Starting /dee2/code/volunteer_pipeline.sh SRR7170653 current disk space = 3089663922176 free memory = 1581837492 SRR7170653 SRAfilesize 8d69e67a27f4c5f65b54b2825d4b3438 SRR7170653.sra SRR7170653.sra file validated SRR7170653 is paired end SRR7170653 is conventional basespace SRR7170653 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170653_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.09125 25.0 18.0 32.0 18.0 33.0 2 24.53375 25.0 18.0 30.0 18.0 33.0 3 27.57125 29.0 27.0 31.0 18.0 33.0 4 30.34225 31.0 29.0 33.0 27.0 33.0 5 31.57775 33.0 32.0 33.0 30.0 33.0 6 35.36025 37.0 35.0 38.0 29.0 38.0 7 36.0315 38.0 36.0 38.0 33.0 38.0 8 36.67175 38.0 37.0 38.0 34.0 38.0 9 37.03575 38.0 38.0 38.0 36.0 38.0 10-14 37.108799999999995 38.0 38.0 38.0 35.8 38.0 15-19 37.074 38.0 38.0 38.0 36.0 38.0 20-24 37.0589 38.0 38.0 38.0 36.2 38.0 25-29 37.13105 38.0 38.0 38.0 36.2 38.0 30-34 37.13405 38.0 38.0 38.0 36.4 38.0 35-39 37.17545 38.0 38.0 38.0 36.4 38.0 40-44 37.0822 38.0 38.0 38.0 36.2 38.0 45-49 37.008050000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.880199999999995 38.0 38.0 38.0 35.4 38.0 55-59 36.758050000000004 38.0 38.0 38.0 34.8 38.0 60-64 36.72455 38.0 38.0 38.0 34.6 38.0 65-69 36.67435 38.0 38.0 38.0 34.4 38.0 70-74 36.6077 38.0 38.0 38.0 34.0 38.0 75-79 36.3604 38.0 37.6 38.0 34.0 38.0 80-84 36.16735 38.0 37.0 38.0 33.2 38.0 85-89 36.0159 38.0 37.0 38.0 32.6 38.0 90-94 35.771550000000005 38.0 37.0 38.0 31.4 38.0 95-99 35.757400000000004 38.0 36.8 38.0 31.4 38.0 100-104 35.486000000000004 38.0 36.4 38.0 29.4 38.0 105-109 35.38555 38.0 36.0 38.0 29.4 38.0 110-114 35.357299999999995 38.0 36.0 38.0 29.4 38.0 115-119 35.111850000000004 38.0 35.8 38.0 28.4 38.0 120-124 34.8091 38.0 35.2 38.0 27.2 38.0 125-129 34.3293 38.0 34.8 38.0 24.2 38.0 130-134 34.2445 38.0 34.4 38.0 24.0 38.0 135-139 33.27315 38.0 33.0 38.0 19.0 38.0 140-144 32.57715 38.0 31.8 38.0 14.0 38.0 145-149 31.278399999999998 37.6 30.4 38.0 8.4 38.0 150-151 24.963375 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 2.0 14 2.0 15 2.0 16 4.0 17 4.0 18 3.0 19 4.0 20 6.0 21 7.0 22 6.0 23 12.0 24 11.0 25 16.0 26 33.0 27 28.0 28 54.0 29 72.0 30 54.0 31 104.0 32 130.0 33 185.0 34 250.0 35 480.0 36 1102.0 37 1424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.437144335230215 15.2871184687015 11.743404035178479 37.532333160889806 2 18.725 24.05 35.725 21.5 3 16.8 28.799999999999997 30.525000000000002 23.875 4 20.45 36.675000000000004 22.650000000000002 20.225 5 20.025000000000002 36.425000000000004 24.099999999999998 19.45 6 16.575 36.675000000000004 24.625 22.125 7 12.375 19.675 46.2 21.75 8 18.075 20.525 27.750000000000004 33.650000000000006 9 16.775000000000002 22.3 30.0 30.925000000000004 10-14 19.009999999999998 30.009999999999998 26.540000000000003 24.44 15-19 19.12 28.860000000000003 27.77 24.25 20-24 19.78 28.694999999999997 27.189999999999998 24.335 25-29 19.685 28.884999999999998 27.875 23.555 30-34 20.445 28.610000000000003 26.865 24.08 35-39 19.794999999999998 28.525 27.96 23.72 40-44 19.91 29.2 27.47 23.419999999999998 45-49 20.369999999999997 28.235 27.750000000000004 23.645 50-54 20.375 28.165000000000003 27.775 23.685000000000002 55-59 20.375 28.349999999999998 27.715 23.56 60-64 19.950000000000003 28.965000000000003 27.755000000000003 23.330000000000002 65-69 19.875 29.459999999999997 26.825 23.84 70-74 20.23 28.575 27.355 23.84 75-79 19.93 28.7 27.79 23.580000000000002 80-84 20.11 28.050000000000004 27.68 24.16 85-89 19.945 28.494999999999997 27.63 23.93 90-94 19.82 28.515 27.900000000000002 23.765 95-99 20.625 28.310000000000002 27.279999999999998 23.785 100-104 20.14 28.095 27.765 24.0 105-109 20.625 28.42 27.38 23.575 110-114 20.635 28.475 26.950000000000003 23.94 115-119 20.625 28.13 27.725 23.52 120-124 20.65 27.955000000000002 27.815 23.580000000000002 125-129 20.5 27.755000000000003 27.96 23.785 130-134 20.655 28.349999999999998 27.18 23.815 135-139 20.674999999999997 27.955000000000002 27.884999999999998 23.485 140-144 20.599999999999998 28.18 27.060000000000002 24.16 145-149 21.015 27.615000000000002 27.155 24.215 150-151 21.05 27.5875 27.0875 24.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 1.5 23 1.0 24 3.0 25 4.0 26 3.5 27 5.0 28 7.0 29 15.0 30 26.5 31 38.5 32 48.0 33 56.5 34 67.5 35 85.0 36 106.0 37 114.5 38 135.0 39 159.5 40 183.5 41 208.0 42 210.5 43 222.5 44 241.0 45 254.5 46 254.0 47 237.0 48 234.5 49 214.5 50 181.5 51 154.5 52 120.0 53 95.5 54 77.0 55 59.0 56 49.5 57 39.5 58 27.5 59 21.5 60 13.0 61 6.0 62 4.0 63 2.0 64 0.5 65 1.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80680375729881 97.3 2 1.0408733181010408 2.0500000000000003 3 0.07616146230007616 0.22499999999999998 4 0.0 0.0 5 0.05077430820005078 0.25 6 0.0 0.0 7 0.02538715410002539 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 7 0.17500000000000002 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.7750000000000004 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138-139 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170653 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170653_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4395 33.0 33.0 34.0 31.0 34.0 2 32.57925 33.0 33.0 34.0 32.0 34.0 3 32.49825 33.0 33.0 34.0 31.0 34.0 4 32.38125 33.0 33.0 34.0 31.0 34.0 5 32.4425 33.0 33.0 34.0 31.0 34.0 6 36.6105 38.0 38.0 38.0 34.0 38.0 7 36.70175 38.0 38.0 38.0 35.0 38.0 8 36.685 38.0 38.0 38.0 35.0 38.0 9 36.6505 38.0 38.0 38.0 35.0 38.0 10-14 36.620349999999995 38.0 38.0 38.0 34.8 38.0 15-19 36.56055 38.0 38.0 38.0 34.2 38.0 20-24 36.562200000000004 38.0 38.0 38.0 34.4 38.0 25-29 36.513549999999995 38.0 38.0 38.0 34.2 38.0 30-34 36.509249999999994 38.0 38.0 38.0 34.2 38.0 35-39 36.429050000000004 38.0 38.0 38.0 34.0 38.0 40-44 36.42325 38.0 38.0 38.0 34.0 38.0 45-49 36.24465 38.0 38.0 38.0 33.8 38.0 50-54 36.24435 38.0 38.0 38.0 33.8 38.0 55-59 36.1816 38.0 38.0 38.0 33.2 38.0 60-64 36.118849999999995 38.0 38.0 38.0 33.2 38.0 65-69 35.98345 38.0 37.8 38.0 32.6 38.0 70-74 35.9687 38.0 37.8 38.0 32.8 38.0 75-79 35.93085000000001 38.0 37.2 38.0 32.6 38.0 80-84 35.79015 38.0 37.0 38.0 31.4 38.0 85-89 35.626000000000005 38.0 37.0 38.0 30.2 38.0 90-94 35.4028 38.0 37.0 38.0 29.4 38.0 95-99 35.29259999999999 38.0 37.0 38.0 28.8 38.0 100-104 35.15464999999999 38.0 36.2 38.0 28.6 38.0 105-109 34.93724999999999 38.0 36.0 38.0 27.6 38.0 110-114 34.68965 38.0 35.6 38.0 26.0 38.0 115-119 34.314099999999996 38.0 35.0 38.0 23.6 38.0 120-124 34.05 38.0 34.6 38.0 23.0 38.0 125-129 33.59095 38.0 33.0 38.0 21.4 38.0 130-134 33.135000000000005 38.0 33.0 38.0 17.4 38.0 135-139 32.4982 38.0 32.4 38.0 14.2 38.0 140-144 31.386199999999995 37.6 30.4 38.0 12.6 38.0 145-149 30.031 36.0 28.0 38.0 3.8 38.0 150-151 24.601125 32.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 2.0 5 5.0 6 5.0 7 1.0 8 2.0 9 3.0 10 5.0 11 1.0 12 1.0 13 4.0 14 6.0 15 5.0 16 8.0 17 8.0 18 10.0 19 6.0 20 5.0 21 13.0 22 17.0 23 16.0 24 29.0 25 36.0 26 38.0 27 41.0 28 53.0 29 56.0 30 87.0 31 98.0 32 123.0 33 154.0 34 236.0 35 365.0 36 814.0 37 1734.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.4 16.575 14.000000000000002 30.025000000000002 2 24.325 24.474999999999998 33.425 17.775 3 21.15 27.200000000000003 32.4 19.25 4 22.425 36.85 20.474999999999998 20.25 5 23.7 36.725 21.15 18.425 6 17.575 37.35 24.0 21.075 7 16.075 16.25 44.474999999999994 23.200000000000003 8 20.4 22.15 26.575 30.875000000000004 9 21.85 24.65 27.025 26.474999999999998 10-14 22.259999999999998 29.375 26.619999999999997 21.745 15-19 23.385 27.565 28.08 20.97 20-24 22.68 27.639999999999997 28.349999999999998 21.33 25-29 22.82 28.505000000000003 27.255000000000003 21.42 30-34 22.56 28.255000000000003 27.700000000000003 21.485000000000003 35-39 23.18 28.57 27.400000000000002 20.849999999999998 40-44 23.064999999999998 28.060000000000002 27.700000000000003 21.175 45-49 22.925 28.03 27.615000000000002 21.43 50-54 22.650000000000002 27.54 28.305000000000003 21.505 55-59 22.845 28.310000000000002 27.355 21.490000000000002 60-64 23.505000000000003 27.750000000000004 27.41 21.335 65-69 23.665 27.865000000000002 26.810000000000002 21.66 70-74 22.745 27.994999999999997 27.73 21.529999999999998 75-79 23.45 27.994999999999997 27.165 21.39 80-84 23.26 27.98 27.655 21.105 85-89 23.805 28.065 27.21 20.919999999999998 90-94 23.599999999999998 28.194999999999997 27.47 20.735 95-99 23.39 27.935 27.505000000000003 21.17 100-104 24.005000000000003 28.34 27.01 20.645 105-109 23.935000000000002 27.16 28.000000000000004 20.905 110-114 23.805 27.935 27.55 20.71 115-119 23.549999999999997 28.410000000000004 27.439999999999998 20.599999999999998 120-124 24.01 28.025 27.26 20.705000000000002 125-129 24.075 28.32 26.700000000000003 20.905 130-134 24.425 28.185 27.065 20.325 135-139 24.415 28.105000000000004 27.245 20.235 140-144 24.975 27.67 27.275 20.080000000000002 145-149 24.675 28.07 27.295 19.96 150-151 26.05 26.424999999999997 27.3375 20.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 0.5 20 1.5 21 4.0 22 2.5 23 1.5 24 2.0 25 3.0 26 6.0 27 7.5 28 9.0 29 14.0 30 16.5 31 17.5 32 26.5 33 33.0 34 50.5 35 74.5 36 76.5 37 90.0 38 127.0 39 156.5 40 177.0 41 201.0 42 222.0 43 243.5 44 259.0 45 268.5 46 285.5 47 265.5 48 215.5 49 191.5 50 185.0 51 157.0 52 123.5 53 103.0 54 91.5 55 84.0 56 61.5 57 41.5 58 34.5 59 22.0 60 12.0 61 10.5 62 9.0 63 7.0 64 3.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78017789072427 97.175 2 0.940279542566709 1.8499999999999999 3 0.20330368487928843 0.6 4 0.025412960609911054 0.1 5 0.025412960609911054 0.125 6 0.025412960609911054 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 6 0.15 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.025 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7249999999999996 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.475 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 4.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTCTC 10 0.006830828 145.0 145 >>END_MODULE Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra Read 733707 spots for SRR7170653.sra Written 733707 spots for SRR7170653.sra SRR ids: ['SRR7170653.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sud7l2l7 SRR7170653.sra spots: 14674140 blocks: [[1, 733707], [733708, 1467414], [1467415, 2201121], [2201122, 2934828], [2934829, 3668535], [3668536, 4402242], [4402243, 5135949], [5135950, 5869656], [5869657, 6603363], [6603364, 7337070], [7337071, 8070777], [8070778, 8804484], [8804485, 9538191], [9538192, 10271898], [10271899, 11005605], [11005606, 11739312], [11739313, 12473019], [12473020, 13206726], [13206727, 13940433], [13940434, 14674140]] SRR7170653 file size 4950884 SRR7170653 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170653 SRR7170653_1.fastq SRR7170653_2.fastq Input file: SRR7170653_1.fastq Paired file: SRR7170653_2.fastq trimmed: SRR7170653-trimmed-pair1.fastq, SRR7170653-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:33:10 2025 >> started Thu Feb 13 14:33:26 2025 >> done (16.469s) 14674140 read pairs processed; of these: 18069 ( 0.12%) short read pairs filtered out after trimming by size control 33740 ( 0.23%) empty read pairs filtered out after trimming by size control 14622331 (99.65%) read pairs available; of these: 9053665 (61.92%) trimmed read pairs available after processing 5568666 (38.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 7 0.00% 23 2 0.00% 24 8 0.00% 25 7 0.00% 26 10 0.00% 27 11 0.00% 28 9 0.00% 29 5 0.00% 30 8 0.00% 31 11 0.00% 32 12 0.00% 33 12 0.00% 34 13 0.00% 35 15 0.00% 36 13 0.00% 37 14 0.00% 38 23 0.00% 39 19 0.00% 40 27 0.00% 41 21 0.00% 42 28 0.00% 43 42 0.00% 44 30 0.00% 45 45 0.00% 46 60 0.00% 47 49 0.00% 48 66 0.00% 49 67 0.00% 50 90 0.00% 51 82 0.00% 52 101 0.00% 53 99 0.00% 54 145 0.00% 55 177 0.00% 56 156 0.00% 57 181 0.00% 58 194 0.00% 59 243 0.00% 60 242 0.00% 61 304 0.00% 62 325 0.00% 63 377 0.00% 64 431 0.00% 65 446 0.00% 66 472 0.00% 67 553 0.00% 68 606 0.00% 69 705 0.00% 70 805 0.01% 71 920 0.01% 72 1077 0.01% 73 1181 0.01% 74 1374 0.01% 75 1499 0.01% 76 1690 0.01% 77 1722 0.01% 78 1837 0.01% 79 2166 0.01% 80 2343 0.02% 81 2776 0.02% 82 3175 0.02% 83 3620 0.02% 84 4782 0.03% 85 5453 0.04% 86 5483 0.04% 87 5789 0.04% 88 6078 0.04% 89 6435 0.04% 90 6837 0.05% 91 7226 0.05% 92 7964 0.05% 93 8562 0.06% 94 8950 0.06% 95 9648 0.07% 96 9926 0.07% 97 10095 0.07% 98 10693 0.07% 99 11156 0.08% 100 11899 0.08% 101 12502 0.09% 102 13253 0.09% 103 14116 0.10% 104 14665 0.10% 105 15384 0.11% 106 16179 0.11% 107 16620 0.11% 108 17158 0.12% 109 17517 0.12% 110 18154 0.12% 111 18907 0.13% 112 20046 0.14% 113 21328 0.15% 114 22030 0.15% 115 22914 0.16% 116 23683 0.16% 117 24480 0.17% 118 25558 0.17% 119 26367 0.18% 120 27230 0.19% 121 27972 0.19% 122 29727 0.20% 123 32076 0.22% 124 33647 0.23% 125 35060 0.24% 126 36982 0.25% 127 39091 0.27% 128 40939 0.28% 129 43643 0.30% 130 45858 0.31% 131 49284 0.34% 132 52987 0.36% 133 56973 0.39% 134 61762 0.42% 135 67372 0.46% 136 74131 0.51% 137 80470 0.55% 138 88951 0.61% 139 98626 0.67% 140 110360 0.75% 141 124899 0.85% 142 141232 0.97% 143 164453 1.12% 144 193058 1.32% 145 233903 1.60% 146 302153 2.07% 147 404611 2.77% 148 621127 4.25% 149 1182989 8.09% 150 4021490 27.50% 151 5568666 38.08% 14622331 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=13 prefix-density=0.84 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=26.39 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.49 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=1.50 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=29.34 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.7 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170653 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:34:09 Started mapping on | Feb 13 14:34:09 Finished on | Feb 13 14:36:21 Mapping speed, Million of reads per hour | 398.79 Number of input reads | 14622331 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13452837 Uniquely mapped reads % | 92.00% Average mapped length | 292.80 Number of splices: Total | 13690435 Number of splices: Annotated (sjdb) | 13393763 Number of splices: GT/AG | 13426302 Number of splices: GC/AG | 213872 Number of splices: AT/AC | 9344 Number of splices: Non-canonical | 40917 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383816 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 23341 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.16% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 801964 801964 801964 N_multimapping 383816 383816 383816 N_noFeature 405820 13162070 473795 N_ambiguous 337859 753 114650 UnstrandedReadsAssigned:12709158 PositiveStrandReadsAssigned:290014 NegativeStrandReadsAssigned:12864392 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170653 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170653-trimmed-pair1.fastq SRR7170653-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,622,331 reads, 12,803,520 reads pseudoaligned [quant] estimated average fragment length: 262.176 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7170653.ke.tsv 34699 SRR7170653.se.tsv 87100 total ==> SRR7170653.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.82 442 13.3423 Potri.005G024800.1.v4.1 1035 773.824 226 15.4883 Potri.004G059700.1.v4.1 961 699.869 11 0.833514 Potri.007G009000.2.v4.1 1416 1154.82 0 0 Potri.003G141000.2.v4.1 2943 2681.82 634.559 12.5481 Potri.016G087400.1.v4.1 270 75.8504 925.657 647.186 Potri.015G069301.1.v4.1 564 309.482 0 0 Potri.010G195200.1.v4.1 1773 1511.82 12 0.420937 Potri.012G127500.1.v4.1 977 715.85 120 8.8899 ==> SRR7170653.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 683 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 50 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7170653 completed mapping pipeline successfully