Starting /dee2/code/volunteer_pipeline.sh SRR7170655 current disk space = 3089908158464 free memory = 1415179656 SRR7170655 SRAfilesize 7fb96296dd0a67fbbfa0a58447e38ba8 SRR7170655.sra SRR7170655.sra file validated SRR7170655 is paired end SRR7170655 is conventional basespace SRR7170655 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170655_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.937 25.0 18.0 32.0 18.0 33.0 2 22.55425 18.0 18.0 27.0 18.0 33.0 3 25.15325 27.0 18.0 29.0 18.0 31.0 4 29.57775 30.0 29.0 31.0 27.0 33.0 5 31.0845 32.0 32.0 33.0 27.0 33.0 6 35.38175 37.0 35.0 38.0 31.0 38.0 7 36.6075 38.0 37.0 38.0 34.0 38.0 8 37.2845 38.0 38.0 38.0 36.0 38.0 9 37.38975 38.0 38.0 38.0 37.0 38.0 10-14 37.3784 38.0 38.0 38.0 37.0 38.0 15-19 37.41275 38.0 38.0 38.0 37.0 38.0 20-24 37.530449999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.457800000000006 38.0 38.0 38.0 37.4 38.0 30-34 37.457 38.0 38.0 38.0 37.6 38.0 35-39 37.47745 38.0 38.0 38.0 38.0 38.0 40-44 37.37415 38.0 38.0 38.0 37.0 38.0 45-49 37.3433 38.0 38.0 38.0 37.0 38.0 50-54 37.245400000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.240899999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.15775 38.0 38.0 38.0 36.2 38.0 65-69 37.1055 38.0 38.0 38.0 36.0 38.0 70-74 37.036 38.0 38.0 38.0 36.0 38.0 75-79 36.8298 38.0 38.0 38.0 36.0 38.0 80-84 36.69715 38.0 38.0 38.0 35.2 38.0 85-89 36.655499999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.537099999999995 38.0 38.0 38.0 34.6 38.0 95-99 36.4713 38.0 38.0 38.0 34.4 38.0 100-104 36.24015 38.0 38.0 38.0 33.8 38.0 105-109 36.131600000000006 38.0 38.0 38.0 33.6 38.0 110-114 36.035250000000005 38.0 37.4 38.0 33.2 38.0 115-119 35.734 38.0 37.0 38.0 31.4 38.0 120-124 35.59845 38.0 36.8 38.0 31.2 38.0 125-129 35.56949999999999 38.0 36.6 38.0 31.4 38.0 130-134 35.3492 38.0 36.0 38.0 30.6 38.0 135-139 35.1173 38.0 36.0 38.0 29.0 38.0 140-144 34.56420000000001 38.0 34.6 38.0 27.8 38.0 145-149 33.7636 38.0 33.4 38.0 23.8 38.0 150-151 29.765249999999998 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 0.0 16 3.0 17 1.0 18 4.0 19 17.0 20 4.0 21 2.0 22 6.0 23 8.0 24 3.0 25 10.0 26 13.0 27 14.0 28 34.0 29 38.0 30 26.0 31 61.0 32 65.0 33 118.0 34 178.0 35 314.0 36 895.0 37 2178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.100353000504285 16.792738275340394 12.05244578920827 24.05446293494705 2 23.25 21.15 35.949999999999996 19.650000000000002 3 17.075000000000003 30.599999999999998 29.75 22.575 4 20.625 34.025 26.35 19.0 5 19.9899673940306 35.615751191371956 24.20366190117883 20.19061951341861 6 16.950000000000003 36.925000000000004 25.924999999999997 20.200000000000003 7 13.3 21.75 44.574999999999996 20.375 8 16.075 23.275000000000002 28.9 31.75 9 18.25 22.95 29.975 28.825 10-14 19.045 31.1 26.035000000000004 23.82 15-19 19.28 30.595 27.005000000000003 23.119999999999997 20-24 19.36 30.235 27.08 23.325000000000003 25-29 19.64 30.305 26.775 23.28 30-34 19.18 30.81 27.265 22.745 35-39 19.66 29.849999999999998 26.845000000000002 23.645 40-44 19.950000000000003 29.875 27.07 23.105 45-49 19.425 30.11 26.93 23.535 50-54 19.830000000000002 29.915000000000003 26.52 23.735 55-59 19.814999999999998 29.39 27.35 23.445 60-64 19.875 29.4 27.339999999999996 23.385 65-69 19.49 29.385 26.82 24.305 70-74 19.63 29.45 27.560000000000002 23.36 75-79 19.485 29.645 27.3 23.57 80-84 19.5 29.455 27.150000000000002 23.895 85-89 20.330000000000002 29.54 26.810000000000002 23.32 90-94 19.925 29.330000000000002 27.05 23.695 95-99 20.285 28.73 27.415 23.57 100-104 20.0 28.794999999999998 27.339999999999996 23.865 105-109 20.535 29.4 26.590000000000003 23.474999999999998 110-114 20.544999999999998 28.749999999999996 26.685 24.02 115-119 20.625 28.46 26.740000000000002 24.175 120-124 20.84 28.525 26.724999999999998 23.91 125-129 20.064999999999998 28.494999999999997 27.089999999999996 24.349999999999998 130-134 20.77 27.900000000000002 27.01 24.32 135-139 20.65 28.439999999999998 26.424999999999997 24.485 140-144 20.200000000000003 28.139999999999997 27.139999999999997 24.52 145-149 20.595 27.834999999999997 27.155 24.415 150-151 21.33116476917303 28.612535968972853 26.2729888652571 23.78331039659702 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 2.5 22 3.0 23 4.5 24 5.5 25 7.5 26 14.0 27 17.0 28 23.5 29 30.0 30 35.0 31 49.5 32 62.0 33 69.5 34 82.0 35 102.0 36 118.0 37 128.5 38 143.0 39 159.0 40 179.0 41 200.5 42 213.0 43 231.0 44 234.0 45 222.5 46 223.0 47 200.0 48 194.5 49 190.0 50 153.5 51 138.5 52 127.0 53 111.5 54 83.5 55 56.0 56 42.0 57 35.0 58 32.0 59 25.0 60 15.0 61 9.5 62 9.5 63 5.0 64 3.0 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5403329065301 96.2 2 1.0755441741357235 2.1 3 0.33290653008962867 0.975 4 0.02560819462227913 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02560819462227913 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 25 0.625 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.8499999999999996 0.0 0.0 0.0 0.0 126-127 4.137499999999999 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.1375 0.0 0.0 0.0 0.0 132-133 5.425 0.0 0.0 0.0 0.0 134-135 5.862500000000001 0.0 0.0 0.0 0.0 136-137 6.137499999999999 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAACC 10 0.006832588 144.9875 2 TTTTTTA 25 8.716269E-4 86.9925 3 AAAAAAA 105 0.0011967887 11.046666 65-69 >>END_MODULE SRR7170655 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170655_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56175 33.0 33.0 34.0 32.0 34.0 2 32.72175 33.0 33.0 34.0 32.0 34.0 3 32.6525 34.0 33.0 34.0 31.0 34.0 4 32.60225 34.0 33.0 34.0 32.0 34.0 5 32.5225 33.0 33.0 34.0 32.0 34.0 6 36.6775 38.0 38.0 38.0 35.0 38.0 7 36.63075 38.0 38.0 38.0 36.0 38.0 8 36.619 38.0 38.0 38.0 35.0 38.0 9 36.61675 38.0 38.0 38.0 35.0 38.0 10-14 36.642700000000005 38.0 38.0 38.0 35.2 38.0 15-19 36.639250000000004 38.0 38.0 38.0 35.2 38.0 20-24 36.64775 38.0 38.0 38.0 35.2 38.0 25-29 36.6035 38.0 38.0 38.0 35.6 38.0 30-34 36.6318 38.0 38.0 38.0 35.2 38.0 35-39 36.5673 38.0 38.0 38.0 35.2 38.0 40-44 36.603049999999996 38.0 38.0 38.0 35.4 38.0 45-49 36.403200000000005 38.0 38.0 38.0 34.6 38.0 50-54 36.4338 38.0 38.0 38.0 34.6 38.0 55-59 36.3938 38.0 38.0 38.0 34.4 38.0 60-64 36.34655 38.0 38.0 38.0 34.4 38.0 65-69 36.2841 38.0 38.0 38.0 34.0 38.0 70-74 36.30775 38.0 38.0 38.0 34.2 38.0 75-79 36.18495 38.0 38.0 38.0 34.0 38.0 80-84 36.0026 38.0 38.0 38.0 34.0 38.0 85-89 35.9302 38.0 38.0 38.0 33.8 38.0 90-94 35.79064999999999 38.0 38.0 38.0 33.0 38.0 95-99 35.7011 38.0 38.0 38.0 32.6 38.0 100-104 35.4678 38.0 37.0 38.0 31.0 38.0 105-109 35.388999999999996 38.0 37.2 38.0 30.6 38.0 110-114 35.1421 38.0 37.0 38.0 29.0 38.0 115-119 34.89985 38.0 36.6 38.0 27.8 38.0 120-124 34.76495 38.0 36.0 38.0 27.6 38.0 125-129 34.3536 38.0 35.6 38.0 24.4 38.0 130-134 33.86755 38.0 34.4 38.0 22.2 38.0 135-139 33.51565 38.0 33.4 38.0 20.4 38.0 140-144 32.9606 38.0 33.0 38.0 15.0 38.0 145-149 32.13505 38.0 33.0 38.0 8.4 38.0 150-151 26.98 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 12.0 4 7.0 5 2.0 6 1.0 7 3.0 8 5.0 9 4.0 10 4.0 11 4.0 12 5.0 13 6.0 14 5.0 15 5.0 16 7.0 17 11.0 18 18.0 19 14.0 20 9.0 21 11.0 22 11.0 23 17.0 24 18.0 25 11.0 26 17.0 27 30.0 28 34.0 29 44.0 30 51.0 31 55.0 32 87.0 33 126.0 34 170.0 35 238.0 36 591.0 37 2358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.7 17.65 15.15 23.5 2 25.75 21.025 33.925 19.3 3 21.224999999999998 25.2 33.225 20.349999999999998 4 23.05 35.875 21.825 19.25 5 23.75 37.45 21.2 17.599999999999998 6 19.25 36.225 24.2 20.325 7 18.925 17.599999999999998 42.925000000000004 20.549999999999997 8 21.075 23.05 26.75 29.125 9 21.0 24.75 27.175 27.075 10-14 23.985 27.985 26.369999999999997 21.66 15-19 24.3 27.310000000000002 27.860000000000003 20.53 20-24 23.855 28.144999999999996 27.355 20.645 25-29 23.875 27.515 27.845 20.765 30-34 23.48 27.54 28.32 20.66 35-39 24.175 28.355000000000004 26.75 20.72 40-44 23.915 27.82 27.66 20.605 45-49 24.04 26.919999999999998 28.299999999999997 20.74 50-54 24.13 27.07 27.6 21.2 55-59 23.905 27.505000000000003 27.73 20.86 60-64 23.810000000000002 27.67 27.6 20.919999999999998 65-69 24.23 27.27 27.925 20.575 70-74 23.86 28.13 26.884999999999998 21.125 75-79 23.82 27.67 27.955000000000002 20.555 80-84 23.125 27.884999999999998 28.02 20.97 85-89 23.82 27.500000000000004 27.634999999999998 21.044999999999998 90-94 23.724999999999998 27.185 28.375 20.715 95-99 23.46 27.250000000000004 28.02 21.27 100-104 24.075 27.025 28.444999999999997 20.455000000000002 105-109 24.705 27.49 28.255000000000003 19.55 110-114 23.974999999999998 28.01 27.705000000000002 20.31 115-119 24.645 27.05 27.925 20.380000000000003 120-124 24.46 27.605 27.51 20.424999999999997 125-129 24.82 27.169999999999998 27.43 20.580000000000002 130-134 23.945 27.325 27.655 21.075 135-139 24.975 27.815 27.255000000000003 19.955000000000002 140-144 25.835 27.67 26.775 19.72 145-149 25.174999999999997 27.165 27.605 20.055 150-151 25.11877969492373 27.66941735433858 27.46936734183546 19.742435608902227 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.5 16 1.0 17 1.5 18 2.0 19 1.0 20 0.0 21 1.0 22 1.0 23 2.5 24 5.0 25 5.5 26 5.0 27 5.5 28 9.0 29 13.5 30 14.0 31 13.5 32 22.0 33 37.5 34 49.5 35 60.5 36 79.5 37 107.5 38 121.0 39 134.0 40 177.5 41 204.5 42 208.5 43 214.5 44 224.5 45 256.5 46 271.0 47 254.0 48 237.5 49 209.0 50 180.0 51 159.5 52 142.5 53 130.0 54 110.0 55 85.0 56 71.0 57 61.5 58 42.0 59 22.0 60 10.0 61 9.0 62 12.0 63 6.0 64 0.5 65 0.5 66 0.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54070660522274 96.22500000000001 2 1.1008704557091653 2.15 3 0.2048131080389145 0.6 4 0.10240655401945725 0.4 5 0.0 0.0 6 0.025601638504864313 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025601638504864313 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 19 0.475 Illumina Single End PCR Primer 1 (96% over 32bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 3.9749999999999996 0.0 0.0 0.0 0.0 126-127 4.262499999999999 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 5.987500000000001 0.0 0.0 0.0 0.0 136-137 6.25 0.0 0.0 0.0 0.0 138-139 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGCT 10 0.006830828 145.0 6 TCATCCA 10 0.006830828 145.0 145 AAAAAAA 115 1.37751795E-5 12.608697 70-74 >>END_MODULE Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722911 spots for SRR7170655.sra Written 722911 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra Read 722910 spots for SRR7170655.sra Written 722910 spots for SRR7170655.sra SRR ids: ['SRR7170655.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ekt0j0zg SRR7170655.sra spots: 14458201 blocks: [[1, 722910], [722911, 1445820], [1445821, 2168730], [2168731, 2891640], [2891641, 3614550], [3614551, 4337460], [4337461, 5060370], [5060371, 5783280], [5783281, 6506190], [6506191, 7229100], [7229101, 7952010], [7952011, 8674920], [8674921, 9397830], [9397831, 10120740], [10120741, 10843650], [10843651, 11566560], [11566561, 12289470], [12289471, 13012380], [13012381, 13735290], [13735291, 14458201]] SRR7170655 file size 4877709 SRR7170655 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170655 SRR7170655_1.fastq SRR7170655_2.fastq Input file: SRR7170655_1.fastq Paired file: SRR7170655_2.fastq trimmed: SRR7170655-trimmed-pair1.fastq, SRR7170655-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:23:21 2025 >> started Thu Feb 13 14:23:49 2025 >> done (28.061s) 14458201 read pairs processed; of these: 31781 ( 0.22%) short read pairs filtered out after trimming by size control 122089 ( 0.84%) empty read pairs filtered out after trimming by size control 14304331 (98.94%) read pairs available; of these: 7126234 (49.82%) trimmed read pairs available after processing 7178097 (50.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 12 0.00% 21 18 0.00% 22 24 0.00% 23 19 0.00% 24 20 0.00% 25 22 0.00% 26 21 0.00% 27 26 0.00% 28 23 0.00% 29 15 0.00% 30 19 0.00% 31 25 0.00% 32 28 0.00% 33 23 0.00% 34 22 0.00% 35 19 0.00% 36 18 0.00% 37 35 0.00% 38 45 0.00% 39 48 0.00% 40 54 0.00% 41 42 0.00% 42 46 0.00% 43 45 0.00% 44 53 0.00% 45 98 0.00% 46 107 0.00% 47 112 0.00% 48 143 0.00% 49 136 0.00% 50 152 0.00% 51 160 0.00% 52 184 0.00% 53 208 0.00% 54 191 0.00% 55 233 0.00% 56 257 0.00% 57 293 0.00% 58 335 0.00% 59 350 0.00% 60 424 0.00% 61 443 0.00% 62 517 0.00% 63 533 0.00% 64 596 0.00% 65 611 0.00% 66 662 0.00% 67 685 0.00% 68 849 0.01% 69 882 0.01% 70 1008 0.01% 71 1194 0.01% 72 1495 0.01% 73 1619 0.01% 74 1819 0.01% 75 2163 0.02% 76 3317 0.02% 77 4116 0.03% 78 3241 0.02% 79 3078 0.02% 80 3023 0.02% 81 3474 0.02% 82 3774 0.03% 83 4364 0.03% 84 6080 0.04% 85 6930 0.05% 86 7667 0.05% 87 7835 0.05% 88 8083 0.06% 89 8575 0.06% 90 8944 0.06% 91 9311 0.07% 92 10082 0.07% 93 10676 0.07% 94 11040 0.08% 95 11379 0.08% 96 11815 0.08% 97 12278 0.09% 98 12543 0.09% 99 13156 0.09% 100 13683 0.10% 101 14170 0.10% 102 15337 0.11% 103 16265 0.11% 104 17011 0.12% 105 17733 0.12% 106 18346 0.13% 107 18585 0.13% 108 19014 0.13% 109 20205 0.14% 110 20611 0.14% 111 21132 0.15% 112 22618 0.16% 113 24154 0.17% 114 24236 0.17% 115 24561 0.17% 116 25584 0.18% 117 25539 0.18% 118 26246 0.18% 119 26757 0.19% 120 27932 0.20% 121 28873 0.20% 122 29475 0.21% 123 31061 0.22% 124 32416 0.23% 125 33142 0.23% 126 34008 0.24% 127 34674 0.24% 128 36416 0.25% 129 37567 0.26% 130 39203 0.27% 131 40098 0.28% 132 42142 0.29% 133 44927 0.31% 134 47046 0.33% 135 49297 0.34% 136 52091 0.36% 137 55010 0.38% 138 58653 0.41% 139 62921 0.44% 140 69002 0.48% 141 76313 0.53% 142 86136 0.60% 143 97866 0.68% 144 113953 0.80% 145 135919 0.95% 146 172215 1.20% 147 236805 1.66% 148 365976 2.56% 149 715061 5.00% 150 3624268 25.34% 151 7178097 50.18% 14304331 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=17 prefix-density=0.83 prefix-fanout=2.5 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=50.15 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.4 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=23 prefix-density=0.76 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=10.91 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.3 sequence=CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7170655 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:24:47 Started mapping on | Feb 13 14:24:48 Finished on | Feb 13 14:28:25 Mapping speed, Million of reads per hour | 237.31 Number of input reads | 14304331 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12854273 Uniquely mapped reads % | 89.86% Average mapped length | 293.40 Number of splices: Total | 11049829 Number of splices: Annotated (sjdb) | 10799219 Number of splices: GT/AG | 10824654 Number of splices: GC/AG | 179732 Number of splices: AT/AC | 9556 Number of splices: Non-canonical | 35887 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.03% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 448006 % of reads mapped to multiple loci | 3.13% Number of reads mapped to too many loci | 28228 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.71% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1031662 1031662 1031662 N_multimapping 448006 448006 448006 N_noFeature 372234 12568146 434505 N_ambiguous 330940 1097 106673 UnstrandedReadsAssigned:12151099 PositiveStrandReadsAssigned:285030 NegativeStrandReadsAssigned:12313095 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170655 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170655-trimmed-pair1.fastq SRR7170655-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,304,331 reads, 12,344,525 reads pseudoaligned [quant] estimated average fragment length: 254.369 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR7170655.ke.tsv 34699 SRR7170655.se.tsv 87100 total ==> SRR7170655.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.63 389 13.4843 Potri.005G024800.1.v4.1 1035 781.631 178 13.93 Potri.004G059700.1.v4.1 961 707.673 1 0.0864368 Potri.007G009000.2.v4.1 1416 1162.63 0 0 Potri.003G141000.2.v4.1 2943 2689.63 615.365 13.9949 Potri.016G087400.1.v4.1 270 76.9942 738 586.313 Potri.015G069301.1.v4.1 564 316.052 0 0 Potri.010G195200.1.v4.1 1773 1519.63 37 1.48934 Potri.012G127500.1.v4.1 977 723.645 170 14.3699 ==> SRR7170655.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 590 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 469 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7170655 completed mapping pipeline successfully