Starting /dee2/code/volunteer_pipeline.sh SRR7170654 current disk space = 3089319043072 free memory = 1466710432 SRR7170654 SRAfilesize 01cab894d5886149a1da4cd4d6a06e56 SRR7170654.sra SRR7170654.sra file validated SRR7170654 is paired end SRR7170654 is conventional basespace SRR7170654 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170654_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.58775 30.0 18.0 33.0 18.0 33.0 2 26.6795 28.0 25.0 31.0 18.0 33.0 3 29.726 31.0 29.0 33.0 25.0 33.0 4 31.40325 33.0 31.0 33.0 29.0 33.0 5 32.29475 33.0 33.0 33.0 32.0 33.0 6 36.73775 38.0 37.0 38.0 35.0 38.0 7 37.03125 38.0 38.0 38.0 35.0 38.0 8 37.392 38.0 38.0 38.0 37.0 38.0 9 37.53325 38.0 38.0 38.0 37.0 38.0 10-14 37.50320000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.516799999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.55225 38.0 38.0 38.0 38.0 38.0 25-29 37.525099999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.50465 38.0 38.0 38.0 38.0 38.0 35-39 37.5209 38.0 38.0 38.0 38.0 38.0 40-44 37.444700000000005 38.0 38.0 38.0 37.6 38.0 45-49 37.4142 38.0 38.0 38.0 37.2 38.0 50-54 37.30185 38.0 38.0 38.0 37.0 38.0 55-59 37.2389 38.0 38.0 38.0 37.0 38.0 60-64 37.23975 38.0 38.0 38.0 36.8 38.0 65-69 37.16065 38.0 38.0 38.0 36.4 38.0 70-74 37.09245 38.0 38.0 38.0 36.0 38.0 75-79 36.89545 38.0 38.0 38.0 35.6 38.0 80-84 36.9013 38.0 38.0 38.0 36.0 38.0 85-89 36.74829999999999 38.0 38.0 38.0 35.2 38.0 90-94 36.66825 38.0 38.0 38.0 35.0 38.0 95-99 36.5086 38.0 38.0 38.0 34.4 38.0 100-104 36.361900000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.2182 38.0 38.0 38.0 34.0 38.0 110-114 36.175850000000004 38.0 37.6 38.0 33.8 38.0 115-119 35.9072 38.0 37.0 38.0 32.8 38.0 120-124 35.6857 38.0 36.8 38.0 31.4 38.0 125-129 35.54695 38.0 36.0 38.0 31.0 38.0 130-134 35.30995 38.0 36.0 38.0 30.4 38.0 135-139 35.107299999999995 38.0 36.0 38.0 29.4 38.0 140-144 34.577999999999996 38.0 34.6 38.0 27.2 38.0 145-149 33.84205000000001 38.0 33.0 38.0 24.6 38.0 150-151 29.497625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 3.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 4.0 18 3.0 19 11.0 20 4.0 21 4.0 22 3.0 23 6.0 24 5.0 25 8.0 26 15.0 27 9.0 28 18.0 29 38.0 30 30.0 31 49.0 32 65.0 33 92.0 34 147.0 35 318.0 36 842.0 37 2318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.023845763571785 18.340943683409435 12.02435312024353 26.61085743277524 2 20.95 21.4 38.15 19.5 3 17.4 29.65 29.275000000000002 23.674999999999997 4 21.099999999999998 34.725 23.974999999999998 20.200000000000003 5 20.06010518407213 36.06311044327573 23.89181066867017 19.984973703981968 6 17.4 34.449999999999996 25.874999999999996 22.275 7 12.575 21.15 44.6 21.675 8 17.9 21.875 27.1 33.125 9 17.424999999999997 23.125 29.675 29.775000000000002 10-14 19.79 29.675 26.534999999999997 24.0 15-19 19.73 28.475 27.47 24.325 20-24 20.305 29.085 27.125 23.485 25-29 19.63 29.304999999999996 27.060000000000002 24.005000000000003 30-34 19.955000000000002 29.145 27.295 23.605 35-39 20.385 28.65 27.21 23.755000000000003 40-44 19.835 29.459999999999997 27.1 23.605 45-49 20.04 28.895 27.05 24.015 50-54 20.035 28.645 27.315 24.005000000000003 55-59 19.835 28.804999999999996 27.815 23.544999999999998 60-64 19.935 28.185 28.134999999999998 23.745 65-69 20.275000000000002 28.439999999999998 27.465 23.82 70-74 19.900000000000002 28.694999999999997 27.425 23.98 75-79 19.705000000000002 29.125 27.034999999999997 24.135 80-84 20.22 28.305000000000003 27.474999999999998 24.0 85-89 20.605 28.144999999999996 27.125 24.125 90-94 20.205000000000002 28.765 27.105 23.925 95-99 20.53 28.24 27.77 23.46 100-104 19.955000000000002 28.775000000000002 27.435 23.835 105-109 20.165 27.755000000000003 27.439999999999998 24.64 110-114 21.015 28.000000000000004 27.295 23.69 115-119 20.845 27.985 26.534999999999997 24.635 120-124 20.86 28.28 27.045 23.815 125-129 20.5 27.875 26.88 24.745 130-134 20.765 28.215 26.735 24.285 135-139 21.125 27.68 27.310000000000002 23.885 140-144 20.990000000000002 27.944999999999997 26.619999999999997 24.445 145-149 20.925 27.334999999999997 27.665 24.075 150-151 21.567891972993248 28.382095523880967 26.244061015253813 23.80595148787197 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 2.5 22 3.0 23 1.0 24 4.0 25 9.0 26 12.0 27 11.5 28 12.0 29 19.5 30 30.0 31 34.0 32 36.5 33 50.0 34 63.5 35 74.5 36 94.0 37 121.5 38 150.0 39 157.5 40 164.0 41 196.5 42 214.5 43 230.0 44 229.5 45 234.5 46 266.0 47 242.0 48 214.0 49 199.0 50 179.0 51 155.0 52 125.0 53 108.0 54 89.5 55 76.5 56 51.5 57 34.0 58 29.5 59 17.5 60 12.0 61 13.5 62 10.5 63 3.5 64 1.0 65 3.0 66 3.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67684478371501 96.95 2 1.1195928753180662 2.1999999999999997 3 0.10178117048346055 0.3 4 0.05089058524173028 0.2 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02544529262086514 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 36bp) GCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.9625000000000001 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.4124999999999996 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.2125 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 3.8375 0.0 0.0 0.0 0.0 134-135 4.1375 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 4.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCACCC 10 0.0068343505 144.975 7 >>END_MODULE SRR7170654 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170654_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68375 33.0 33.0 34.0 32.0 34.0 2 32.72325 33.0 33.0 34.0 32.0 34.0 3 32.73375 33.0 33.0 34.0 32.0 34.0 4 32.664 33.0 33.0 34.0 32.0 34.0 5 32.67025 33.0 33.0 34.0 32.0 34.0 6 36.7165 38.0 38.0 38.0 35.0 38.0 7 36.821 38.0 38.0 38.0 36.0 38.0 8 36.83625 38.0 38.0 38.0 35.0 38.0 9 36.85325 38.0 38.0 38.0 36.0 38.0 10-14 36.82795 38.0 38.0 38.0 36.0 38.0 15-19 36.793099999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.787 38.0 38.0 38.0 35.8 38.0 25-29 36.719100000000005 38.0 38.0 38.0 35.0 38.0 30-34 36.7337 38.0 38.0 38.0 35.8 38.0 35-39 36.71145 38.0 38.0 38.0 35.4 38.0 40-44 36.721199999999996 38.0 38.0 38.0 35.6 38.0 45-49 36.6904 38.0 38.0 38.0 35.4 38.0 50-54 36.621599999999994 38.0 38.0 38.0 35.0 38.0 55-59 36.493849999999995 38.0 38.0 38.0 34.4 38.0 60-64 36.447050000000004 38.0 38.0 38.0 34.2 38.0 65-69 36.4924 38.0 38.0 38.0 34.6 38.0 70-74 36.3989 38.0 38.0 38.0 34.0 38.0 75-79 36.38605 38.0 38.0 38.0 34.0 38.0 80-84 36.181650000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.1152 38.0 38.0 38.0 33.6 38.0 90-94 36.0128 38.0 38.0 38.0 33.2 38.0 95-99 35.8968 38.0 38.0 38.0 33.0 38.0 100-104 35.7109 38.0 37.2 38.0 31.4 38.0 105-109 35.590399999999995 38.0 37.0 38.0 31.0 38.0 110-114 35.4172 38.0 37.0 38.0 30.4 38.0 115-119 35.11109999999999 38.0 36.0 38.0 28.6 38.0 120-124 35.123949999999994 38.0 36.0 38.0 28.4 38.0 125-129 34.6543 38.0 35.2 38.0 26.6 38.0 130-134 34.1956 38.0 34.6 38.0 24.0 38.0 135-139 33.6462 38.0 33.0 38.0 21.4 38.0 140-144 33.280649999999994 38.0 33.0 38.0 19.8 38.0 145-149 32.24585 38.0 33.0 38.0 10.8 38.0 150-151 26.937624999999997 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 7.0 4 1.0 5 1.0 6 3.0 7 0.0 8 4.0 9 3.0 10 1.0 11 4.0 12 1.0 13 4.0 14 8.0 15 6.0 16 4.0 17 5.0 18 11.0 19 14.0 20 10.0 21 10.0 22 10.0 23 10.0 24 23.0 25 18.0 26 22.0 27 30.0 28 28.0 29 49.0 30 62.0 31 58.0 32 85.0 33 93.0 34 205.0 35 302.0 36 623.0 37 2280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.325 16.6 15.475 24.6 2 25.8 22.3 32.5 19.400000000000002 3 20.65 25.7 33.550000000000004 20.1 4 22.125 35.099999999999994 21.725 21.05 5 23.425 37.425000000000004 20.625 18.525 6 19.2 37.125 23.425 20.25 7 18.125 16.8 41.699999999999996 23.375 8 20.575 22.400000000000002 25.45 31.574999999999996 9 21.625 23.625 28.499999999999996 26.25 10-14 23.275000000000002 27.72 26.995 22.009999999999998 15-19 23.549999999999997 27.57 27.034999999999997 21.845 20-24 23.04 28.000000000000004 27.55 21.41 25-29 23.919999999999998 27.73 27.150000000000002 21.2 30-34 23.01 27.810000000000002 27.485 21.695 35-39 23.57 27.0 27.800000000000004 21.63 40-44 22.86 27.62 27.905 21.615000000000002 45-49 22.53 27.42 27.855 22.195 50-54 22.975 28.395 27.51 21.12 55-59 23.68 27.01 27.83 21.48 60-64 22.805 28.1 27.35 21.745 65-69 23.485 27.655 27.57 21.29 70-74 23.345 28.060000000000002 27.07 21.525 75-79 23.47 27.76 27.21 21.560000000000002 80-84 22.895 28.025 26.97 22.11 85-89 24.13 27.779999999999998 27.21 20.880000000000003 90-94 23.935000000000002 27.150000000000002 27.639999999999997 21.275 95-99 24.05 27.61 26.919999999999998 21.42 100-104 24.055 27.894999999999996 27.35 20.7 105-109 24.104999999999997 27.845 27.55 20.5 110-114 23.805 27.544999999999998 27.325 21.325 115-119 24.325 28.325 26.700000000000003 20.65 120-124 24.445 27.965 26.735 20.855 125-129 24.72 27.58 27.22 20.48 130-134 24.995 27.405 27.265 20.335 135-139 24.25 28.03 27.060000000000002 20.66 140-144 24.69 28.244999999999997 26.245 20.82 145-149 25.09 28.095 26.935 19.88 150-151 25.603200400050007 26.96587073384173 26.903362920365048 20.527565945743216 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 2.5 25 4.0 26 5.0 27 4.5 28 5.5 29 11.0 30 17.5 31 20.0 32 22.5 33 26.5 34 30.5 35 52.5 36 77.0 37 95.0 38 114.5 39 133.0 40 175.0 41 188.0 42 205.0 43 261.5 44 278.0 45 264.0 46 247.5 47 240.0 48 243.5 49 230.5 50 193.0 51 151.0 52 129.5 53 124.5 54 110.0 55 84.0 56 69.5 57 56.5 58 38.5 59 30.5 60 21.0 61 11.0 62 5.5 63 4.0 64 4.0 65 2.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49643221202854 96.625 2 1.325178389398573 2.6 3 0.0764525993883792 0.22499999999999998 4 0.025484199796126403 0.1 5 0.025484199796126403 0.125 6 0.025484199796126403 0.15 7 0.025484199796126403 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 6 0.15 No Hit CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 1.9875 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.4625000000000004 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.7750000000000004 0.0 0.0 0.0 0.0 126-127 2.9625 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 3.8375 0.0 0.0 0.0 0.0 134-135 4.1375 0.0 0.0 0.0 0.0 136-137 4.387499999999999 0.0 0.0 0.0 0.0 138-139 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATGCA 10 0.006830828 145.0 4 >>END_MODULE Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858356 spots for SRR7170654.sra Written 858356 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra Read 858353 spots for SRR7170654.sra Written 858353 spots for SRR7170654.sra SRR ids: ['SRR7170654.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dl_ipf15 SRR7170654.sra spots: 17167063 blocks: [[1, 858353], [858354, 1716706], [1716707, 2575059], [2575060, 3433412], [3433413, 4291765], [4291766, 5150118], [5150119, 6008471], [6008472, 6866824], [6866825, 7725177], [7725178, 8583530], [8583531, 9441883], [9441884, 10300236], [10300237, 11158589], [11158590, 12016942], [12016943, 12875295], [12875296, 13733648], [13733649, 14592001], [14592002, 15450354], [15450355, 16308707], [16308708, 17167063]] SRR7170654 file size 5795653 SRR7170654 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170654 SRR7170654_1.fastq SRR7170654_2.fastq Input file: SRR7170654_1.fastq Paired file: SRR7170654_2.fastq trimmed: SRR7170654-trimmed-pair1.fastq, SRR7170654-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:57:32 2025 >> started Thu Feb 13 14:57:50 2025 >> done (18.705s) 17167063 read pairs processed; of these: 26424 ( 0.15%) short read pairs filtered out after trimming by size control 67972 ( 0.40%) empty read pairs filtered out after trimming by size control 17072667 (99.45%) read pairs available; of these: 8696933 (50.94%) trimmed read pairs available after processing 8375734 (49.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 6 0.00% 20 17 0.00% 21 13 0.00% 22 18 0.00% 23 14 0.00% 24 15 0.00% 25 20 0.00% 26 16 0.00% 27 21 0.00% 28 17 0.00% 29 24 0.00% 30 21 0.00% 31 23 0.00% 32 12 0.00% 33 14 0.00% 34 21 0.00% 35 21 0.00% 36 20 0.00% 37 24 0.00% 38 50 0.00% 39 47 0.00% 40 38 0.00% 41 41 0.00% 42 45 0.00% 43 48 0.00% 44 65 0.00% 45 59 0.00% 46 83 0.00% 47 92 0.00% 48 109 0.00% 49 113 0.00% 50 128 0.00% 51 142 0.00% 52 158 0.00% 53 193 0.00% 54 200 0.00% 55 182 0.00% 56 215 0.00% 57 259 0.00% 58 286 0.00% 59 318 0.00% 60 398 0.00% 61 402 0.00% 62 398 0.00% 63 462 0.00% 64 502 0.00% 65 622 0.00% 66 599 0.00% 67 647 0.00% 68 717 0.00% 69 843 0.00% 70 968 0.01% 71 1116 0.01% 72 1224 0.01% 73 1405 0.01% 74 1673 0.01% 75 1967 0.01% 76 2801 0.02% 77 3248 0.02% 78 2582 0.02% 79 2614 0.02% 80 2744 0.02% 81 3101 0.02% 82 3524 0.02% 83 3901 0.02% 84 5517 0.03% 85 6399 0.04% 86 6989 0.04% 87 7289 0.04% 88 7783 0.05% 89 7762 0.05% 90 8304 0.05% 91 8505 0.05% 92 9052 0.05% 93 9431 0.06% 94 10012 0.06% 95 10651 0.06% 96 11145 0.07% 97 11395 0.07% 98 11751 0.07% 99 12166 0.07% 100 12964 0.08% 101 13396 0.08% 102 14345 0.08% 103 15164 0.09% 104 16120 0.09% 105 16724 0.10% 106 17414 0.10% 107 17825 0.10% 108 18054 0.11% 109 19366 0.11% 110 19882 0.12% 111 20766 0.12% 112 21668 0.13% 113 23092 0.14% 114 23659 0.14% 115 24352 0.14% 116 25056 0.15% 117 26013 0.15% 118 26767 0.16% 119 27371 0.16% 120 28521 0.17% 121 29285 0.17% 122 30282 0.18% 123 32715 0.19% 124 33557 0.20% 125 35456 0.21% 126 37320 0.22% 127 38032 0.22% 128 40188 0.24% 129 42177 0.25% 130 43778 0.26% 131 45374 0.27% 132 49130 0.29% 133 51669 0.30% 134 55480 0.32% 135 59358 0.35% 136 64118 0.38% 137 69737 0.41% 138 74708 0.44% 139 82043 0.48% 140 90840 0.53% 141 101559 0.59% 142 114388 0.67% 143 133734 0.78% 144 156974 0.92% 145 189605 1.11% 146 237329 1.39% 147 323047 1.89% 148 496378 2.91% 149 973835 5.70% 150 4350488 25.48% 151 8375734 49.06% 17072667 reads passed initial QC criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=14 prefix-density=1.18 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=80.40 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=13 prefix-density=1.23 prefix-fanout=2.1 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=73.24 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170654 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:58:35 Started mapping on | Feb 13 14:58:36 Finished on | Feb 13 15:01:15 Mapping speed, Million of reads per hour | 386.55 Number of input reads | 17072667 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15621288 Uniquely mapped reads % | 91.50% Average mapped length | 294.25 Number of splices: Total | 15731889 Number of splices: Annotated (sjdb) | 15451346 Number of splices: GT/AG | 15431073 Number of splices: GC/AG | 253303 Number of splices: AT/AC | 9620 Number of splices: Non-canonical | 37893 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405083 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 24259 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.94% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1072601 1072601 1072601 N_multimapping 405083 405083 405083 N_noFeature 377393 15315350 453053 N_ambiguous 351291 798 120543 UnstrandedReadsAssigned:14892604 PositiveStrandReadsAssigned:305140 NegativeStrandReadsAssigned:15047692 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170654 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170654-trimmed-pair1.fastq SRR7170654-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,072,667 reads, 14,996,636 reads pseudoaligned [quant] estimated average fragment length: 271.194 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7170654.ke.tsv 34699 SRR7170654.se.tsv 87100 total ==> SRR7170654.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.81 519 14.404 Potri.005G024800.1.v4.1 1035 764.806 268 16.9978 Potri.004G059700.1.v4.1 961 690.866 16 1.12341 Potri.007G009000.2.v4.1 1416 1145.81 0 0 Potri.003G141000.2.v4.1 2943 2672.81 861.699 15.6386 Potri.016G087400.1.v4.1 270 74.481 1350.72 879.689 Potri.015G069301.1.v4.1 564 302.554 0 0 Potri.010G195200.1.v4.1 1773 1502.81 29 0.936063 Potri.012G127500.1.v4.1 977 706.831 149 10.2254 ==> SRR7170654.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 725 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 399 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170654 completed mapping pipeline successfully