Starting /dee2/code/volunteer_pipeline.sh SRR7170660 current disk space = 3089252708352 free memory = 1582056328 SRR7170660 SRAfilesize 641154e7ae02ead021f190dc6f7bcb3a SRR7170660.sra SRR7170660.sra file validated SRR7170660 is paired end SRR7170660 is conventional basespace SRR7170660 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170660_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.82475 18.0 18.0 27.0 18.0 32.0 2 25.54225 27.0 25.0 29.0 18.0 31.0 3 25.4505 27.0 18.0 29.0 18.0 31.0 4 29.60825 32.0 27.0 32.0 25.0 33.0 5 30.65075 32.0 31.0 33.0 27.0 33.0 6 35.9155 37.0 36.0 38.0 33.0 38.0 7 36.83275 38.0 37.0 38.0 35.0 38.0 8 36.88825 38.0 38.0 38.0 35.0 38.0 9 37.073 38.0 38.0 38.0 35.0 38.0 10-14 37.234249999999996 38.0 38.0 38.0 36.2 38.0 15-19 37.282199999999996 38.0 38.0 38.0 36.4 38.0 20-24 37.482150000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.5232 38.0 38.0 38.0 38.0 38.0 30-34 37.4881 38.0 38.0 38.0 37.2 38.0 35-39 37.437400000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.4035 38.0 38.0 38.0 37.0 38.0 45-49 37.384 38.0 38.0 38.0 37.0 38.0 50-54 37.30795 38.0 38.0 38.0 37.0 38.0 55-59 37.1554 38.0 38.0 38.0 36.0 38.0 60-64 37.12815 38.0 38.0 38.0 36.0 38.0 65-69 37.0291 38.0 38.0 38.0 35.8 38.0 70-74 36.96169999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.951 38.0 38.0 38.0 35.6 38.0 80-84 36.83855 38.0 38.0 38.0 35.0 38.0 85-89 36.753 38.0 38.0 38.0 34.4 38.0 90-94 36.663700000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.488 38.0 38.0 38.0 34.0 38.0 100-104 36.277950000000004 38.0 37.2 38.0 33.8 38.0 105-109 36.04075 38.0 37.0 38.0 32.6 38.0 110-114 35.96765 38.0 37.0 38.0 32.6 38.0 115-119 35.61475 38.0 36.2 38.0 30.6 38.0 120-124 35.50695 38.0 36.0 38.0 30.2 38.0 125-129 35.43035 38.0 36.0 38.0 30.2 38.0 130-134 35.181050000000006 38.0 35.6 38.0 28.6 38.0 135-139 34.6608 38.0 34.6 38.0 27.4 38.0 140-144 33.7719 38.0 33.8 38.0 22.2 38.0 145-149 33.299549999999996 38.0 33.0 38.0 20.8 38.0 150-151 28.685499999999998 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 5.0 18 1.0 19 3.0 20 4.0 21 0.0 22 6.0 23 4.0 24 9.0 25 9.0 26 12.0 27 24.0 28 21.0 29 31.0 30 44.0 31 51.0 32 111.0 33 135.0 34 215.0 35 420.0 36 1130.0 37 1762.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.95124428643982 28.08532249873032 9.497206703910614 28.466226510919245 2 22.075 25.25 34.425 18.25 3 18.625 31.275 28.599999999999998 21.5 4 19.725 36.449999999999996 23.625 20.200000000000003 5 20.330082520630157 37.28432108027007 23.48087021755439 18.904726181545385 6 17.525 36.199999999999996 24.0 22.275 7 12.35 19.825 46.6 21.224999999999998 8 18.875 21.8 27.750000000000004 31.574999999999996 9 17.375 22.25 28.95 31.424999999999997 10-14 19.545 29.975 26.0 24.48 15-19 19.564999999999998 28.58 27.67 24.185000000000002 20-24 19.81 28.78 27.905 23.505000000000003 25-29 19.695 29.18 27.525 23.599999999999998 30-34 19.56 28.685 27.42 24.335 35-39 20.07 28.74 27.625 23.565 40-44 19.655 29.604999999999997 27.29 23.45 45-49 20.085 28.610000000000003 27.805000000000003 23.5 50-54 20.195 28.595 27.900000000000002 23.31 55-59 19.900000000000002 28.595 28.185 23.32 60-64 19.59 29.415000000000003 27.43 23.565 65-69 19.57 28.93 27.650000000000002 23.849999999999998 70-74 19.865 28.74 27.67 23.724999999999998 75-79 19.8 28.915000000000003 27.715 23.57 80-84 19.939999999999998 28.665000000000003 27.560000000000002 23.835 85-89 20.36 28.64 27.33 23.669999999999998 90-94 20.445 28.849999999999998 27.325 23.380000000000003 95-99 19.86 28.694999999999997 27.58 23.865 100-104 20.419999999999998 28.105000000000004 27.905 23.57 105-109 20.32 28.689999999999998 27.62 23.369999999999997 110-114 20.02 28.665000000000003 27.560000000000002 23.755000000000003 115-119 20.275000000000002 28.860000000000003 27.55 23.315 120-124 20.365 28.265 27.425 23.945 125-129 20.74 28.854999999999997 26.995 23.41 130-134 20.52 27.925 27.63 23.925 135-139 20.515 28.24 27.534999999999997 23.71 140-144 20.765 27.634999999999998 26.955000000000002 24.645 145-149 20.775 27.815 27.6 23.810000000000002 150-151 20.4125 28.4375 27.800000000000004 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 3.0 25 2.5 26 4.5 27 8.5 28 10.5 29 18.0 30 30.0 31 35.5 32 41.0 33 45.0 34 57.0 35 82.0 36 102.5 37 127.0 38 144.0 39 158.0 40 180.0 41 224.0 42 254.5 43 261.5 44 271.0 45 265.5 46 256.0 47 241.5 48 237.5 49 207.5 50 154.0 51 120.5 52 102.0 53 88.5 54 71.5 55 51.0 56 34.5 57 31.5 58 25.5 59 15.0 60 10.5 61 7.5 62 3.0 63 2.5 64 2.5 65 0.5 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4528301886792453 0.8999999999999999 3 0.05031446540880503 0.15 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.0875 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.4749999999999996 0.0 0.0 0.0 0.0 132-133 2.6625 0.0 0.0 0.0 0.0 134-135 2.9000000000000004 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170660 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170660_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6905 33.0 33.0 34.0 32.0 34.0 2 32.901 33.0 33.0 34.0 32.0 34.0 3 32.8615 34.0 33.0 34.0 32.0 34.0 4 32.748 34.0 33.0 34.0 32.0 34.0 5 32.78325 34.0 33.0 34.0 32.0 34.0 6 36.96025 38.0 38.0 38.0 36.0 38.0 7 37.065 38.0 38.0 38.0 36.0 38.0 8 37.09275 38.0 38.0 38.0 36.0 38.0 9 37.03425 38.0 38.0 38.0 36.0 38.0 10-14 37.0116 38.0 38.0 38.0 36.0 38.0 15-19 37.02475 38.0 38.0 38.0 36.2 38.0 20-24 37.016149999999996 38.0 38.0 38.0 36.4 38.0 25-29 36.905950000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.902300000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.901399999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.902699999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.8349 38.0 38.0 38.0 36.0 38.0 50-54 36.76025 38.0 38.0 38.0 35.4 38.0 55-59 36.72585 38.0 38.0 38.0 35.4 38.0 60-64 36.6653 38.0 38.0 38.0 35.0 38.0 65-69 36.6574 38.0 38.0 38.0 35.0 38.0 70-74 36.586349999999996 38.0 38.0 38.0 34.6 38.0 75-79 36.50405 38.0 38.0 38.0 34.6 38.0 80-84 36.451550000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.43755 38.0 38.0 38.0 34.2 38.0 90-94 36.2547 38.0 38.0 38.0 33.8 38.0 95-99 36.10170000000001 38.0 37.8 38.0 33.6 38.0 100-104 35.94815 38.0 37.0 38.0 32.6 38.0 105-109 35.880050000000004 38.0 37.0 38.0 33.0 38.0 110-114 35.48905 38.0 36.6 38.0 30.2 38.0 115-119 35.3048 38.0 36.0 38.0 29.4 38.0 120-124 35.165299999999995 38.0 36.0 38.0 28.6 38.0 125-129 34.8791 38.0 35.6 38.0 27.8 38.0 130-134 34.18055 38.0 33.8 38.0 24.2 38.0 135-139 33.81015000000001 38.0 33.0 38.0 23.0 38.0 140-144 33.275549999999996 38.0 33.0 38.0 20.4 38.0 145-149 32.10165000000001 38.0 33.0 38.0 11.0 38.0 150-151 26.456875 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 2.0 5 0.0 6 2.0 7 1.0 8 1.0 9 1.0 10 3.0 11 3.0 12 4.0 13 1.0 14 2.0 15 1.0 16 1.0 17 7.0 18 12.0 19 7.0 20 10.0 21 12.0 22 8.0 23 14.0 24 7.0 25 10.0 26 30.0 27 26.0 28 40.0 29 39.0 30 56.0 31 65.0 32 63.0 33 111.0 34 210.0 35 302.0 36 718.0 37 2221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.8 16.7 12.725 26.775 2 24.7 21.9 35.099999999999994 18.3 3 19.775000000000002 26.1 34.150000000000006 19.975 4 22.625 35.325 21.575 20.474999999999998 5 23.05 38.224999999999994 20.75 17.974999999999998 6 17.1 38.925 24.275 19.7 7 15.7 17.675 46.075 20.549999999999997 8 20.3 20.95 27.975 30.775000000000002 9 21.575 23.724999999999998 27.55 27.150000000000002 10-14 22.545 28.599999999999998 27.32 21.535 15-19 23.3 28.08 28.1 20.52 20-24 23.044999999999998 27.905 28.03 21.02 25-29 22.715 28.43 27.689999999999998 21.165 30-34 22.85 27.83 28.305000000000003 21.015 35-39 22.32611630581529 27.931396569828493 28.296414820741038 21.44607230361518 40-44 22.7 28.405 28.1 20.794999999999998 45-49 22.425 28.24 28.294999999999998 21.04 50-54 22.965 27.88 28.13 21.025 55-59 23.724999999999998 27.68 27.74 20.855 60-64 23.055 27.55 28.225 21.17 65-69 22.564999999999998 27.485 28.395 21.555 70-74 23.294999999999998 27.994999999999997 27.839999999999996 20.87 75-79 22.830000000000002 27.650000000000002 28.349999999999998 21.17 80-84 23.18 27.83 28.21 20.78 85-89 22.905 27.33 28.71 21.055 90-94 23.3 28.044999999999998 27.765 20.89 95-99 23.13 27.889999999999997 28.34 20.64 100-104 23.435 27.800000000000004 28.09 20.674999999999997 105-109 22.78 28.000000000000004 28.09 21.13 110-114 23.565 27.61 28.46 20.365 115-119 23.669999999999998 27.750000000000004 27.994999999999997 20.585 120-124 22.915 27.6 28.325 21.16 125-129 23.93 28.025 27.925 20.119999999999997 130-134 23.98 27.74 28.355000000000004 19.925 135-139 23.775 27.685 28.199999999999996 20.34 140-144 23.985 27.224999999999998 28.395 20.395 145-149 24.13 27.034999999999997 28.625 20.21 150-151 23.849999999999998 27.737499999999997 27.487499999999997 20.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 2.5 23 2.5 24 2.5 25 3.0 26 4.0 27 3.5 28 6.5 29 13.0 30 19.0 31 19.5 32 24.0 33 38.5 34 56.5 35 66.5 36 75.0 37 100.5 38 138.0 39 161.0 40 188.5 41 222.0 42 241.5 43 274.5 44 305.0 45 299.5 46 276.5 47 241.5 48 209.5 49 191.0 50 172.0 51 144.0 52 116.5 53 90.5 54 67.5 55 59.0 56 50.5 57 37.5 58 20.0 59 14.5 60 12.5 61 8.5 62 7.0 63 4.0 64 2.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39546599496222 98.65 2 0.5037783375314862 1.0 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.0250000000000004 0.0 0.0 0.0 0.0 136-137 3.3125 0.0 0.0 0.0 0.0 138-139 3.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGAG 10 0.006830828 145.0 145 GCATTAT 10 0.006830828 145.0 145 >>END_MODULE Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664353 spots for SRR7170660.sra Written 664353 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra Read 664340 spots for SRR7170660.sra Written 664340 spots for SRR7170660.sra SRR ids: ['SRR7170660.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8_p7c_2w SRR7170660.sra spots: 13286813 blocks: [[1, 664340], [664341, 1328680], [1328681, 1993020], [1993021, 2657360], [2657361, 3321700], [3321701, 3986040], [3986041, 4650380], [4650381, 5314720], [5314721, 5979060], [5979061, 6643400], [6643401, 7307740], [7307741, 7972080], [7972081, 8636420], [8636421, 9300760], [9300761, 9965100], [9965101, 10629440], [10629441, 11293780], [11293781, 11958120], [11958121, 12622460], [12622461, 13286813]] SRR7170660 file size 4480764 SRR7170660 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170660 SRR7170660_1.fastq SRR7170660_2.fastq Input file: SRR7170660_1.fastq Paired file: SRR7170660_2.fastq trimmed: SRR7170660-trimmed-pair1.fastq, SRR7170660-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:03:21 2025 >> started Thu Feb 13 15:03:37 2025 >> done (16.031s) 13286813 read pairs processed; of these: 14834 ( 0.11%) short read pairs filtered out after trimming by size control 17185 ( 0.13%) empty read pairs filtered out after trimming by size control 13254794 (99.76%) read pairs available; of these: 7194196 (54.28%) trimmed read pairs available after processing 6060598 (45.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 3 0.00% 21 4 0.00% 22 6 0.00% 23 9 0.00% 24 9 0.00% 25 13 0.00% 26 4 0.00% 27 11 0.00% 28 7 0.00% 29 12 0.00% 30 5 0.00% 31 8 0.00% 32 6 0.00% 33 11 0.00% 34 8 0.00% 35 7 0.00% 36 26 0.00% 37 5 0.00% 38 19 0.00% 39 27 0.00% 40 25 0.00% 41 21 0.00% 42 22 0.00% 43 26 0.00% 44 19 0.00% 45 21 0.00% 46 48 0.00% 47 45 0.00% 48 53 0.00% 49 51 0.00% 50 66 0.00% 51 67 0.00% 52 83 0.00% 53 83 0.00% 54 73 0.00% 55 102 0.00% 56 97 0.00% 57 108 0.00% 58 122 0.00% 59 153 0.00% 60 183 0.00% 61 192 0.00% 62 224 0.00% 63 236 0.00% 64 251 0.00% 65 288 0.00% 66 299 0.00% 67 333 0.00% 68 396 0.00% 69 446 0.00% 70 527 0.00% 71 605 0.00% 72 651 0.00% 73 725 0.01% 74 829 0.01% 75 954 0.01% 76 1106 0.01% 77 1194 0.01% 78 1245 0.01% 79 1321 0.01% 80 1439 0.01% 81 1713 0.01% 82 2009 0.02% 83 2289 0.02% 84 3018 0.02% 85 3573 0.03% 86 3731 0.03% 87 3849 0.03% 88 4069 0.03% 89 4413 0.03% 90 4680 0.04% 91 4774 0.04% 92 5336 0.04% 93 5479 0.04% 94 5960 0.04% 95 6238 0.05% 96 6582 0.05% 97 6757 0.05% 98 7113 0.05% 99 7426 0.06% 100 7862 0.06% 101 8306 0.06% 102 8949 0.07% 103 9266 0.07% 104 9835 0.07% 105 10296 0.08% 106 10657 0.08% 107 10818 0.08% 108 11471 0.09% 109 11700 0.09% 110 12219 0.09% 111 13065 0.10% 112 13663 0.10% 113 13975 0.11% 114 14880 0.11% 115 15277 0.12% 116 15939 0.12% 117 16556 0.12% 118 16884 0.13% 119 17559 0.13% 120 18379 0.14% 121 19083 0.14% 122 20104 0.15% 123 21765 0.16% 124 22601 0.17% 125 23907 0.18% 126 24965 0.19% 127 25915 0.20% 128 27175 0.21% 129 28670 0.22% 130 30446 0.23% 131 32433 0.24% 132 34676 0.26% 133 37412 0.28% 134 40768 0.31% 135 43881 0.33% 136 47339 0.36% 137 52608 0.40% 138 57405 0.43% 139 63621 0.48% 140 72116 0.54% 141 81839 0.62% 142 94063 0.71% 143 110183 0.83% 144 133043 1.00% 145 167855 1.27% 146 213611 1.61% 147 296766 2.24% 148 463879 3.50% 149 920790 6.95% 150 3613768 27.26% 151 6060598 45.72% 13254794 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.42 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=13.05 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.4 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAAT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=0.69 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=40.74 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170660 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:04:35 Started mapping on | Feb 13 15:04:35 Finished on | Feb 13 15:05:54 Mapping speed, Million of reads per hour | 604.02 Number of input reads | 13254794 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 11797012 Uniquely mapped reads % | 89.00% Average mapped length | 286.85 Number of splices: Total | 11709030 Number of splices: Annotated (sjdb) | 11458112 Number of splices: GT/AG | 11491652 Number of splices: GC/AG | 174771 Number of splices: AT/AC | 6898 Number of splices: Non-canonical | 35709 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365136 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 28156 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.97% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1105538 1105538 1105538 N_multimapping 365136 365136 365136 N_noFeature 426609 11606023 487403 N_ambiguous 239369 1373 108283 UnstrandedReadsAssigned:11131034 PositiveStrandReadsAssigned:189616 NegativeStrandReadsAssigned:11201326 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=142 echo kmer=137 SRR7170660 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170660-trimmed-pair1.fastq SRR7170660-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,254,794 reads, 11,653,886 reads pseudoaligned [quant] estimated average fragment length: 274.647 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7170660.ke.tsv 34699 SRR7170660.se.tsv 87100 total ==> SRR7170660.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.35 730 33.5006 Potri.005G024800.1.v4.1 1035 761.353 205 21.5542 Potri.004G059700.1.v4.1 961 687.431 4 0.465795 Potri.007G009000.2.v4.1 1416 1142.35 0 0 Potri.003G141000.2.v4.1 2943 2669.35 737 22.1017 Potri.016G087400.1.v4.1 270 75.6587 610.726 646.177 Potri.015G069301.1.v4.1 564 300.352 0 0 Potri.010G195200.1.v4.1 1773 1499.35 250.883 13.3947 Potri.012G127500.1.v4.1 977 703.385 138 15.7054 ==> SRR7170660.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 798 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170660 completed mapping pipeline successfully