Starting /dee2/code/volunteer_pipeline.sh SRR7170656 current disk space = 3089590173696 free memory = 1443528092 SRR7170656 SRAfilesize 778a743fa4ccd8d91bc61e4899209b4b SRR7170656.sra SRR7170656.sra file validated SRR7170656 is paired end SRR7170656 is conventional basespace SRR7170656 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170656_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.47675 25.0 18.0 33.0 18.0 33.0 2 26.13225 27.0 18.0 31.0 18.0 33.0 3 29.34025 30.0 28.0 31.0 25.0 33.0 4 31.23325 33.0 31.0 33.0 29.0 33.0 5 32.293 33.0 33.0 33.0 32.0 33.0 6 36.658 38.0 37.0 38.0 34.0 38.0 7 37.018 38.0 37.0 38.0 35.0 38.0 8 37.399 38.0 38.0 38.0 37.0 38.0 9 37.4615 38.0 38.0 38.0 37.0 38.0 10-14 37.43055 38.0 38.0 38.0 37.0 38.0 15-19 37.479200000000006 38.0 38.0 38.0 37.6 38.0 20-24 37.53505 38.0 38.0 38.0 37.8 38.0 25-29 37.5099 38.0 38.0 38.0 38.0 38.0 30-34 37.53725 38.0 38.0 38.0 38.0 38.0 35-39 37.45805 38.0 38.0 38.0 37.6 38.0 40-44 37.424350000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.415350000000004 38.0 38.0 38.0 37.2 38.0 50-54 37.324 38.0 38.0 38.0 37.0 38.0 55-59 37.28705 38.0 38.0 38.0 37.0 38.0 60-64 37.18175 38.0 38.0 38.0 36.2 38.0 65-69 37.157050000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.0681 38.0 38.0 38.0 36.0 38.0 75-79 36.9096 38.0 38.0 38.0 35.6 38.0 80-84 36.849849999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.755700000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.66420000000001 38.0 38.0 38.0 34.8 38.0 95-99 36.46205 38.0 38.0 38.0 34.0 38.0 100-104 36.411500000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.18985 38.0 37.4 38.0 33.8 38.0 110-114 36.118700000000004 38.0 37.2 38.0 33.4 38.0 115-119 35.8989 38.0 37.0 38.0 32.6 38.0 120-124 35.64035 38.0 36.6 38.0 31.4 38.0 125-129 35.56510000000001 38.0 36.0 38.0 31.0 38.0 130-134 35.38315 38.0 36.0 38.0 31.0 38.0 135-139 35.0319 38.0 35.4 38.0 28.8 38.0 140-144 34.6088 38.0 34.6 38.0 28.0 38.0 145-149 33.753049999999995 38.0 33.0 38.0 24.0 38.0 150-151 29.323625 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 1.0 14 5.0 15 0.0 16 2.0 17 4.0 18 3.0 19 5.0 20 2.0 21 3.0 22 7.0 23 3.0 24 5.0 25 8.0 26 14.0 27 12.0 28 18.0 29 29.0 30 42.0 31 37.0 32 71.0 33 103.0 34 187.0 35 314.0 36 936.0 37 2185.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.524173027989825 15.954198473282444 13.155216284987278 32.36641221374046 2 21.025 23.625 37.525 17.825 3 17.974999999999998 29.95 27.55 24.525 4 21.025 35.575 22.325 21.075 5 20.906359539308962 37.20580871306961 23.209814722083124 18.678017025538306 6 16.425 35.3 26.375 21.9 7 12.925 20.8 46.575 19.7 8 17.95 21.05 29.099999999999998 31.900000000000002 9 17.25 23.125 30.599999999999998 29.025000000000002 10-14 19.134999999999998 29.770000000000003 26.284999999999997 24.81 15-19 19.675 29.005 27.279999999999998 24.04 20-24 19.125 29.185 27.284999999999997 24.404999999999998 25-29 20.169999999999998 29.345 26.805 23.68 30-34 19.3 28.965000000000003 27.725 24.01 35-39 20.39 29.07 26.900000000000002 23.64 40-44 19.78 28.575 27.61 24.035 45-49 19.96 28.615000000000002 27.189999999999998 24.235 50-54 19.97 28.225 27.71 24.095 55-59 20.0 28.77 27.855 23.375 60-64 19.835 28.02 27.634999999999998 24.51 65-69 20.025000000000002 28.15 27.694999999999997 24.13 70-74 19.695 29.25 27.48 23.575 75-79 19.85 28.76 27.095000000000002 24.295 80-84 20.16 28.74 26.905 24.195 85-89 20.244999999999997 28.794999999999998 26.724999999999998 24.235 90-94 20.225 28.77 27.534999999999997 23.47 95-99 20.68 28.655 27.055 23.61 100-104 20.13 28.315 27.800000000000004 23.755000000000003 105-109 20.715 28.255000000000003 27.584999999999997 23.445 110-114 20.87 28.54 27.165 23.425 115-119 20.474999999999998 28.499999999999996 26.840000000000003 24.185000000000002 120-124 21.08 28.18 26.93 23.810000000000002 125-129 20.474999999999998 28.560000000000002 26.740000000000002 24.224999999999998 130-134 20.75 28.38 26.55 24.32 135-139 21.205 27.485 26.99 24.32 140-144 21.15 27.63 27.065 24.154999999999998 145-149 20.455000000000002 28.249999999999996 27.029999999999998 24.265 150-151 21.10527631907977 28.119529882470616 26.04401100275069 24.731182795698924 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.0 18 0.0 19 1.5 20 2.5 21 3.0 22 2.5 23 3.0 24 6.0 25 7.5 26 9.0 27 11.0 28 12.0 29 22.5 30 37.5 31 41.5 32 47.0 33 59.0 34 70.0 35 79.0 36 98.5 37 125.5 38 147.0 39 156.5 40 169.5 41 183.5 42 194.5 43 206.0 44 219.5 45 231.5 46 226.0 47 227.0 48 227.0 49 208.0 50 179.5 51 157.0 52 137.5 53 113.5 54 94.5 55 76.0 56 54.5 57 42.0 58 37.5 59 26.0 60 14.5 61 12.0 62 7.5 63 3.5 64 2.0 65 0.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13155874072179 95.85000000000001 2 1.586895316099309 3.1 3 0.1791656002047607 0.525 4 0.05119017148707448 0.2 5 0.0 0.0 6 0.02559508574353724 0.15 7 0.02559508574353724 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 38bp) GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.5499999999999998 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.5 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138-139 4.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170656 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170656_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76175 33.0 33.0 34.0 32.0 34.0 2 32.8435 33.0 33.0 34.0 32.0 34.0 3 32.87025 34.0 33.0 34.0 32.0 34.0 4 32.81125 34.0 33.0 34.0 32.0 34.0 5 32.78975 34.0 33.0 34.0 32.0 34.0 6 36.9235 38.0 38.0 38.0 36.0 38.0 7 37.07875 38.0 38.0 38.0 36.0 38.0 8 37.10225 38.0 38.0 38.0 37.0 38.0 9 37.0915 38.0 38.0 38.0 36.0 38.0 10-14 37.06125 38.0 38.0 38.0 36.4 38.0 15-19 37.0276 38.0 38.0 38.0 36.2 38.0 20-24 37.03405 38.0 38.0 38.0 36.4 38.0 25-29 36.9918 38.0 38.0 38.0 36.0 38.0 30-34 36.9751 38.0 38.0 38.0 36.2 38.0 35-39 37.0101 38.0 38.0 38.0 36.2 38.0 40-44 36.98995 38.0 38.0 38.0 36.2 38.0 45-49 36.9455 38.0 38.0 38.0 36.2 38.0 50-54 36.9083 38.0 38.0 38.0 36.0 38.0 55-59 36.776149999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.77065 38.0 38.0 38.0 35.8 38.0 65-69 36.73555 38.0 38.0 38.0 35.4 38.0 70-74 36.70795 38.0 38.0 38.0 35.6 38.0 75-79 36.584799999999994 38.0 38.0 38.0 35.0 38.0 80-84 36.53495 38.0 38.0 38.0 34.8 38.0 85-89 36.47745 38.0 38.0 38.0 34.6 38.0 90-94 36.36575 38.0 38.0 38.0 34.2 38.0 95-99 36.30315 38.0 38.0 38.0 34.0 38.0 100-104 36.062799999999996 38.0 38.0 38.0 33.4 38.0 105-109 36.0131 38.0 37.6 38.0 33.2 38.0 110-114 35.76505 38.0 37.0 38.0 32.6 38.0 115-119 35.5576 38.0 37.0 38.0 31.4 38.0 120-124 35.560950000000005 38.0 36.8 38.0 31.2 38.0 125-129 35.128400000000006 38.0 36.0 38.0 29.2 38.0 130-134 34.8236 38.0 35.8 38.0 27.6 38.0 135-139 34.361 38.0 34.4 38.0 26.2 38.0 140-144 33.87595 38.0 33.0 38.0 23.4 38.0 145-149 33.0106 38.0 33.0 38.0 18.8 38.0 150-151 27.742375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 3.0 6 2.0 7 0.0 8 1.0 9 1.0 10 6.0 11 2.0 12 0.0 13 4.0 14 4.0 15 2.0 16 5.0 17 5.0 18 6.0 19 6.0 20 7.0 21 10.0 22 8.0 23 15.0 24 10.0 25 13.0 26 19.0 27 28.0 28 25.0 29 37.0 30 51.0 31 59.0 32 59.0 33 92.0 34 159.0 35 277.0 36 633.0 37 2443.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 16.6 14.625 30.025000000000002 2 24.3 24.725 35.275 15.7 3 21.075 26.125 31.075000000000003 21.725 4 24.375 35.949999999999996 20.625 19.05 5 22.35 38.5 20.325 18.825 6 17.675 36.975 24.075 21.275 7 16.625 15.55 44.3 23.525 8 20.05 23.25 26.575 30.125 9 23.3 22.900000000000002 28.199999999999996 25.6 10-14 23.56 28.88 25.295 22.264999999999997 15-19 23.735 27.87 26.955000000000002 21.44 20-24 23.195 27.67 27.445000000000004 21.69 25-29 22.755 28.29 26.965 21.990000000000002 30-34 23.65 27.700000000000003 27.405 21.245 35-39 23.62 27.555000000000003 27.295 21.529999999999998 40-44 23.915 27.07 27.279999999999998 21.735 45-49 23.575 27.265 27.794999999999998 21.365000000000002 50-54 23.015 27.705000000000002 27.67 21.61 55-59 23.255 27.925 27.295 21.525 60-64 23.365 27.07 27.405 22.16 65-69 23.285 27.465 27.339999999999996 21.91 70-74 23.665 27.800000000000004 27.165 21.37 75-79 24.099999999999998 27.715 27.05 21.135 80-84 23.815 27.48 27.474999999999998 21.23 85-89 24.104999999999997 27.650000000000002 27.060000000000002 21.185000000000002 90-94 23.865 27.439999999999998 27.345000000000002 21.349999999999998 95-99 23.47 28.365000000000002 27.0 21.165 100-104 24.07 27.744999999999997 27.534999999999997 20.65 105-109 23.665 28.29 27.245 20.8 110-114 24.474999999999998 27.67 27.465 20.39 115-119 23.905 28.389999999999997 27.105 20.599999999999998 120-124 24.425 27.565 27.065 20.945 125-129 25.095 27.525 27.284999999999997 20.095 130-134 25.295 27.075 27.55 20.080000000000002 135-139 24.595 27.775 27.26 20.369999999999997 140-144 24.39 27.675 27.37 20.565 145-149 24.93 27.639999999999997 27.3 20.13 150-151 25.674999999999997 26.987499999999997 27.8125 19.525000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 3.0 23 3.5 24 1.0 25 2.0 26 6.5 27 7.5 28 8.0 29 13.0 30 15.0 31 16.5 32 28.0 33 38.0 34 41.0 35 56.0 36 71.0 37 88.5 38 113.0 39 136.5 40 170.0 41 193.5 42 204.0 43 220.0 44 243.5 45 240.5 46 254.5 47 268.5 48 247.5 49 219.0 50 181.0 51 151.5 52 136.5 53 128.0 54 114.0 55 97.0 56 79.0 57 57.0 58 41.0 59 35.0 60 22.5 61 15.5 62 10.5 63 5.5 64 5.0 65 3.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.78692743180648 95.0 2 1.9042717447246524 3.6999999999999997 3 0.18013381369016984 0.525 4 0.0514668039114771 0.2 5 0.02573340195573855 0.125 6 0.0 0.0 7 0.02573340195573855 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02573340195573855 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 11 0.27499999999999997 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) GTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.4625 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.1625 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 3.9625000000000004 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.487500000000001 0.0 0.0 0.0 0.0 136-137 4.65 0.0 0.0 0.0 0.0 138-139 4.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCAAC 15 1.1411342E-4 145.0 7 ATGGCAA 40 0.005621335 54.375 6 >>END_MODULE Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876373 spots for SRR7170656.sra Written 876373 spots for SRR7170656.sra Read 876382 spots for SRR7170656.sra Written 876382 spots for SRR7170656.sra SRR ids: ['SRR7170656.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hyzib0oq SRR7170656.sra spots: 17527469 blocks: [[1, 876373], [876374, 1752746], [1752747, 2629119], [2629120, 3505492], [3505493, 4381865], [4381866, 5258238], [5258239, 6134611], [6134612, 7010984], [7010985, 7887357], [7887358, 8763730], [8763731, 9640103], [9640104, 10516476], [10516477, 11392849], [11392850, 12269222], [12269223, 13145595], [13145596, 14021968], [14021969, 14898341], [14898342, 15774714], [15774715, 16651087], [16651088, 17527469]] SRR7170656 file size 5917783 SRR7170656 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170656 SRR7170656_1.fastq SRR7170656_2.fastq Input file: SRR7170656_1.fastq Paired file: SRR7170656_2.fastq trimmed: SRR7170656-trimmed-pair1.fastq, SRR7170656-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:37:49 2025 >> started Thu Feb 13 14:38:08 2025 >> done (19.802s) 17527469 read pairs processed; of these: 12178 ( 0.07%) short read pairs filtered out after trimming by size control 36937 ( 0.21%) empty read pairs filtered out after trimming by size control 17478354 (99.72%) read pairs available; of these: 8648113 (49.48%) trimmed read pairs available after processing 8830241 (50.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 8 0.00% 21 7 0.00% 22 12 0.00% 23 9 0.00% 24 9 0.00% 25 7 0.00% 26 10 0.00% 27 8 0.00% 28 10 0.00% 29 10 0.00% 30 13 0.00% 31 14 0.00% 32 18 0.00% 33 17 0.00% 34 12 0.00% 35 19 0.00% 36 15 0.00% 37 18 0.00% 38 36 0.00% 39 34 0.00% 40 38 0.00% 41 35 0.00% 42 37 0.00% 43 44 0.00% 44 32 0.00% 45 52 0.00% 46 62 0.00% 47 80 0.00% 48 85 0.00% 49 87 0.00% 50 116 0.00% 51 129 0.00% 52 122 0.00% 53 137 0.00% 54 151 0.00% 55 152 0.00% 56 182 0.00% 57 176 0.00% 58 211 0.00% 59 245 0.00% 60 277 0.00% 61 318 0.00% 62 336 0.00% 63 419 0.00% 64 432 0.00% 65 499 0.00% 66 484 0.00% 67 516 0.00% 68 585 0.00% 69 713 0.00% 70 786 0.00% 71 887 0.01% 72 1113 0.01% 73 1182 0.01% 74 1434 0.01% 75 1535 0.01% 76 2225 0.01% 77 2687 0.02% 78 2328 0.01% 79 2397 0.01% 80 2337 0.01% 81 2754 0.02% 82 3156 0.02% 83 3500 0.02% 84 4503 0.03% 85 5367 0.03% 86 5437 0.03% 87 5830 0.03% 88 6193 0.04% 89 6437 0.04% 90 6956 0.04% 91 7470 0.04% 92 8046 0.05% 93 8771 0.05% 94 9467 0.05% 95 9773 0.06% 96 10279 0.06% 97 10847 0.06% 98 10953 0.06% 99 11749 0.07% 100 12230 0.07% 101 12966 0.07% 102 14178 0.08% 103 14650 0.08% 104 15742 0.09% 105 16622 0.10% 106 17373 0.10% 107 17738 0.10% 108 18306 0.10% 109 19057 0.11% 110 19536 0.11% 111 20608 0.12% 112 21749 0.12% 113 23168 0.13% 114 23968 0.14% 115 24159 0.14% 116 24998 0.14% 117 25767 0.15% 118 26770 0.15% 119 27399 0.16% 120 28351 0.16% 121 29434 0.17% 122 30284 0.17% 123 32775 0.19% 124 33632 0.19% 125 34365 0.20% 126 36150 0.21% 127 37653 0.22% 128 39250 0.22% 129 40528 0.23% 130 42431 0.24% 131 43357 0.25% 132 46634 0.27% 133 49066 0.28% 134 51806 0.30% 135 56112 0.32% 136 60008 0.34% 137 64837 0.37% 138 69144 0.40% 139 75700 0.43% 140 82465 0.47% 141 92614 0.53% 142 104610 0.60% 143 122218 0.70% 144 144276 0.83% 145 174197 1.00% 146 222425 1.27% 147 305098 1.75% 148 478093 2.74% 149 960423 5.49% 150 4499742 25.74% 151 8830241 50.52% 17478354 reads passed initial QC criterion=sequence-density sequence-density=1.25 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=25 prefix-density=1.34 prefix-fanout=2.3 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=29.22 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.9 sequence=ATTAAGGCACACATATTATTGATTTGCATCGACACAAATAAGATACATAGAGGGGTGGCTAGCTTTATTACATAAATACATACCCACATGATGATGAAGGCATCGATCGCCCTTACACGCTGCACCTTCAATTAATTAAAAGGTAAGCACGTCAAGAACCGGCCTTGCCATCTCAGTGAATATGGTAGCTAGCTAGACATGACGCAGTACATATTATAATGAGCTGATGGGAACATGCATGTACGTATGCACCTTTGAAAGTTTTATTTCTCAATACAAATACTATATATTATTAGAAATTAAGGGCATGCATGCATGTTCTATTGTGCTTGCTAATTTTACTTAATGTGATTATCAACAGCCTGGCTGACAGATTTCAAAAGGGCGAGGTATTCTTGAGGATCTGTGTCCTTATAATAGACAGTCCATTTTGCAAGGACAGCAAGGCTGTCCTCTGTAACCTCTAATTTGACCTTGGTGATGTCACCTAGGATCCCTCCATTCTCTATTT criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=30 prefix-density=0.95 prefix-fanout=2.1 sequence=GAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=59.78 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGC SRR7170656 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:38:55 Started mapping on | Feb 13 14:38:55 Finished on | Feb 13 14:42:23 Mapping speed, Million of reads per hour | 302.51 Number of input reads | 17478354 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15570261 Uniquely mapped reads % | 89.08% Average mapped length | 294.86 Number of splices: Total | 14991197 Number of splices: Annotated (sjdb) | 14702081 Number of splices: GT/AG | 14705246 Number of splices: GC/AG | 237223 Number of splices: AT/AC | 12315 Number of splices: Non-canonical | 36413 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456539 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 96392 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.64% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1464418 1464418 1464418 N_multimapping 456539 456539 456539 N_noFeature 424218 15294513 487319 N_ambiguous 353050 703 140068 UnstrandedReadsAssigned:14792993 PositiveStrandReadsAssigned:275045 NegativeStrandReadsAssigned:14942874 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170656 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170656-trimmed-pair1.fastq SRR7170656-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,478,354 reads, 15,004,907 reads pseudoaligned [quant] estimated average fragment length: 264.188 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR7170656.ke.tsv 34699 SRR7170656.se.tsv 87100 total ==> SRR7170656.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.81 293 7.57409 Potri.005G024800.1.v4.1 1035 771.812 234 13.753 Potri.004G059700.1.v4.1 961 697.856 2 0.130004 Potri.007G009000.2.v4.1 1416 1152.81 0 0 Potri.003G141000.2.v4.1 2943 2679.81 304 5.14591 Potri.016G087400.1.v4.1 270 74.4944 1495 910.355 Potri.015G069301.1.v4.1 564 307.661 0 0 Potri.010G195200.1.v4.1 1773 1509.81 4 0.120179 Potri.012G127500.1.v4.1 977 713.827 677 43.0218 ==> SRR7170656.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 506 Potri.001G212900.v4.1 983 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7170656 completed mapping pipeline successfully