Starting /dee2/code/volunteer_pipeline.sh SRR7170659 current disk space = 3089312452608 free memory = 1582069432 SRR7170659 SRAfilesize 8fffccd88b511fd4528406c1dcffd9e9 SRR7170659.sra SRR7170659.sra file validated SRR7170659 is paired end SRR7170659 is conventional basespace SRR7170659 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170659_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.12525 18.0 18.0 27.0 18.0 32.0 2 24.854 27.0 18.0 29.0 18.0 31.0 3 24.28625 25.0 18.0 29.0 18.0 31.0 4 28.12175 29.0 27.0 31.0 25.0 33.0 5 29.73175 32.0 30.0 33.0 25.0 33.0 6 35.24875 37.0 35.0 38.0 29.0 38.0 7 36.37075 38.0 37.0 38.0 34.0 38.0 8 36.60175 38.0 37.0 38.0 34.0 38.0 9 36.973 38.0 38.0 38.0 35.0 38.0 10-14 37.0696 38.0 38.0 38.0 36.0 38.0 15-19 37.102500000000006 38.0 38.0 38.0 36.0 38.0 20-24 37.11155 38.0 38.0 38.0 36.2 38.0 25-29 37.145849999999996 38.0 38.0 38.0 36.6 38.0 30-34 37.15645 38.0 38.0 38.0 36.8 38.0 35-39 37.186099999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.12044999999999 38.0 38.0 38.0 36.2 38.0 45-49 36.991949999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.8695 38.0 38.0 38.0 35.4 38.0 55-59 36.836349999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.737199999999994 38.0 38.0 38.0 34.8 38.0 65-69 36.694700000000005 38.0 38.0 38.0 34.6 38.0 70-74 36.592 38.0 38.0 38.0 34.2 38.0 75-79 36.458200000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.258950000000006 38.0 37.4 38.0 33.6 38.0 85-89 36.22435 38.0 37.4 38.0 33.6 38.0 90-94 35.9126 38.0 37.0 38.0 32.0 38.0 95-99 35.87714999999999 38.0 37.0 38.0 32.0 38.0 100-104 35.655150000000006 38.0 36.8 38.0 30.4 38.0 105-109 35.4879 38.0 36.0 38.0 29.4 38.0 110-114 35.39755 38.0 36.0 38.0 29.4 38.0 115-119 35.20395 38.0 36.0 38.0 28.8 38.0 120-124 34.82719999999999 38.0 35.2 38.0 27.4 38.0 125-129 34.3271 38.0 34.6 38.0 24.4 38.0 130-134 34.161649999999995 38.0 34.2 38.0 23.8 38.0 135-139 33.364999999999995 38.0 32.8 38.0 19.4 38.0 140-144 32.637649999999994 37.8 32.2 38.0 16.4 38.0 145-149 31.544900000000002 37.6 31.2 38.0 10.4 38.0 150-151 25.303874999999998 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 2.0 15 3.0 16 2.0 17 4.0 18 4.0 19 3.0 20 6.0 21 6.0 22 7.0 23 8.0 24 16.0 25 21.0 26 22.0 27 21.0 28 33.0 29 68.0 30 76.0 31 92.0 32 116.0 33 178.0 34 268.0 35 523.0 36 1228.0 37 1283.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.04070066975786 24.781040700669756 9.402369912416281 34.77588871715611 2 21.4 25.924999999999997 36.65 16.025 3 21.325 28.475 28.000000000000004 22.2 4 21.425 34.0 22.125 22.45 5 22.275 34.575 24.25 18.9 6 16.05 35.875 25.650000000000002 22.425 7 11.875 20.424999999999997 45.6 22.1 8 19.075 20.549999999999997 28.849999999999998 31.525 9 18.224999999999998 19.625 29.275000000000002 32.875 10-14 19.29 29.93 26.305 24.474999999999998 15-19 19.615 28.465 27.52 24.4 20-24 19.74 28.765 27.265 24.23 25-29 19.605 28.655 27.72 24.02 30-34 19.505 29.154999999999998 27.105 24.235 35-39 19.965 28.725 27.865000000000002 23.445 40-44 19.869999999999997 28.925 27.55 23.655 45-49 20.385 28.845 27.474999999999998 23.294999999999998 50-54 20.349999999999998 28.249999999999996 27.889999999999997 23.51 55-59 19.455 28.645 28.134999999999998 23.765 60-64 20.4 28.43 27.305 23.865 65-69 19.86 29.145 27.775 23.22 70-74 19.735 28.955 27.68 23.630000000000003 75-79 19.85 28.4 28.04 23.71 80-84 20.155 28.035 27.985 23.825 85-89 20.095 28.249999999999996 28.04 23.615 90-94 19.955000000000002 28.355000000000004 27.825 23.865 95-99 20.455000000000002 28.33 28.115000000000002 23.1 100-104 20.435 28.895 27.255000000000003 23.415 105-109 20.974999999999998 28.15 27.395000000000003 23.48 110-114 20.48 28.27 28.505000000000003 22.745 115-119 20.26 28.439999999999998 27.445000000000004 23.855 120-124 19.85 28.68 27.67 23.799999999999997 125-129 20.855 28.275 27.589999999999996 23.28 130-134 20.669999999999998 28.634999999999998 27.27 23.425 135-139 20.46 29.17 27.065 23.305 140-144 20.544999999999998 28.22 27.82 23.415 145-149 20.745 28.749999999999996 27.255000000000003 23.25 150-151 20.45 27.725 27.6375 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 3.0 24 3.5 25 4.5 26 6.0 27 7.5 28 12.0 29 16.5 30 24.0 31 30.5 32 38.0 33 52.5 34 62.5 35 74.0 36 97.0 37 118.5 38 132.5 39 144.5 40 170.5 41 216.0 42 257.0 43 271.5 44 265.0 45 251.0 46 252.5 47 254.5 48 236.5 49 206.0 50 170.5 51 152.0 52 127.5 53 88.5 54 63.0 55 51.5 56 37.0 57 25.0 58 23.0 59 17.0 60 10.0 61 7.5 62 5.5 63 3.5 64 3.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4249999999999998 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.5374999999999996 0.0 0.0 0.0 0.0 134-135 2.9125 0.0 0.0 0.0 0.0 136-137 3.1625 0.0 0.0 0.0 0.0 138-139 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170659 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170659_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.30975 33.0 33.0 34.0 31.0 34.0 2 32.39625 33.0 33.0 34.0 31.0 34.0 3 32.44 33.0 33.0 34.0 31.0 34.0 4 32.297 33.0 33.0 34.0 31.0 34.0 5 32.3535 33.0 33.0 34.0 31.0 34.0 6 36.528 38.0 38.0 38.0 34.0 38.0 7 36.6265 38.0 38.0 38.0 35.0 38.0 8 36.496 38.0 38.0 38.0 34.0 38.0 9 36.56575 38.0 38.0 38.0 34.0 38.0 10-14 36.4926 38.0 38.0 38.0 34.0 38.0 15-19 36.379749999999994 38.0 38.0 38.0 34.0 38.0 20-24 36.3541 38.0 38.0 38.0 34.0 38.0 25-29 36.4184 38.0 38.0 38.0 34.0 38.0 30-34 36.3579 38.0 38.0 38.0 34.0 38.0 35-39 36.2622 38.0 38.0 38.0 33.6 38.0 40-44 36.2719 38.0 38.0 38.0 33.6 38.0 45-49 36.1349 38.0 37.8 38.0 32.8 38.0 50-54 36.15605 38.0 38.0 38.0 33.2 38.0 55-59 36.107800000000005 38.0 38.0 38.0 33.0 38.0 60-64 35.983450000000005 38.0 37.6 38.0 32.2 38.0 65-69 35.9501 38.0 37.2 38.0 32.2 38.0 70-74 35.87755 38.0 37.4 38.0 31.4 38.0 75-79 35.7649 38.0 37.0 38.0 31.0 38.0 80-84 35.6375 38.0 37.0 38.0 30.6 38.0 85-89 35.570499999999996 38.0 37.0 38.0 30.2 38.0 90-94 35.31265 38.0 36.6 38.0 29.0 38.0 95-99 35.2473 38.0 36.2 38.0 29.0 38.0 100-104 34.91055 38.0 36.0 38.0 26.8 38.0 105-109 34.76025 38.0 36.0 38.0 26.8 38.0 110-114 34.591300000000004 38.0 35.4 38.0 25.4 38.0 115-119 34.2162 38.0 34.8 38.0 23.2 38.0 120-124 33.8668 38.0 34.2 38.0 21.0 38.0 125-129 33.3873 38.0 33.0 38.0 17.4 38.0 130-134 32.99855 38.0 33.0 38.0 15.0 38.0 135-139 32.1554 38.0 31.4 38.0 13.8 38.0 140-144 31.1038 37.0 29.4 38.0 12.4 38.0 145-149 29.83125 36.0 28.0 38.0 2.0 38.0 150-151 24.241750000000003 32.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 2.0 5 0.0 6 2.0 7 2.0 8 3.0 9 2.0 10 1.0 11 1.0 12 2.0 13 5.0 14 5.0 15 4.0 16 11.0 17 6.0 18 12.0 19 7.0 20 20.0 21 15.0 22 22.0 23 24.0 24 23.0 25 36.0 26 52.0 27 45.0 28 48.0 29 70.0 30 84.0 31 102.0 32 123.0 33 163.0 34 236.0 35 338.0 36 860.0 37 1658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.3 16.400000000000002 13.325000000000001 31.974999999999998 2 22.925 24.3 36.0 16.775000000000002 3 18.65 27.175 32.525 21.65 4 22.75 35.35 22.650000000000002 19.25 5 20.349999999999998 38.65 22.625 18.375 6 16.400000000000002 38.15 25.474999999999998 19.975 7 16.775000000000002 16.425 45.824999999999996 20.974999999999998 8 20.1 22.075 28.15 29.675 9 21.3 23.05 28.575 27.075 10-14 22.515 28.715000000000003 27.025 21.745 15-19 22.32 28.4 28.035 21.245 20-24 22.945 29.14 27.6 20.315 25-29 22.645 28.21 27.93 21.215 30-34 22.33 27.915 28.865000000000002 20.89 35-39 22.6 28.22 27.975 21.205 40-44 22.965 27.944999999999997 28.285 20.805 45-49 23.080000000000002 27.534999999999997 28.449999999999996 20.935000000000002 50-54 22.55 27.79 28.57 21.09 55-59 22.735 28.04 27.82 21.404999999999998 60-64 22.81 27.944999999999997 28.165000000000003 21.08 65-69 22.93 27.825 28.475 20.77 70-74 22.805 27.839999999999996 28.185 21.17 75-79 22.384999999999998 27.689999999999998 28.895 21.029999999999998 80-84 22.525000000000002 27.725 27.894999999999996 21.855 85-89 23.25 27.425 28.29 21.035 90-94 22.71 27.92 28.299999999999997 21.07 95-99 23.095 27.97 27.855 21.08 100-104 23.095 28.005000000000003 28.24 20.66 105-109 23.29 27.694999999999997 27.99 21.025 110-114 23.810000000000002 28.110000000000003 27.915 20.165 115-119 23.34 27.815 28.22 20.625 120-124 23.305 27.894999999999996 28.155 20.645 125-129 23.799999999999997 27.584999999999997 28.215 20.4 130-134 23.419999999999998 28.025 27.944999999999997 20.61 135-139 23.64 27.395000000000003 28.225 20.74 140-144 23.49 27.725 28.15 20.635 145-149 23.674999999999997 27.76 27.805000000000003 20.76 150-151 23.962500000000002 26.724999999999998 29.037499999999998 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 1.5 21 1.5 22 0.5 23 0.5 24 3.5 25 5.5 26 5.0 27 8.0 28 12.0 29 14.5 30 15.0 31 17.5 32 27.0 33 42.0 34 55.0 35 74.5 36 102.5 37 124.0 38 153.5 39 173.5 40 197.5 41 222.0 42 233.0 43 258.5 44 271.5 45 265.5 46 253.0 47 238.5 48 213.0 49 189.0 50 175.0 51 138.0 52 104.0 53 91.0 54 73.5 55 63.0 56 54.0 57 37.0 58 29.5 59 22.5 60 9.0 61 5.5 62 6.0 63 3.5 64 2.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78265280243468 97.375 2 1.0398173979203653 2.0500000000000003 3 0.12680699974638598 0.375 4 0.050722799898554397 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.1125 0.0 0.0 0.0 0.0 130-131 2.3499999999999996 0.0 0.0 0.0 0.0 132-133 2.6 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.2375 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 30 0.0014437955 24.166668 70-74 >>END_MODULE Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874392 spots for SRR7170659.sra Written 874392 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra Read 874378 spots for SRR7170659.sra Written 874378 spots for SRR7170659.sra SRR ids: ['SRR7170659.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g48cy39u SRR7170659.sra spots: 17487574 blocks: [[1, 874378], [874379, 1748756], [1748757, 2623134], [2623135, 3497512], [3497513, 4371890], [4371891, 5246268], [5246269, 6120646], [6120647, 6995024], [6995025, 7869402], [7869403, 8743780], [8743781, 9618158], [9618159, 10492536], [10492537, 11366914], [11366915, 12241292], [12241293, 13115670], [13115671, 13990048], [13990049, 14864426], [14864427, 15738804], [15738805, 16613182], [16613183, 17487574]] SRR7170659 file size 5904264 SRR7170659 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170659 SRR7170659_1.fastq SRR7170659_2.fastq Input file: SRR7170659_1.fastq Paired file: SRR7170659_2.fastq trimmed: SRR7170659-trimmed-pair1.fastq, SRR7170659-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:02:37 2025 >> started Thu Feb 13 15:02:56 2025 >> done (19.093s) 17487574 read pairs processed; of these: 21449 ( 0.12%) short read pairs filtered out after trimming by size control 26776 ( 0.15%) empty read pairs filtered out after trimming by size control 17439349 (99.72%) read pairs available; of these: 11070443 (63.48%) trimmed read pairs available after processing 6368906 (36.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 4 0.00% 21 1 0.00% 22 8 0.00% 23 9 0.00% 24 3 0.00% 25 7 0.00% 26 7 0.00% 27 9 0.00% 28 9 0.00% 29 6 0.00% 30 12 0.00% 31 12 0.00% 32 11 0.00% 33 15 0.00% 34 15 0.00% 35 16 0.00% 36 13 0.00% 37 20 0.00% 38 20 0.00% 39 25 0.00% 40 33 0.00% 41 33 0.00% 42 41 0.00% 43 42 0.00% 44 40 0.00% 45 47 0.00% 46 52 0.00% 47 70 0.00% 48 70 0.00% 49 79 0.00% 50 85 0.00% 51 108 0.00% 52 96 0.00% 53 135 0.00% 54 138 0.00% 55 145 0.00% 56 136 0.00% 57 191 0.00% 58 184 0.00% 59 242 0.00% 60 243 0.00% 61 302 0.00% 62 318 0.00% 63 364 0.00% 64 422 0.00% 65 436 0.00% 66 480 0.00% 67 522 0.00% 68 572 0.00% 69 676 0.00% 70 735 0.00% 71 887 0.01% 72 981 0.01% 73 1107 0.01% 74 1234 0.01% 75 1346 0.01% 76 1555 0.01% 77 1574 0.01% 78 1826 0.01% 79 2102 0.01% 80 2123 0.01% 81 2527 0.01% 82 2926 0.02% 83 3446 0.02% 84 4444 0.03% 85 4947 0.03% 86 5109 0.03% 87 5433 0.03% 88 5805 0.03% 89 6001 0.03% 90 6480 0.04% 91 6961 0.04% 92 7410 0.04% 93 7941 0.05% 94 8724 0.05% 95 8971 0.05% 96 9421 0.05% 97 9916 0.06% 98 10472 0.06% 99 10935 0.06% 100 11249 0.06% 101 12197 0.07% 102 12935 0.07% 103 13856 0.08% 104 14557 0.08% 105 14868 0.09% 106 15831 0.09% 107 16415 0.09% 108 17168 0.10% 109 17678 0.10% 110 18263 0.10% 111 19546 0.11% 112 20327 0.12% 113 21655 0.12% 114 22673 0.13% 115 23746 0.14% 116 25053 0.14% 117 26089 0.15% 118 27373 0.16% 119 28572 0.16% 120 29686 0.17% 121 31421 0.18% 122 33511 0.19% 123 36510 0.21% 124 38295 0.22% 125 40896 0.23% 126 43641 0.25% 127 46269 0.27% 128 49357 0.28% 129 52708 0.30% 130 56638 0.32% 131 61182 0.35% 132 66848 0.38% 133 73033 0.42% 134 79832 0.46% 135 88333 0.51% 136 98743 0.57% 137 109015 0.63% 138 120900 0.69% 139 135002 0.77% 140 152297 0.87% 141 171324 0.98% 142 194396 1.11% 143 227508 1.30% 144 267016 1.53% 145 317324 1.82% 146 405592 2.33% 147 531178 3.05% 148 802035 4.60% 149 1476745 8.47% 150 4703281 26.97% 151 6368906 36.52% 17439349 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=15 prefix-density=0.78 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=37.50 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.9 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=13 prefix-density=0.89 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=84.75 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.8 sequence=AAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170659 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:03:42 Started mapping on | Feb 13 15:03:42 Finished on | Feb 13 15:05:27 Mapping speed, Million of reads per hour | 597.92 Number of input reads | 17439349 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16448849 Uniquely mapped reads % | 94.32% Average mapped length | 292.93 Number of splices: Total | 16308227 Number of splices: Annotated (sjdb) | 15974242 Number of splices: GT/AG | 15996376 Number of splices: GC/AG | 263034 Number of splices: AT/AC | 8398 Number of splices: Non-canonical | 40419 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421138 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 21550 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 590086 590086 590086 N_multimapping 421138 421138 421138 N_noFeature 610884 16228029 695120 N_ambiguous 249298 1052 112075 UnstrandedReadsAssigned:15588667 PositiveStrandReadsAssigned:219768 NegativeStrandReadsAssigned:15641654 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170659 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170659-trimmed-pair1.fastq SRR7170659-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,439,349 reads, 15,593,023 reads pseudoaligned [quant] estimated average fragment length: 277.831 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR7170659.ke.tsv 34699 SRR7170659.se.tsv 87100 total ==> SRR7170659.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.17 514 19.0938 Potri.005G024800.1.v4.1 1035 758.169 51 4.35086 Potri.004G059700.1.v4.1 961 684.194 14 1.32349 Potri.007G009000.2.v4.1 1416 1139.17 0 0 Potri.003G141000.2.v4.1 2943 2666.17 814.437 19.7579 Potri.016G087400.1.v4.1 270 71.4843 690 624.322 Potri.015G069301.1.v4.1 564 295.134 0 0 Potri.010G195200.1.v4.1 1773 1496.17 13 0.561996 Potri.012G127500.1.v4.1 977 700.188 165 15.2419 ==> SRR7170659.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 836 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7170659 completed mapping pipeline successfully