Starting /dee2/code/volunteer_pipeline.sh SRR7170657 current disk space = 3089215504384 free memory = 1464718784 SRR7170657 SRAfilesize 74777e7d8428eb77fd8fcbd780d74596 SRR7170657.sra SRR7170657.sra file validated SRR7170657 is paired end SRR7170657 is conventional basespace SRR7170657 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170657_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.3065 18.0 18.0 25.0 18.0 32.0 2 25.32575 27.0 25.0 29.0 18.0 31.0 3 26.051 27.0 25.0 29.0 18.0 31.0 4 29.4495 30.0 29.0 31.0 27.0 33.0 5 30.82325 32.0 32.0 33.0 27.0 33.0 6 35.89525 37.0 36.0 38.0 33.0 38.0 7 36.89775 38.0 37.0 38.0 35.0 38.0 8 36.843 38.0 38.0 38.0 35.0 38.0 9 37.081 38.0 38.0 38.0 36.0 38.0 10-14 37.2541 38.0 38.0 38.0 36.6 38.0 15-19 37.32449999999999 38.0 38.0 38.0 36.8 38.0 20-24 37.48025 38.0 38.0 38.0 37.4 38.0 25-29 37.4823 38.0 38.0 38.0 37.2 38.0 30-34 37.458800000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.45055 38.0 38.0 38.0 37.2 38.0 40-44 37.397800000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.374199999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.28125 38.0 38.0 38.0 36.6 38.0 55-59 37.1846 38.0 38.0 38.0 36.2 38.0 60-64 37.17765000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.07755 38.0 38.0 38.0 36.0 38.0 70-74 37.004 38.0 38.0 38.0 36.0 38.0 75-79 36.93675 38.0 38.0 38.0 35.4 38.0 80-84 36.85395 38.0 38.0 38.0 35.0 38.0 85-89 36.79225 38.0 38.0 38.0 34.8 38.0 90-94 36.540099999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.5111 38.0 38.0 38.0 34.0 38.0 100-104 36.384299999999996 38.0 37.6 38.0 34.0 38.0 105-109 36.2504 38.0 37.0 38.0 33.4 38.0 110-114 35.97455 38.0 36.8 38.0 32.4 38.0 115-119 35.66135 38.0 36.2 38.0 30.6 38.0 120-124 35.5676 38.0 36.0 38.0 31.0 38.0 125-129 35.37765 38.0 36.0 38.0 30.0 38.0 130-134 35.021550000000005 38.0 35.0 38.0 28.0 38.0 135-139 34.71515 38.0 34.4 38.0 27.2 38.0 140-144 34.075300000000006 38.0 33.2 38.0 24.4 38.0 145-149 33.227700000000006 38.0 33.0 38.0 21.8 38.0 150-151 28.924875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 3.0 20 2.0 21 2.0 22 7.0 23 4.0 24 4.0 25 7.0 26 20.0 27 15.0 28 17.0 29 31.0 30 38.0 31 63.0 32 92.0 33 134.0 34 209.0 35 447.0 36 1124.0 37 1772.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.99541634835753 25.59205500381971 10.2113572701808 30.201171377641966 2 22.05 25.55 35.725 16.675 3 18.4 31.924999999999997 26.775 22.900000000000002 4 20.525 36.55 21.65 21.275 5 19.575 37.15 23.724999999999998 19.55 6 17.45 36.25 24.025 22.275 7 12.65 19.825 45.45 22.075 8 18.05 20.45 27.6 33.900000000000006 9 17.95 21.175 31.7 29.175 10-14 19.23 29.409999999999997 27.02 24.34 15-19 19.75 28.645 27.834999999999997 23.77 20-24 19.85 28.63 28.075 23.445 25-29 19.415 28.64 28.17 23.775 30-34 19.75 28.494999999999997 27.97 23.785 35-39 20.0 28.57 27.689999999999998 23.74 40-44 19.744999999999997 28.54 27.83 23.885 45-49 19.425 28.76 27.33 24.485 50-54 19.875 28.865000000000002 27.860000000000003 23.400000000000002 55-59 19.715 28.21 28.34 23.735 60-64 19.75 28.804999999999996 28.139999999999997 23.305 65-69 19.89 28.57 28.349999999999998 23.189999999999998 70-74 19.79 28.475 27.900000000000002 23.835 75-79 20.125 28.43 27.755000000000003 23.69 80-84 19.7 28.005000000000003 28.235 24.060000000000002 85-89 20.095 28.005000000000003 28.689999999999998 23.21 90-94 19.915 28.64 28.26 23.185 95-99 20.244999999999997 28.244999999999997 27.605 23.905 100-104 19.485 28.470000000000002 28.134999999999998 23.91 105-109 20.19 27.98 28.42 23.41 110-114 20.24 28.03 28.16 23.57 115-119 20.485 28.499999999999996 27.37 23.645 120-124 20.549999999999997 28.235 27.91 23.305 125-129 20.18 28.095 27.515 24.21 130-134 20.14 27.800000000000004 28.035 24.025 135-139 20.505000000000003 27.939999999999998 27.92 23.635 140-144 20.62 27.97 27.400000000000002 24.01 145-149 20.14 27.735 27.965 24.16 150-151 20.5 26.85 28.475 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 2.0 22 2.0 23 1.5 24 4.0 25 5.0 26 5.5 27 7.5 28 11.5 29 18.5 30 23.5 31 29.5 32 40.0 33 49.5 34 55.0 35 70.5 36 94.5 37 124.5 38 151.5 39 180.0 40 199.5 41 212.5 42 245.5 43 268.5 44 281.0 45 277.0 46 258.0 47 243.5 48 218.5 49 191.5 50 164.5 51 133.5 52 108.5 53 85.5 54 69.5 55 45.5 56 25.0 57 26.0 58 20.5 59 13.5 60 10.5 61 8.0 62 6.5 63 3.0 64 2.0 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.2249999999999996 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138-139 2.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170657 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170657_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.593 33.0 33.0 34.0 32.0 34.0 2 32.70125 33.0 33.0 34.0 32.0 34.0 3 32.6455 33.0 33.0 34.0 32.0 34.0 4 32.68625 33.0 33.0 34.0 32.0 34.0 5 32.67825 33.0 33.0 34.0 32.0 34.0 6 36.75775 38.0 38.0 38.0 36.0 38.0 7 36.75025 38.0 38.0 38.0 35.0 38.0 8 36.8955 38.0 38.0 38.0 36.0 38.0 9 36.91025 38.0 38.0 38.0 36.0 38.0 10-14 36.86385 38.0 38.0 38.0 35.8 38.0 15-19 36.83835 38.0 38.0 38.0 36.0 38.0 20-24 36.77804999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.75175 38.0 38.0 38.0 35.8 38.0 30-34 36.66435 38.0 38.0 38.0 35.0 38.0 35-39 36.69735 38.0 38.0 38.0 35.4 38.0 40-44 36.6681 38.0 38.0 38.0 35.2 38.0 45-49 36.65599999999999 38.0 38.0 38.0 35.0 38.0 50-54 36.51985 38.0 38.0 38.0 34.6 38.0 55-59 36.453149999999994 38.0 38.0 38.0 34.2 38.0 60-64 36.51775 38.0 38.0 38.0 34.2 38.0 65-69 36.3411 38.0 38.0 38.0 33.8 38.0 70-74 36.29425 38.0 38.0 38.0 33.8 38.0 75-79 36.340999999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.26004999999999 38.0 38.0 38.0 33.8 38.0 85-89 36.06009999999999 38.0 38.0 38.0 33.2 38.0 90-94 35.8601 38.0 37.0 38.0 32.2 38.0 95-99 35.782250000000005 38.0 37.0 38.0 31.6 38.0 100-104 35.542899999999996 38.0 37.0 38.0 30.2 38.0 105-109 35.39444999999999 38.0 36.4 38.0 30.2 38.0 110-114 35.1302 38.0 36.0 38.0 28.2 38.0 115-119 34.9755 38.0 36.0 38.0 27.8 38.0 120-124 34.716449999999995 38.0 35.2 38.0 27.2 38.0 125-129 34.2154 38.0 34.6 38.0 23.6 38.0 130-134 33.623450000000005 38.0 33.0 38.0 21.4 38.0 135-139 33.0415 38.0 33.0 38.0 18.4 38.0 140-144 32.430600000000005 38.0 32.8 38.0 14.4 38.0 145-149 31.23965 37.0 31.0 38.0 8.2 38.0 150-151 25.71425 32.5 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 4.0 4 3.0 5 2.0 6 1.0 7 0.0 8 1.0 9 3.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 7.0 16 6.0 17 11.0 18 5.0 19 5.0 20 10.0 21 12.0 22 13.0 23 11.0 24 18.0 25 17.0 26 29.0 27 36.0 28 39.0 29 56.0 30 54.0 31 81.0 32 102.0 33 136.0 34 217.0 35 363.0 36 856.0 37 1885.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45 17.65 14.524999999999999 29.375 2 22.95 24.5 35.3 17.25 3 18.675 27.375 32.875 21.075 4 22.075 36.7 22.875 18.35 5 22.95 37.85 21.725 17.474999999999998 6 17.39674593241552 37.6720901126408 24.58072590738423 20.35043804755945 7 16.23717788341256 16.81260945709282 46.50988241180885 20.440330247685765 8 20.590442832124094 21.115836877658246 27.695771828871653 30.597948461346007 9 20.915686765073804 23.19239429572179 28.34625969477108 27.545659244433324 10-14 21.76132099074306 28.641481110833123 27.78083562672004 21.816362271703778 15-19 22.39283749312259 27.484619616865903 28.77006952433352 21.352473365677987 20-24 22.785253364013805 28.087639437746986 28.492821769796407 20.6342854284428 25-29 22.332282755515536 28.450647856320977 27.970383711041073 21.246685677122418 30-34 22.097153434388915 28.160488268547702 28.645755165340937 21.096603131722446 35-39 22.344523940561363 27.567919147445842 28.618602091359385 21.468954820633414 40-44 22.61100265305101 28.22746158081794 27.887070130650248 21.2744656354808 45-49 22.38955320958623 27.97818582078351 28.638615099814878 20.99364586981538 50-54 21.81026718703092 28.414890423296306 28.444911438006603 21.329930951666164 55-59 22.523018414731784 27.722177742193754 28.557846277021614 21.196957566052845 60-64 22.73546191572415 28.195375838254428 28.100290261235113 20.968871984786308 65-69 22.716815044513353 27.888366509952984 28.063419025707713 21.331399419825946 70-74 22.918021307457607 28.164857700195068 27.689691391987196 21.227429600360125 75-79 22.61017457856035 28.447801510679803 27.97758991546196 20.964433995297885 80-84 22.984193677470987 28.07623049219688 27.936174469787918 21.00340136054422 85-89 22.775248861987897 27.77749987494372 28.232704717122704 21.214546545945677 90-94 23.028059820937326 27.71470014505077 28.27489621367479 20.982343820337118 95-99 22.42121060530265 28.104052026013004 28.214107053526767 21.260630315157577 100-104 23.172745009755367 27.305017759767875 28.315573565461005 21.20666366501576 105-109 23.434919681729472 27.80863734174048 27.913726667667515 20.84271630886253 110-114 22.741604524298083 28.35693909213753 28.336920074070367 20.56453630949402 115-119 24.055636163506282 28.058237854605494 27.502876869965476 20.383249111922748 120-124 23.333666933546837 27.93234587670136 28.22257806244996 20.511409127301842 125-129 24.012812171562985 27.756368550122616 28.14673940243231 20.08407987588209 130-134 23.334834609418007 28.038833008056844 27.94875644297653 20.677575939548618 135-139 23.039191150708245 27.94434155863657 28.264677911807397 20.75178937884779 140-144 24.161409832782617 27.906278161610093 28.00640833083008 19.92590367477721 145-149 24.16983396679336 27.230446089217843 28.020604120824167 20.579115823164635 150-151 23.474999999999998 27.800000000000004 27.8125 20.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 5.5 25 9.0 26 7.5 27 9.0 28 11.0 29 11.0 30 15.0 31 26.5 32 31.5 33 41.0 34 60.5 35 71.5 36 85.5 37 102.5 38 136.5 39 178.0 40 198.5 41 221.5 42 260.0 43 289.5 44 281.5 45 271.0 46 252.0 47 237.5 48 219.5 49 191.5 50 167.0 51 131.0 52 106.5 53 81.0 54 66.5 55 50.5 56 39.0 57 34.5 58 25.5 59 21.0 60 18.0 61 11.0 62 4.5 63 3.5 64 2.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.075 8 0.075 9 0.075 10-14 0.075 15-19 0.034999999999999996 20-24 0.045 25-29 0.055 30-34 0.055 35-39 0.065 40-44 0.11499999999999999 45-49 0.065 50-54 0.06999999999999999 55-59 0.08 60-64 0.09 65-69 0.03 70-74 0.034999999999999996 75-79 0.045 80-84 0.04 85-89 0.045 90-94 0.034999999999999996 95-99 0.05 100-104 0.055 105-109 0.08499999999999999 110-114 0.095 115-119 0.065 120-124 0.08 125-129 0.095 130-134 0.08499999999999999 135-139 0.105 140-144 0.13 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14206409285894 98.225 2 0.7822356800403736 1.55 3 0.0757002271006813 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7625000000000002 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 1.9875 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138-139 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848433 spots for SRR7170657.sra Written 848433 spots for SRR7170657.sra Read 848445 spots for SRR7170657.sra Written 848445 spots for SRR7170657.sra SRR ids: ['SRR7170657.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o9hp8ntp SRR7170657.sra spots: 16968672 blocks: [[1, 848433], [848434, 1696866], [1696867, 2545299], [2545300, 3393732], [3393733, 4242165], [4242166, 5090598], [5090599, 5939031], [5939032, 6787464], [6787465, 7635897], [7635898, 8484330], [8484331, 9332763], [9332764, 10181196], [10181197, 11029629], [11029630, 11878062], [11878063, 12726495], [12726496, 13574928], [13574929, 14423361], [14423362, 15271794], [15271795, 16120227], [16120228, 16968672]] SRR7170657 file size 5728425 SRR7170657 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170657 SRR7170657_1.fastq SRR7170657_2.fastq Input file: SRR7170657_1.fastq Paired file: SRR7170657_2.fastq trimmed: SRR7170657-trimmed-pair1.fastq, SRR7170657-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:08:25 2025 >> started Thu Feb 13 15:08:44 2025 >> done (18.478s) 16968672 read pairs processed; of these: 20020 ( 0.12%) short read pairs filtered out after trimming by size control 21577 ( 0.13%) empty read pairs filtered out after trimming by size control 16927075 (99.75%) read pairs available; of these: 9101826 (53.77%) trimmed read pairs available after processing 7825249 (46.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 9 0.00% 21 11 0.00% 22 8 0.00% 23 10 0.00% 24 6 0.00% 25 6 0.00% 26 9 0.00% 27 17 0.00% 28 13 0.00% 29 10 0.00% 30 12 0.00% 31 7 0.00% 32 13 0.00% 33 7 0.00% 34 18 0.00% 35 19 0.00% 36 20 0.00% 37 9 0.00% 38 26 0.00% 39 21 0.00% 40 20 0.00% 41 22 0.00% 42 27 0.00% 43 19 0.00% 44 32 0.00% 45 30 0.00% 46 27 0.00% 47 50 0.00% 48 50 0.00% 49 53 0.00% 50 72 0.00% 51 75 0.00% 52 78 0.00% 53 92 0.00% 54 97 0.00% 55 107 0.00% 56 114 0.00% 57 112 0.00% 58 102 0.00% 59 165 0.00% 60 170 0.00% 61 222 0.00% 62 224 0.00% 63 223 0.00% 64 246 0.00% 65 285 0.00% 66 285 0.00% 67 352 0.00% 68 387 0.00% 69 422 0.00% 70 495 0.00% 71 547 0.00% 72 692 0.00% 73 721 0.00% 74 802 0.00% 75 977 0.01% 76 1109 0.01% 77 1117 0.01% 78 1189 0.01% 79 1355 0.01% 80 1517 0.01% 81 1680 0.01% 82 1903 0.01% 83 2222 0.01% 84 3131 0.02% 85 3907 0.02% 86 4078 0.02% 87 4345 0.03% 88 4354 0.03% 89 4656 0.03% 90 4966 0.03% 91 5047 0.03% 92 5327 0.03% 93 6041 0.04% 94 6473 0.04% 95 6537 0.04% 96 7035 0.04% 97 7345 0.04% 98 7409 0.04% 99 8014 0.05% 100 8447 0.05% 101 9040 0.05% 102 9596 0.06% 103 10079 0.06% 104 10582 0.06% 105 11081 0.07% 106 11728 0.07% 107 12021 0.07% 108 12629 0.07% 109 13112 0.08% 110 13511 0.08% 111 14404 0.09% 112 15025 0.09% 113 15768 0.09% 114 16761 0.10% 115 17265 0.10% 116 18027 0.11% 117 18816 0.11% 118 19574 0.12% 119 20246 0.12% 120 21656 0.13% 121 22497 0.13% 122 24016 0.14% 123 26007 0.15% 124 27110 0.16% 125 28625 0.17% 126 30096 0.18% 127 32278 0.19% 128 34659 0.20% 129 35640 0.21% 130 37585 0.22% 131 40705 0.24% 132 44214 0.26% 133 47651 0.28% 134 51708 0.31% 135 56222 0.33% 136 61592 0.36% 137 68360 0.40% 138 75368 0.45% 139 85519 0.51% 140 95879 0.57% 141 110158 0.65% 142 127718 0.75% 143 150262 0.89% 144 178411 1.05% 145 220293 1.30% 146 278930 1.65% 147 385329 2.28% 148 590040 3.49% 149 1144570 6.76% 150 4581605 27.07% 151 7825249 46.23% 16927075 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=18 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=43.02 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=11.5 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=14 prefix-density=0.71 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=18.71 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.1 sequence=CAGCATCCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR7170657 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:09:29 Started mapping on | Feb 13 15:09:29 Finished on | Feb 13 15:11:19 Mapping speed, Million of reads per hour | 553.98 Number of input reads | 16927075 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15901806 Uniquely mapped reads % | 93.94% Average mapped length | 295.08 Number of splices: Total | 15897607 Number of splices: Annotated (sjdb) | 15544076 Number of splices: GT/AG | 15602767 Number of splices: GC/AG | 244447 Number of splices: AT/AC | 8763 Number of splices: Non-canonical | 41630 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437278 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 12701 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 606371 606371 606371 N_multimapping 437278 437278 437278 N_noFeature 632610 15676651 722600 N_ambiguous 232886 1116 97026 UnstrandedReadsAssigned:15036310 PositiveStrandReadsAssigned:224039 NegativeStrandReadsAssigned:15082180 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170657 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170657-trimmed-pair1.fastq SRR7170657-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,927,075 reads, 15,003,905 reads pseudoaligned [quant] estimated average fragment length: 301.441 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7170657.ke.tsv 34699 SRR7170657.se.tsv 87100 total ==> SRR7170657.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1717.56 477 19.4831 Potri.005G024800.1.v4.1 1035 734.559 103 9.83698 Potri.004G059700.1.v4.1 961 660.675 7 0.743296 Potri.007G009000.2.v4.1 1416 1115.56 0 0 Potri.003G141000.2.v4.1 2943 2642.56 701.311 18.6182 Potri.016G087400.1.v4.1 270 67.8652 631 652.28 Potri.015G069301.1.v4.1 564 277.177 0 0 Potri.010G195200.1.v4.1 1773 1472.56 23 1.09574 Potri.012G127500.1.v4.1 977 676.637 63 6.53185 ==> SRR7170657.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1396 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 64 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170657 completed mapping pipeline successfully