Starting /dee2/code/volunteer_pipeline.sh SRR7170658 current disk space = 3089518379008 free memory = 1417117132 SRR7170658 SRAfilesize a3a375432de3169bc1624e22f5813e60 SRR7170658.sra SRR7170658.sra file validated SRR7170658 is paired end SRR7170658 is conventional basespace SRR7170658 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170658_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.97125 18.0 18.0 25.0 18.0 32.0 2 24.91225 27.0 18.0 27.0 18.0 30.0 3 25.661 27.0 25.0 29.0 18.0 31.0 4 29.2185 30.0 27.0 31.0 27.0 33.0 5 30.6955 32.0 32.0 33.0 27.0 33.0 6 35.7455 37.0 36.0 38.0 31.0 38.0 7 36.82975 38.0 37.0 38.0 35.0 38.0 8 36.83 38.0 37.0 38.0 34.0 38.0 9 37.05575 38.0 38.0 38.0 36.0 38.0 10-14 37.23779999999999 38.0 38.0 38.0 36.0 38.0 15-19 37.361599999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.520849999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.49444999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.486900000000006 38.0 38.0 38.0 37.2 38.0 35-39 37.47005 38.0 38.0 38.0 37.2 38.0 40-44 37.425799999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.37265 38.0 38.0 38.0 37.0 38.0 50-54 37.303700000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.221450000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.144099999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.062850000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.957300000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.932 38.0 38.0 38.0 35.6 38.0 80-84 36.81845 38.0 38.0 38.0 35.0 38.0 85-89 36.790049999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.5874 38.0 38.0 38.0 34.2 38.0 95-99 36.47065 38.0 37.6 38.0 34.0 38.0 100-104 36.348349999999996 38.0 37.0 38.0 33.8 38.0 105-109 36.2663 38.0 37.0 38.0 33.8 38.0 110-114 35.9476 38.0 37.0 38.0 32.2 38.0 115-119 35.85015 38.0 36.0 38.0 31.8 38.0 120-124 35.58895 38.0 36.0 38.0 30.6 38.0 125-129 35.275150000000004 38.0 35.6 38.0 28.4 38.0 130-134 34.93895 38.0 34.8 38.0 28.0 38.0 135-139 34.63995 38.0 34.2 38.0 27.2 38.0 140-144 33.97085 38.0 33.2 38.0 24.0 38.0 145-149 33.01275 38.0 33.0 38.0 19.0 38.0 150-151 28.732 35.5 23.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 2.0 21 1.0 22 2.0 23 6.0 24 7.0 25 17.0 26 11.0 27 18.0 28 18.0 29 35.0 30 43.0 31 70.0 32 85.0 33 137.0 34 233.0 35 463.0 36 1181.0 37 1667.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.56463975472662 25.907000510986204 9.427695452222789 29.100664282064386 2 21.525 25.650000000000002 35.025 17.8 3 19.05 30.875000000000004 27.575 22.5 4 21.05 36.65 22.075 20.225 5 20.355088772193046 36.30907726931733 22.9057264316079 20.43010752688172 6 17.275 35.675000000000004 23.95 23.1 7 12.775 19.825 45.574999999999996 21.825 8 17.474999999999998 20.7 28.249999999999996 33.575 9 17.325 21.575 29.25 31.85 10-14 19.64 29.865000000000002 26.365 24.13 15-19 19.755 27.855 27.939999999999998 24.45 20-24 19.715 28.449999999999996 28.244999999999997 23.59 25-29 19.845 28.565 28.000000000000004 23.59 30-34 19.875 28.17 27.939999999999998 24.015 35-39 20.195 27.750000000000004 28.205000000000002 23.849999999999998 40-44 19.53 28.939999999999998 27.939999999999998 23.59 45-49 20.21 28.49 27.775 23.525 50-54 19.73 29.115000000000002 27.534999999999997 23.62 55-59 19.900000000000002 28.21 27.77 24.12 60-64 19.91 28.999999999999996 27.500000000000004 23.59 65-69 19.46 28.675 28.244999999999997 23.62 70-74 19.939999999999998 28.505000000000003 27.77 23.785 75-79 20.265 28.58 27.55 23.605 80-84 20.185 28.895 27.12 23.799999999999997 85-89 20.14 27.79 28.199999999999996 23.87 90-94 19.950000000000003 27.98 28.015 24.055 95-99 20.41 27.99 28.13 23.47 100-104 20.68 28.22 27.615000000000002 23.485 105-109 20.025000000000002 28.275 27.675 24.025 110-114 20.225 27.875 28.410000000000004 23.49 115-119 20.46 28.92 27.265 23.355 120-124 20.495 28.294999999999998 27.815 23.395 125-129 20.830000000000002 28.435 27.200000000000003 23.535 130-134 20.3 28.455000000000002 27.58 23.665 135-139 20.91 28.725 27.02 23.345 140-144 20.805 27.975 27.589999999999996 23.630000000000003 145-149 20.5 28.849999999999998 27.005000000000003 23.645 150-151 20.7 28.1625 27.3125 23.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.5 24 5.0 25 6.5 26 5.0 27 8.5 28 12.5 29 15.5 30 22.0 31 25.5 32 33.5 33 47.5 34 52.5 35 69.5 36 90.5 37 108.0 38 129.5 39 165.0 40 202.5 41 214.0 42 223.0 43 253.0 44 271.5 45 279.0 46 283.0 47 267.0 48 233.5 49 203.0 50 180.5 51 148.0 52 110.0 53 85.5 54 69.5 55 51.5 56 37.5 57 22.5 58 18.0 59 14.5 60 8.0 61 6.5 62 5.5 63 3.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9125000000000001 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 2.0250000000000004 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.4875 0.0 0.0 0.0 0.0 136-137 2.7125000000000004 0.0 0.0 0.0 0.0 138-139 2.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170658 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170658_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.633 33.0 33.0 34.0 32.0 34.0 2 32.80525 33.0 33.0 34.0 32.0 34.0 3 32.7935 33.0 33.0 34.0 32.0 34.0 4 32.78975 33.0 33.0 34.0 32.0 34.0 5 32.78525 33.0 33.0 34.0 32.0 34.0 6 36.9625 38.0 38.0 38.0 36.0 38.0 7 36.85375 38.0 38.0 38.0 36.0 38.0 8 36.95625 38.0 38.0 38.0 36.0 38.0 9 36.95175 38.0 38.0 38.0 36.0 38.0 10-14 36.909150000000004 38.0 38.0 38.0 36.0 38.0 15-19 36.93265 38.0 38.0 38.0 36.0 38.0 20-24 36.91995 38.0 38.0 38.0 36.0 38.0 25-29 36.876799999999996 38.0 38.0 38.0 35.8 38.0 30-34 36.813 38.0 38.0 38.0 35.8 38.0 35-39 36.81875 38.0 38.0 38.0 36.0 38.0 40-44 36.83565 38.0 38.0 38.0 36.0 38.0 45-49 36.76950000000001 38.0 38.0 38.0 35.4 38.0 50-54 36.6663 38.0 38.0 38.0 35.2 38.0 55-59 36.5277 38.0 38.0 38.0 34.2 38.0 60-64 36.575050000000005 38.0 38.0 38.0 34.8 38.0 65-69 36.4514 38.0 38.0 38.0 34.2 38.0 70-74 36.482299999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.39615 38.0 38.0 38.0 34.0 38.0 80-84 36.22625 38.0 38.0 38.0 33.8 38.0 85-89 36.18465 38.0 38.0 38.0 33.6 38.0 90-94 35.967 38.0 37.0 38.0 32.6 38.0 95-99 35.867599999999996 38.0 37.0 38.0 32.4 38.0 100-104 35.551700000000004 38.0 37.0 38.0 30.2 38.0 105-109 35.4499 38.0 37.0 38.0 29.8 38.0 110-114 35.2461 38.0 36.4 38.0 28.8 38.0 115-119 35.035700000000006 38.0 36.0 38.0 28.2 38.0 120-124 34.81915 38.0 35.8 38.0 27.2 38.0 125-129 34.4447 38.0 34.8 38.0 25.8 38.0 130-134 33.81545 38.0 33.0 38.0 22.2 38.0 135-139 33.3289 38.0 33.0 38.0 20.4 38.0 140-144 32.77815 38.0 33.0 38.0 16.4 38.0 145-149 31.506400000000003 38.0 31.2 38.0 8.4 38.0 150-151 26.38425 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 2.0 5 3.0 6 2.0 7 1.0 8 3.0 9 1.0 10 0.0 11 1.0 12 3.0 13 3.0 14 4.0 15 3.0 16 3.0 17 11.0 18 6.0 19 7.0 20 9.0 21 6.0 22 12.0 23 19.0 24 8.0 25 25.0 26 23.0 27 37.0 28 40.0 29 46.0 30 62.0 31 74.0 32 93.0 33 144.0 34 174.0 35 345.0 36 775.0 37 2044.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.525 16.575 13.275 27.625 2 23.575 22.475 35.825 18.125 3 19.5 25.45 33.75 21.3 4 23.0 35.35 22.45 19.2 5 21.275 39.1 22.35 17.275 6 17.36736736736737 38.63863863863864 23.34834834834835 20.645645645645647 7 16.45822911455728 16.933466733366682 45.147573786893446 21.46073036518259 8 20.485242621310658 22.861430715357677 27.48874437218609 29.164582291145575 9 20.96048024012006 23.78689344672336 28.88944472236118 26.3631815907954 10-14 22.3884330598359 28.767260356213733 26.91614968981389 21.92815689413648 15-19 22.846854056216863 27.89336801040312 27.82334700410123 21.43643092927878 20-24 22.443977591036415 27.501000400160063 28.701480592236894 21.353541416566628 25-29 22.226113056528263 28.704352176088044 27.838919459729865 21.230615307653828 30-34 22.586293146573286 27.66383191595798 28.25912956478239 21.490745372686344 35-39 22.42008904006803 28.19268670901906 27.897553899254664 21.489670351658248 40-44 22.796656823982783 27.386016715880086 28.18677743856664 21.63054902157049 45-49 22.911455727863935 27.603801900950476 27.843921960980488 21.6408204102051 50-54 22.337285507028863 27.825303917154436 28.575716644154287 21.261693931662414 55-59 22.764797118126783 28.2883874518437 27.58292890378746 21.363886526242055 60-64 22.64585209646753 27.974582207545286 28.334834384068845 21.044731311918344 65-69 22.91187356206862 27.663298989696912 27.643292987896366 21.7815344603381 70-74 22.956887066119837 27.95838751625488 27.953386015804742 21.131339401820544 75-79 22.725226351858336 28.34775649042069 27.88754939722875 21.039467760492222 80-84 22.94303006052118 27.629670384634625 27.799729905466915 21.627569649377282 85-89 23.119247699079633 28.45138055222089 27.526010404161667 20.903361344537817 90-94 23.23313159605862 27.914770169559343 27.699694893212623 21.15240334116941 95-99 23.154261704681872 28.091236494597837 28.146258503401363 20.60824329731893 100-104 23.214285714285715 28.186274509803923 27.74609843937575 20.853341336534616 105-109 23.585047290196666 27.64349697242656 27.733573537506878 21.03788219986989 110-114 23.852889667250437 27.860895671753816 28.19614711033275 20.090067550662997 115-119 23.07769273100205 27.920356195907747 28.39561758967432 20.606333483415877 120-124 23.62035322959924 28.053234602491617 27.783058988342425 20.54335317956672 125-129 23.562672004003 27.545659244433324 28.19614711033275 20.695521641230926 130-134 23.3201581027668 27.587932155901335 28.533546805423526 20.558362935908338 135-139 23.52234622891747 28.021620539512536 27.746359041089036 20.709674190480957 140-144 24.425531914893618 28.05006257822278 27.47434292866083 20.05006257822278 145-149 24.186046511627907 27.786946736684172 27.806951737934483 20.220055013753438 150-151 24.390548818602326 27.15339417427178 27.903487935992 20.55256907113389 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 3.5 22 3.0 23 2.0 24 2.0 25 3.0 26 5.0 27 8.0 28 12.0 29 14.5 30 20.5 31 22.5 32 30.0 33 36.5 34 40.0 35 56.0 36 69.5 37 107.0 38 143.5 39 159.5 40 184.5 41 204.0 42 233.5 43 273.5 44 298.5 45 300.0 46 283.5 47 247.5 48 206.5 49 199.0 50 183.0 51 136.5 52 113.0 53 92.0 54 73.0 55 64.5 56 50.0 57 37.0 58 23.5 59 16.0 60 12.0 61 8.5 62 7.5 63 6.0 64 3.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.05 8 0.05 9 0.05 10-14 0.06 15-19 0.03 20-24 0.04 25-29 0.05 30-34 0.05 35-39 0.045 40-44 0.095 45-49 0.05 50-54 0.055 55-59 0.065 60-64 0.06999999999999999 65-69 0.03 70-74 0.03 75-79 0.045 80-84 0.034999999999999996 85-89 0.04 90-94 0.034999999999999996 95-99 0.04 100-104 0.04 105-109 0.08499999999999999 110-114 0.075 115-119 0.055 120-124 0.065 125-129 0.075 130-134 0.065 135-139 0.095 140-144 0.125 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11504424778761 98.0 2 0.7079646017699115 1.4000000000000001 3 0.12642225031605564 0.375 4 0.025284450063211124 0.1 5 0.025284450063211124 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.4125 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.2125 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 2.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGTTT 10 0.006830828 145.0 9 GTCTCAA 10 0.006830828 145.0 4 >>END_MODULE Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra Read 801277 spots for SRR7170658.sra Written 801277 spots for SRR7170658.sra Read 801262 spots for SRR7170658.sra Written 801262 spots for SRR7170658.sra SRR ids: ['SRR7170658.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ztgzweqc SRR7170658.sra spots: 16025255 blocks: [[1, 801262], [801263, 1602524], [1602525, 2403786], [2403787, 3205048], [3205049, 4006310], [4006311, 4807572], [4807573, 5608834], [5608835, 6410096], [6410097, 7211358], [7211359, 8012620], [8012621, 8813882], [8813883, 9615144], [9615145, 10416406], [10416407, 11217668], [11217669, 12018930], [12018931, 12820192], [12820193, 13621454], [13621455, 14422716], [14422717, 15223978], [15223979, 16025255]] SRR7170658 file size 5408732 SRR7170658 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170658 SRR7170658_1.fastq SRR7170658_2.fastq Input file: SRR7170658_1.fastq Paired file: SRR7170658_2.fastq trimmed: SRR7170658-trimmed-pair1.fastq, SRR7170658-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:40:37 2025 >> started Thu Feb 13 14:41:04 2025 >> done (27.308s) 16025255 read pairs processed; of these: 20288 ( 0.13%) short read pairs filtered out after trimming by size control 19208 ( 0.12%) empty read pairs filtered out after trimming by size control 15985759 (99.75%) read pairs available; of these: 8557577 (53.53%) trimmed read pairs available after processing 7428182 (46.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 6 0.00% 20 6 0.00% 21 5 0.00% 22 6 0.00% 23 7 0.00% 24 5 0.00% 25 5 0.00% 26 9 0.00% 27 1 0.00% 28 12 0.00% 29 6 0.00% 30 7 0.00% 31 9 0.00% 32 6 0.00% 33 10 0.00% 34 14 0.00% 35 8 0.00% 36 17 0.00% 37 15 0.00% 38 13 0.00% 39 12 0.00% 40 23 0.00% 41 17 0.00% 42 22 0.00% 43 34 0.00% 44 16 0.00% 45 35 0.00% 46 22 0.00% 47 36 0.00% 48 46 0.00% 49 41 0.00% 50 53 0.00% 51 64 0.00% 52 73 0.00% 53 62 0.00% 54 85 0.00% 55 90 0.00% 56 76 0.00% 57 102 0.00% 58 101 0.00% 59 136 0.00% 60 137 0.00% 61 163 0.00% 62 174 0.00% 63 206 0.00% 64 260 0.00% 65 273 0.00% 66 327 0.00% 67 311 0.00% 68 345 0.00% 69 402 0.00% 70 445 0.00% 71 499 0.00% 72 567 0.00% 73 655 0.00% 74 761 0.00% 75 862 0.01% 76 1012 0.01% 77 1155 0.01% 78 1115 0.01% 79 1264 0.01% 80 1410 0.01% 81 1618 0.01% 82 1831 0.01% 83 2092 0.01% 84 3111 0.02% 85 3742 0.02% 86 4008 0.03% 87 4102 0.03% 88 4210 0.03% 89 4597 0.03% 90 4860 0.03% 91 4876 0.03% 92 5467 0.03% 93 5838 0.04% 94 6226 0.04% 95 6404 0.04% 96 6849 0.04% 97 7013 0.04% 98 7383 0.05% 99 7692 0.05% 100 8097 0.05% 101 8702 0.05% 102 9328 0.06% 103 9715 0.06% 104 10232 0.06% 105 10957 0.07% 106 11131 0.07% 107 11919 0.07% 108 12145 0.08% 109 12428 0.08% 110 13204 0.08% 111 13821 0.09% 112 14642 0.09% 113 15500 0.10% 114 16337 0.10% 115 16846 0.11% 116 17436 0.11% 117 18212 0.11% 118 18910 0.12% 119 19553 0.12% 120 20571 0.13% 121 21931 0.14% 122 23000 0.14% 123 24881 0.16% 124 26074 0.16% 125 27641 0.17% 126 29041 0.18% 127 30974 0.19% 128 32776 0.21% 129 33920 0.21% 130 36403 0.23% 131 38511 0.24% 132 41289 0.26% 133 44466 0.28% 134 48501 0.30% 135 53114 0.33% 136 57863 0.36% 137 63667 0.40% 138 70655 0.44% 139 79697 0.50% 140 89168 0.56% 141 102564 0.64% 142 117554 0.74% 143 138597 0.87% 144 164298 1.03% 145 203987 1.28% 146 258043 1.61% 147 357850 2.24% 148 550124 3.44% 149 1073588 6.72% 150 4322128 27.04% 151 7428182 46.47% 15985759 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=12 prefix-density=0.67 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=22.04 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.6 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGACGGTGTATTGGGTAGTTCCACCAAG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=18 prefix-density=0.89 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=138.63 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.2 sequence=TCTTCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7170658 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:42:00 Started mapping on | Feb 13 14:42:00 Finished on | Feb 13 14:44:03 Mapping speed, Million of reads per hour | 467.88 Number of input reads | 15985759 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15095315 Uniquely mapped reads % | 94.43% Average mapped length | 295.09 Number of splices: Total | 15255823 Number of splices: Annotated (sjdb) | 14957347 Number of splices: GT/AG | 14960680 Number of splices: GC/AG | 248887 Number of splices: AT/AC | 8255 Number of splices: Non-canonical | 38001 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406830 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 36291 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 502877 502877 502877 N_multimapping 406830 406830 406830 N_noFeature 505110 14898971 587514 N_ambiguous 215063 888 100682 UnstrandedReadsAssigned:14375142 PositiveStrandReadsAssigned:195456 NegativeStrandReadsAssigned:14407119 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170658 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170658-trimmed-pair1.fastq SRR7170658-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,985,759 reads, 14,367,538 reads pseudoaligned [quant] estimated average fragment length: 295.175 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7170658.ke.tsv 34699 SRR7170658.se.tsv 87100 total ==> SRR7170658.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1723.82 401 16.8659 Potri.005G024800.1.v4.1 1035 740.825 157 15.3653 Potri.004G059700.1.v4.1 961 666.94 15 1.63066 Potri.007G009000.2.v4.1 1416 1121.82 1 0.0646298 Potri.003G141000.2.v4.1 2943 2648.82 759.382 20.7857 Potri.016G087400.1.v4.1 270 68.5364 538.702 569.882 Potri.015G069301.1.v4.1 564 282.884 0 0 Potri.010G195200.1.v4.1 1773 1478.82 9 0.441249 Potri.012G127500.1.v4.1 977 682.892 234 24.844 ==> SRR7170658.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 953 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 46 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 3 SRR7170658 completed mapping pipeline successfully