-39 22.71203402551914 28.401300975731797 27.62071553665249 21.26594946209657 40-44 23.83264100895851 27.696311495921126 27.586206896551722 20.88484059856864 45-49 22.957217913435077 28.08606454841131 27.89592194145609 21.060795596697524 50-54 22.886020214149905 28.24477133993796 27.504252977083958 21.364955468828178 55-59 23.48761571178384 26.875156367275455 28.536402301726294 21.10082561921441 60-64 22.737052789592195 27.425569176882664 28.126094570928196 21.71128346259695 65-69 23.642732049036777 27.32549412059044 27.62071553665249 21.411058293720288 70-74 22.96648324162081 28.394197098549274 27.66383191595798 20.975487743871938 75-79 23.45907544526716 27.576545927556534 28.036822093255953 20.927556533920352 80-84 23.7256765544495 27.667450352658697 27.68745935671052 20.91941373618128 85-89 23.489093456073647 27.851711026615973 27.776665999599757 20.882529517710626 90-94 23.28547846530939 28.02261017457856 28.167675453954278 20.52423590615777 95-99 23.397339733973396 28.047804780478046 27.742774277427745 20.812081208120812 100-104 22.895723930982744 27.781945486371594 28.56714178544636 20.7551887971993 105-109 23.4352329013859 27.74303297143143 28.31340371241307 20.508330414769603 110-114 23.129660211179505 27.598458689886403 28.564279637692035 20.707601461242056 115-119 23.831682177524264 28.15971179825878 27.33413389372561 20.674472130491345 120-124 24.034420652391436 27.46147688613168 27.88673203922353 20.61737042225335 125-129 23.873130221621892 28.075441492821053 27.990394717094404 20.061033568462655 130-134 24.456005202341053 27.84753138912511 27.337301785803614 20.35916162273023 135-139 23.892919689767325 28.656492369276958 27.31548661496122 20.135101325994494 140-144 24.363272454340756 27.87090317738304 27.480610457843387 20.285213910432827 145-149 24.26242624262426 27.987798779877988 27.147714771477148 20.602060206020603 150-151 25.25 27.8625 27.200000000000003 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 2.5 23 3.5 24 3.0 25 6.0 26 6.0 27 5.5 28 12.5 29 17.5 30 20.0 31 20.5 32 24.5 33 34.5 34 49.5 35 63.0 36 80.0 37 104.0 38 123.5 39 155.0 40 184.0 41 212.0 42 240.0 43 259.5 44 282.5 45 285.5 46 252.0 47 221.0 48 222.0 49 202.0 50 174.0 51 139.5 52 113.5 53 104.5 54 85.5 55 70.0 56 59.5 57 48.5 58 31.5 59 25.5 60 17.5 61 10.5 62 7.5 63 4.5 64 3.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.075 8 0.1 9 0.075 10-14 0.08 15-19 0.075 20-24 0.075 25-29 0.075 30-34 0.075 35-39 0.075 40-44 0.095 45-49 0.075 50-54 0.06999999999999999 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.05 75-79 0.06 80-84 0.045 85-89 0.06 90-94 0.045 95-99 0.01 100-104 0.025 105-109 0.065 110-114 0.08499999999999999 115-119 0.06999999999999999 120-124 0.06 125-129 0.055 130-134 0.045 135-139 0.075 140-144 0.075 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03675538656526 97.675 2 0.7604562737642585 1.5 3 0.050697084917617236 0.15 4 0.12674271229404308 0.5 5 0.0 0.0 6 0.0 0.0 7 0.025348542458808618 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.4874999999999998 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.4625000000000004 0.0 0.0 0.0 0.0 126-127 2.65 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 3.0375 0.0 0.0 0.0 0.0 132-133 3.2750000000000004 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 3.775 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815321 spots for SRR7170652.sra Written 815321 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra Read 815319 spots for SRR7170652.sra Written 815319 spots for SRR7170652.sra SRR ids: ['SRR7170652.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i4a3xu10 SRR7170652.sra spots: 16306382 blocks: [[1, 815319], [815320, 1630638], [1630639, 2445957], [2445958, 3261276], [3261277, 4076595], [4076596, 4891914], [4891915, 5707233], [5707234, 6522552], [6522553, 7337871], [7337872, 8153190], [8153191, 8968509], [8968510, 9783828], [9783829, 10599147], [10599148, 11414466], [11414467, 12229785], [12229786, 13045104], [13045105, 13860423], [13860424, 14675742], [14675743, 15491061], [15491062, 16306382]] SRR7170652 file size 5503997 SRR7170652 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170652 SRR7170652_1.fastq SRR7170652_2.fastq Input file: SRR7170652_1.fastq Paired file: SRR7170652_2.fastq trimmed: SRR7170652-trimmed-pair1.fastq, SRR7170652-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:31:16 2025 >> started Thu Feb 13 14:31:36 2025 >> done (19.865s) 16306382 read pairs processed; of these: 17568 ( 0.11%) short read pairs filtered out after trimming by size control 49478 ( 0.30%) empty read pairs filtered out after trimming by size control 16239336 (99.59%) read pairs available; of these: 8732781 (53.78%) trimmed read pairs available after processing 7506555 (46.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 10 0.00% 20 11 0.00% 21 7 0.00% 22 15 0.00% 23 8 0.00% 24 13 0.00% 25 10 0.00% 26 8 0.00% 27 10 0.00% 28 16 0.00% 29 15 0.00% 30 9 0.00% 31 7 0.00% 32 7 0.00% 33 27 0.00% 34 17 0.00% 35 19 0.00% 36 26 0.00% 37 20 0.00% 38 31 0.00% 39 30 0.00% 40 28 0.00% 41 33 0.00% 42 47 0.00% 43 44 0.00% 44 59 0.00% 45 65 0.00% 46 63 0.00% 47 96 0.00% 48 89 0.00% 49 119 0.00% 50 132 0.00% 51 144 0.00% 52 147 0.00% 53 161 0.00% 54 147 0.00% 55 185 0.00% 56 166 0.00% 57 218 0.00% 58 255 0.00% 59 269 0.00% 60 328 0.00% 61 394 0.00% 62 401 0.00% 63 457 0.00% 64 485 0.00% 65 482 0.00% 66 501 0.00% 67 640 0.00% 68 722 0.00% 69 739 0.00% 70 851 0.01% 71 928 0.01% 72 1160 0.01% 73 1275 0.01% 74 1418 0.01% 75 1687 0.01% 76 2111 0.01% 77 2435 0.01% 78 2161 0.01% 79 2330 0.01% 80 2495 0.02% 81 2742 0.02% 82 3073 0.02% 83 3533 0.02% 84 4807 0.03% 85 5039 0.03% 86 5612 0.03% 87 5575 0.03% 88 6024 0.04% 89 6301 0.04% 90 6640 0.04% 91 7030 0.04% 92 7686 0.05% 93 8414 0.05% 94 8711 0.05% 95 9158 0.06% 96 9687 0.06% 97 9789 0.06% 98 10193 0.06% 99 10630 0.07% 100 11125 0.07% 101 11514 0.07% 102 12433 0.08% 103 13372 0.08% 104 13819 0.09% 105 14615 0.09% 106 15189 0.09% 107 15654 0.10% 108 15964 0.10% 109 16558 0.10% 110 17083 0.11% 111 18180 0.11% 112 18909 0.12% 113 20378 0.13% 114 21109 0.13% 115 21397 0.13% 116 22145 0.14% 117 23189 0.14% 118 23709 0.15% 119 24219 0.15% 120 25222 0.16% 121 26496 0.16% 122 27359 0.17% 123 29358 0.18% 124 30907 0.19% 125 32167 0.20% 126 33420 0.21% 127 35219 0.22% 128 37427 0.23% 129 38745 0.24% 130 40667 0.25% 131 43060 0.27% 132 45716 0.28% 133 49212 0.30% 134 53024 0.33% 135 57337 0.35% 136 62272 0.38% 137 67782 0.42% 138 74005 0.46% 139 82064 0.51% 140 91310 0.56% 141 104581 0.64% 142 120708 0.74% 143 139319 0.86% 144 162211 1.00% 145 202247 1.25% 146 258013 1.59% 147 367644 2.26% 148 547728 3.37% 149 1037990 6.39% 150 4301566 26.49% 151 7506555 46.22% 16239336 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=14 prefix-density=0.66 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=254.96 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=18 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.26 sequence-density-rank=14 fanout-score=9.62 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=5.4 sequence=AAGAAAGCTTACCCTAAC SRR7170652 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:32:17 Started mapping on | Feb 13 14:32:17 Finished on | Feb 13 14:34:06 Mapping speed, Million of reads per hour | 536.35 Number of input reads | 16239336 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15298681 Uniquely mapped reads % | 94.21% Average mapped length | 294.34 Number of splices: Total | 15416274 Number of splices: Annotated (sjdb) | 15103078 Number of splices: GT/AG | 15134492 Number of splices: GC/AG | 230994 Number of splices: AT/AC | 10264 Number of splices: Non-canonical | 40524 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383759 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 18368 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 574881 574881 574881 N_multimapping 383759 383759 383759 N_noFeature 521765 15012783 602924 N_ambiguous 305957 995 100728 UnstrandedReadsAssigned:14470959 PositiveStrandReadsAssigned:284903 NegativeStrandReadsAssigned:14595029 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170652 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170652-trimmed-pair1.fastq SRR7170652-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,239,336 reads, 14,502,609 reads pseudoaligned [quant] estimated average fragment length: 279.582 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR7170652.ke.tsv 34699 SRR7170652.se.tsv 87100 total ==> SRR7170652.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.42 694 21.4964 Potri.005G024800.1.v4.1 1035 756.418 360 25.6419 Potri.004G059700.1.v4.1 961 682.481 38 2.99988 Potri.007G009000.2.v4.1 1416 1137.42 0 0 Potri.003G141000.2.v4.1 2943 2664.42 862.446 17.4397 Potri.016G087400.1.v4.1 270 72.9015 1110 820.346 Potri.015G069301.1.v4.1 564 295.58 0 0 Potri.010G195200.1.v4.1 1773 1494.42 23 0.829213 Potri.012G127500.1.v4.1 977 698.45 234 18.0506 ==> SRR7170652.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1134 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 404 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7170652 completed mapping pipeline successfully