Starting /dee2/code/volunteer_pipeline.sh SRR7170661 current disk space = 3089227943936 free memory = 1540895008 SRR7170661 SRAfilesize e4ea73914d3e3988113ae5171ae8a4d7 SRR7170661.sra SRR7170661.sra file validated SRR7170661 is paired end SRR7170661 is conventional basespace SRR7170661 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170661_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.2005 28.0 18.0 32.0 18.0 33.0 2 31.019 31.0 30.0 33.0 27.0 33.0 3 31.8755 33.0 31.0 33.0 29.0 33.0 4 32.34575 33.0 33.0 33.0 31.0 34.0 5 32.96225 33.0 33.0 34.0 32.0 34.0 6 36.9435 38.0 37.0 38.0 35.0 38.0 7 37.1505 38.0 38.0 38.0 36.0 38.0 8 37.29625 38.0 38.0 38.0 36.0 38.0 9 37.37875 38.0 38.0 38.0 37.0 38.0 10-14 37.34585 38.0 38.0 38.0 37.0 38.0 15-19 37.30495 38.0 38.0 38.0 37.0 38.0 20-24 37.39145 38.0 38.0 38.0 37.0 38.0 25-29 37.37265 38.0 38.0 38.0 37.0 38.0 30-34 37.3506 38.0 38.0 38.0 37.0 38.0 35-39 37.305600000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.20075 38.0 38.0 38.0 36.6 38.0 45-49 37.208800000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.056200000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.97045 38.0 38.0 38.0 35.6 38.0 60-64 36.93339999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.796350000000004 38.0 38.0 38.0 35.2 38.0 70-74 36.7115 38.0 38.0 38.0 34.6 38.0 75-79 36.57039999999999 38.0 38.0 38.0 34.2 38.0 80-84 36.638549999999995 38.0 38.0 38.0 34.4 38.0 85-89 36.41180000000001 38.0 38.0 38.0 33.8 38.0 90-94 36.23255 38.0 37.4 38.0 33.4 38.0 95-99 36.13145 38.0 37.0 38.0 33.4 38.0 100-104 35.9283 38.0 37.0 38.0 32.2 38.0 105-109 35.72239999999999 38.0 37.0 38.0 31.2 38.0 110-114 35.68595 38.0 36.8 38.0 30.6 38.0 115-119 35.50345 38.0 36.0 38.0 30.6 38.0 120-124 35.3471 38.0 36.0 38.0 29.8 38.0 125-129 34.8533 38.0 35.4 38.0 27.4 38.0 130-134 34.386750000000006 38.0 34.8 38.0 25.0 38.0 135-139 33.64695 38.0 33.8 38.0 20.6 38.0 140-144 32.97465 38.0 33.0 38.0 16.8 38.0 145-149 32.2117 37.8 32.2 38.0 13.2 38.0 150-151 28.173125 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 5.0 16 0.0 17 2.0 18 8.0 19 1.0 20 4.0 21 7.0 22 10.0 23 6.0 24 17.0 25 22.0 26 18.0 27 31.0 28 34.0 29 34.0 30 56.0 31 71.0 32 100.0 33 125.0 34 198.0 35 382.0 36 914.0 37 1950.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.4380081300813 19.53760162601626 12.47459349593496 26.54979674796748 2 20.275000000000002 24.7 34.5 20.525 3 17.275 32.1 27.975 22.650000000000002 4 20.0 36.4 24.4 19.2 5 18.593593593593592 37.66266266266266 23.14814814814815 20.595595595595594 6 16.85 34.325 24.9 23.925 7 13.850000000000001 20.225 44.35 21.575 8 17.4 21.425 28.199999999999996 32.975 9 16.575 22.575 29.075 31.775 10-14 19.025 29.75 26.21 25.014999999999997 15-19 20.01 28.17 27.43 24.39 20-24 19.36 29.354999999999997 26.91 24.375 25-29 20.39 29.470000000000002 26.145000000000003 23.995 30-34 20.24 28.449999999999996 27.169999999999998 24.14 35-39 20.27 29.060000000000002 26.825 23.845 40-44 19.905 28.865000000000002 27.365000000000002 23.865 45-49 20.41 28.494999999999997 27.084999999999997 24.01 50-54 19.8 28.93 27.1 24.169999999999998 55-59 19.634999999999998 28.925 26.784999999999997 24.654999999999998 60-64 20.630000000000003 28.74 26.840000000000003 23.79 65-69 19.64 28.360000000000003 27.43 24.57 70-74 19.81 28.810000000000002 26.985 24.395 75-79 20.215 29.025000000000002 26.729999999999997 24.03 80-84 20.119999999999997 28.67 26.295 24.915000000000003 85-89 20.630000000000003 27.565 26.955000000000002 24.85 90-94 20.474999999999998 28.01 26.97 24.545 95-99 20.419999999999998 28.610000000000003 26.534999999999997 24.435000000000002 100-104 21.235 28.03 26.729999999999997 24.005000000000003 105-109 21.08 27.975 26.939999999999998 24.005000000000003 110-114 21.035 27.87 26.815 24.279999999999998 115-119 21.349999999999998 27.855 26.669999999999998 24.125 120-124 20.3 28.015 26.69 24.995 125-129 21.17 27.11 26.87 24.85 130-134 21.325 27.975 26.840000000000003 23.86 135-139 21.224999999999998 27.250000000000004 26.495 25.03 140-144 21.099999999999998 27.305 27.08 24.515 145-149 20.375 28.21 26.810000000000002 24.605 150-151 21.3875 26.9625 27.875 23.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 2.5 23 3.5 24 5.0 25 8.0 26 9.0 27 12.5 28 14.5 29 20.5 30 29.0 31 30.0 32 30.5 33 40.0 34 55.0 35 77.0 36 98.0 37 117.5 38 135.0 39 142.5 40 165.0 41 180.5 42 200.0 43 210.5 44 221.5 45 243.5 46 249.5 47 249.0 48 234.0 49 214.0 50 189.5 51 164.0 52 128.5 53 109.0 54 95.5 55 73.0 56 61.0 57 48.5 58 39.0 59 28.5 60 15.5 61 11.0 62 11.5 63 7.5 64 4.0 65 1.5 66 0.5 67 0.5 68 0.5 69 2.0 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 97.9145211122554 95.075 2 1.596292481977343 3.1 3 0.28321318228630277 0.8250000000000001 4 0.15447991761071062 0.6 5 0.0 0.0 6 0.025746652935118432 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025746652935118432 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 10 0.25 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0125 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0125 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.2125 0.0 0.0 0.025 0.0 84-85 0.25 0.0 0.0 0.025 0.0 86-87 0.275 0.0 0.0 0.025 0.0 88-89 0.275 0.0 0.0 0.025 0.0 90-91 0.2875 0.0 0.0 0.025 0.0 92-93 0.38749999999999996 0.0 0.0 0.025 0.0 94-95 0.525 0.0 0.0 0.025 0.0 96-97 0.65 0.0 0.0 0.025 0.0 98-99 0.7749999999999999 0.0 0.0 0.025 0.0 100-101 0.875 0.0 0.0 0.025 0.0 102-103 1.1 0.0 0.0 0.025 0.0 104-105 1.225 0.0 0.0 0.025 0.0 106-107 1.3624999999999998 0.0 0.0 0.025 0.0 108-109 1.4875 0.0 0.0 0.025 0.0 110-111 1.6625 0.0 0.0 0.025 0.0 112-113 1.8125 0.0 0.0 0.025 0.0 114-115 1.875 0.0 0.0 0.025 0.0 116-117 2.075 0.0 0.0 0.025 0.0 118-119 2.225 0.0 0.0 0.025 0.0 120-121 2.475 0.0 0.0 0.025 0.0 122-123 2.725 0.0 0.0 0.025 0.0 124-125 2.9 0.0 0.0 0.025 0.0 126-127 3.2 0.0 0.0 0.025 0.0 128-129 3.5125 0.0 0.0 0.025 0.0 130-131 3.8375 0.0 0.0 0.025 0.0 132-133 4.075 0.0 0.0 0.025 0.0 134-135 4.375 0.0 0.0 0.025 0.0 136-137 4.7125 0.0 0.0 0.025 0.0 138-139 4.925 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170661 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170661_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72025 33.0 33.0 34.0 32.0 34.0 2 32.76175 33.0 33.0 34.0 32.0 34.0 3 32.789 34.0 33.0 34.0 32.0 34.0 4 32.61225 34.0 33.0 34.0 32.0 34.0 5 32.6405 34.0 33.0 34.0 32.0 34.0 6 36.83475 38.0 38.0 38.0 36.0 38.0 7 36.7145 38.0 38.0 38.0 36.0 38.0 8 36.77275 38.0 38.0 38.0 36.0 38.0 9 36.7745 38.0 38.0 38.0 36.0 38.0 10-14 36.8043 38.0 38.0 38.0 36.0 38.0 15-19 36.75834999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.72165 38.0 38.0 38.0 36.0 38.0 25-29 36.665049999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.63185 38.0 38.0 38.0 35.8 38.0 35-39 36.5953 38.0 38.0 38.0 36.0 38.0 40-44 36.602850000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.5364 38.0 38.0 38.0 35.8 38.0 50-54 36.491949999999996 38.0 38.0 38.0 35.6 38.0 55-59 36.36355 38.0 38.0 38.0 35.0 38.0 60-64 36.379099999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.327600000000004 38.0 38.0 38.0 34.8 38.0 70-74 36.31654999999999 38.0 38.0 38.0 34.6 38.0 75-79 36.206649999999996 38.0 38.0 38.0 34.2 38.0 80-84 36.10945 38.0 38.0 38.0 34.0 38.0 85-89 35.944900000000004 38.0 38.0 38.0 33.6 38.0 90-94 35.8464 38.0 38.0 38.0 33.4 38.0 95-99 35.60625 38.0 37.6 38.0 31.6 38.0 100-104 35.419650000000004 38.0 37.0 38.0 30.8 38.0 105-109 35.25695 38.0 37.0 38.0 30.6 38.0 110-114 35.2844 38.0 37.0 38.0 31.0 38.0 115-119 35.040549999999996 38.0 36.6 38.0 29.0 38.0 120-124 34.787400000000005 38.0 36.0 38.0 28.0 38.0 125-129 34.303650000000005 38.0 35.6 38.0 24.6 38.0 130-134 33.8962 38.0 33.6 38.0 22.8 38.0 135-139 33.6974 38.0 33.2 38.0 22.6 38.0 140-144 32.99115 38.0 33.0 38.0 16.4 38.0 145-149 32.037499999999994 38.0 33.0 38.0 10.4 38.0 150-151 26.844125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 4.0 4 5.0 5 3.0 6 6.0 7 4.0 8 2.0 9 4.0 10 4.0 11 6.0 12 8.0 13 3.0 14 6.0 15 4.0 16 8.0 17 13.0 18 9.0 19 8.0 20 6.0 21 12.0 22 4.0 23 9.0 24 13.0 25 13.0 26 17.0 27 21.0 28 22.0 29 37.0 30 59.0 31 56.0 32 85.0 33 135.0 34 149.0 35 264.0 36 678.0 37 2298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.7 17.175 16.3 22.825 2 26.275 22.25 31.275 20.200000000000003 3 19.875 25.724999999999998 33.0 21.4 4 25.324999999999996 34.75 20.175 19.75 5 23.974999999999998 37.85 19.675 18.5 6 18.663997998498875 36.67750813109832 22.76707530647986 21.891418563922944 7 17.838378784088064 16.737553164873656 43.632724543407555 21.79134350763072 8 21.215911933950462 21.591193395046286 27.395546659994995 29.797348011008257 9 21.4160620465349 24.54340755566675 27.220415311483613 26.82011508631474 10-14 23.2424318238679 28.111083312484364 26.52489367025269 22.121591193395044 15-19 23.43022964927203 27.763045979886925 27.222694751588534 21.584029619252515 20-24 23.402020606181857 28.013404021206362 26.662998899669898 21.921576472941883 25-29 23.12656328164082 28.189094547273637 27.163581790895446 21.520760380190097 30-34 23.461422996097266 28.009606724707297 26.783748624036825 21.745221655158613 35-39 24.113084813610207 27.020265198899175 27.235426569927444 21.631223417563174 40-44 23.735174898663864 27.848671370665066 27.143071610869242 21.27308211980183 45-49 23.4714300010007 27.33413389372561 26.993895727008905 22.200540378264787 50-54 23.35817536137648 27.049467313559745 27.469614365027763 22.122742960036014 55-59 23.541479035324727 26.913839687781447 27.299109376563596 22.24557190033023 60-64 23.74543453244609 27.35778255866313 26.922499624756092 21.97428328413469 65-69 24.013602040306044 26.819022853428017 27.07906185927889 22.08831324698705 70-74 23.575 27.855 26.365 22.205 75-79 23.97219165749725 27.848354506351907 26.397919375812744 21.7815344603381 80-84 24.346086521630408 27.806951737934483 26.66166541635409 21.185296324081023 85-89 24.148622293344 27.189078361754266 26.46396959543932 22.19832974946242 90-94 23.935000000000002 27.155 27.255000000000003 21.654999999999998 95-99 24.095 28.225 26.39 21.29 100-104 23.93 27.665 27.125 21.279999999999998 105-109 24.73994798959792 26.895379075815164 27.470494098819763 20.894178835767153 110-114 24.174504702821693 26.756053632179306 27.541524914948965 21.52791675005003 115-119 24.4035412394338 27.669684389536336 26.944430550692744 20.982343820337118 120-124 24.73623681184059 27.386369318465924 26.491324566228315 21.386069303465174 125-129 24.365000000000002 27.500000000000004 27.29 20.845 130-134 25.06251875562669 27.033109932979894 27.34320296088827 20.561168350505152 135-139 25.182627839487644 27.614330031021716 26.908836185329733 20.29420594416091 140-144 25.313985489116835 27.25544158118589 26.91018263697773 20.52039029271954 145-149 25.115 27.555000000000003 27.560000000000002 19.77 150-151 25.4375 27.6375 26.437500000000004 20.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.5 22 4.5 23 4.0 24 3.0 25 3.0 26 4.0 27 7.5 28 8.5 29 8.0 30 10.0 31 15.0 32 20.5 33 25.5 34 34.0 35 43.5 36 59.0 37 76.0 38 104.0 39 136.5 40 150.0 41 173.5 42 193.5 43 216.5 44 256.0 45 270.5 46 260.0 47 256.0 48 250.5 49 230.0 50 207.5 51 163.5 52 136.0 53 128.5 54 117.5 55 107.5 56 80.5 57 61.0 58 49.0 59 37.0 60 28.0 61 15.0 62 12.0 63 10.0 64 4.5 65 3.0 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.075 15-19 0.065 20-24 0.03 25-29 0.05 30-34 0.06999999999999999 35-39 0.075 40-44 0.08499999999999999 45-49 0.06999999999999999 50-54 0.034999999999999996 55-59 0.06999999999999999 60-64 0.065 65-69 0.015 70-74 0.0 75-79 0.03 80-84 0.025 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.06 115-119 0.034999999999999996 120-124 0.005 125-129 0.0 130-134 0.03 135-139 0.06999999999999999 140-144 0.075 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.275 #Duplication Level Percentage of deduplicated Percentage of total 1 97.45520643988574 93.825 2 1.973513373149831 3.8 3 0.23370553103090105 0.675 4 0.15580368735393405 0.6 5 0.10386912490262269 0.5 6 0.051934562451311346 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025967281225655673 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 12 0.3 No Hit AGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCC 6 0.15 No Hit GCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCG 6 0.15 No Hit GTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGG 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit GTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCC 5 0.125 No Hit CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.8125 0.0 0.0 0.0 0.0 132-133 4.05 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.762499999999999 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCAAC 10 0.006830828 145.0 6 AGCCTTA 10 0.006830828 145.0 9 TTTTTTT 35 0.0035366106 20.714287 125-129 >>END_MODULE Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506769 spots for SRR7170661.sra Written 506769 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra Read 506754 spots for SRR7170661.sra Written 506754 spots for SRR7170661.sra SRR ids: ['SRR7170661.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__rumupit SRR7170661.sra spots: 10135095 blocks: [[1, 506754], [506755, 1013508], [1013509, 1520262], [1520263, 2027016], [2027017, 2533770], [2533771, 3040524], [3040525, 3547278], [3547279, 4054032], [4054033, 4560786], [4560787, 5067540], [5067541, 5574294], [5574295, 6081048], [6081049, 6587802], [6587803, 7094556], [7094557, 7601310], [7601311, 8108064], [8108065, 8614818], [8614819, 9121572], [9121573, 9628326], [9628327, 10135095]] SRR7170661 file size 3412750 SRR7170661 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170661 SRR7170661_1.fastq SRR7170661_2.fastq Input file: SRR7170661_1.fastq Paired file: SRR7170661_2.fastq trimmed: SRR7170661-trimmed-pair1.fastq, SRR7170661-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:05:29 2025 >> started Thu Feb 13 15:05:41 2025 >> done (11.837s) 10135095 read pairs processed; of these: 27243 ( 0.27%) short read pairs filtered out after trimming by size control 37156 ( 0.37%) empty read pairs filtered out after trimming by size control 10070696 (99.36%) read pairs available; of these: 5269374 (52.32%) trimmed read pairs available after processing 4801322 (47.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 5 0.00% 20 11 0.00% 21 8 0.00% 22 10 0.00% 23 15 0.00% 24 15 0.00% 25 10 0.00% 26 15 0.00% 27 11 0.00% 28 17 0.00% 29 11 0.00% 30 19 0.00% 31 16 0.00% 32 10 0.00% 33 16 0.00% 34 14 0.00% 35 8 0.00% 36 20 0.00% 37 20 0.00% 38 24 0.00% 39 16 0.00% 40 30 0.00% 41 7 0.00% 42 19 0.00% 43 22 0.00% 44 19 0.00% 45 43 0.00% 46 45 0.00% 47 56 0.00% 48 71 0.00% 49 68 0.00% 50 76 0.00% 51 87 0.00% 52 105 0.00% 53 92 0.00% 54 121 0.00% 55 121 0.00% 56 123 0.00% 57 151 0.00% 58 147 0.00% 59 187 0.00% 60 209 0.00% 61 229 0.00% 62 261 0.00% 63 289 0.00% 64 304 0.00% 65 375 0.00% 66 376 0.00% 67 431 0.00% 68 463 0.00% 69 476 0.00% 70 643 0.01% 71 729 0.01% 72 891 0.01% 73 971 0.01% 74 1133 0.01% 75 1280 0.01% 76 1540 0.02% 77 1770 0.02% 78 1690 0.02% 79 1720 0.02% 80 1912 0.02% 81 2162 0.02% 82 2437 0.02% 83 2770 0.03% 84 4162 0.04% 85 4992 0.05% 86 5169 0.05% 87 5469 0.05% 88 5354 0.05% 89 5552 0.06% 90 5713 0.06% 91 5955 0.06% 92 6340 0.06% 93 6760 0.07% 94 6916 0.07% 95 7408 0.07% 96 7516 0.07% 97 7613 0.08% 98 7944 0.08% 99 8355 0.08% 100 8522 0.08% 101 8967 0.09% 102 9470 0.09% 103 10141 0.10% 104 10758 0.11% 105 11028 0.11% 106 11365 0.11% 107 11585 0.12% 108 11850 0.12% 109 12425 0.12% 110 12489 0.12% 111 12965 0.13% 112 14033 0.14% 113 14725 0.15% 114 14971 0.15% 115 15080 0.15% 116 15900 0.16% 117 16201 0.16% 118 16551 0.16% 119 16630 0.17% 120 17519 0.17% 121 17960 0.18% 122 18676 0.19% 123 19952 0.20% 124 20326 0.20% 125 21328 0.21% 126 22328 0.22% 127 22981 0.23% 128 24348 0.24% 129 24631 0.24% 130 25593 0.25% 131 26151 0.26% 132 28301 0.28% 133 29940 0.30% 134 31709 0.31% 135 33684 0.33% 136 35811 0.36% 137 38997 0.39% 138 41943 0.42% 139 45408 0.45% 140 49670 0.49% 141 55819 0.55% 142 63113 0.63% 143 73635 0.73% 144 86583 0.86% 145 106616 1.06% 146 136171 1.35% 147 190994 1.90% 148 296521 2.94% 149 603569 5.99% 150 2675269 26.56% 151 4801322 47.68% 10070696 reads passed initial QC criterion=sequence-density sequence-density=1.40 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=19 prefix-density=1.60 prefix-fanout=2.5 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=72.88 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=5.6 sequence=TTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCC criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=32 prefix-density=1.17 prefix-fanout=2.3 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=60.98 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.7 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7170661 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:06:21 Started mapping on | Feb 13 15:06:21 Finished on | Feb 13 15:07:32 Mapping speed, Million of reads per hour | 510.63 Number of input reads | 10070696 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9311024 Uniquely mapped reads % | 92.46% Average mapped length | 293.98 Number of splices: Total | 9430051 Number of splices: Annotated (sjdb) | 9266294 Number of splices: GT/AG | 9265148 Number of splices: GC/AG | 138342 Number of splices: AT/AC | 6240 Number of splices: Non-canonical | 20321 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246059 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 116354 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535398 535398 535398 N_multimapping 246059 246059 246059 N_noFeature 260550 9125255 299500 N_ambiguous 237499 435 90429 UnstrandedReadsAssigned:8812975 PositiveStrandReadsAssigned:185334 NegativeStrandReadsAssigned:8921095 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170661 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170661-trimmed-pair1.fastq SRR7170661-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,070,696 reads, 8,935,608 reads pseudoaligned [quant] estimated average fragment length: 267.525 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 998 rounds 52401 SRR7170661.ke.tsv 34699 SRR7170661.se.tsv 87100 total ==> SRR7170661.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.48 133 5.33701 Potri.005G024800.1.v4.1 1035 768.475 78 7.13371 Potri.004G059700.1.v4.1 961 694.546 15 1.51789 Potri.007G009000.2.v4.1 1416 1149.48 0 0 Potri.003G141000.2.v4.1 2943 2676.48 99 2.5997 Potri.016G087400.1.v4.1 270 75.9653 780 721.655 Potri.015G069301.1.v4.1 564 305.819 0 0 Potri.010G195200.1.v4.1 1773 1506.48 0 0 Potri.012G127500.1.v4.1 977 710.514 233 23.048 ==> SRR7170661.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 66 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170661 completed mapping pipeline successfully