Starting /dee2/code/volunteer_pipeline.sh SRR7170662 current disk space = 3089294819328 free memory = 1427027292 SRR7170662 SRAfilesize 2b2e9dffae11545dd54f2dcfc069d4d7 SRR7170662.sra SRR7170662.sra file validated SRR7170662 is paired end SRR7170662 is conventional basespace SRR7170662 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170662_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.61475 18.0 18.0 30.0 18.0 32.0 2 25.37425 27.0 18.0 29.0 18.0 31.0 3 24.68 25.0 18.0 29.0 18.0 33.0 4 28.261 29.0 27.0 31.0 25.0 33.0 5 30.1145 32.0 30.0 33.0 25.0 33.0 6 35.351 37.0 35.0 38.0 29.0 38.0 7 36.33775 38.0 37.0 38.0 34.0 38.0 8 36.57575 38.0 37.0 38.0 34.0 38.0 9 36.95725 38.0 38.0 38.0 35.0 38.0 10-14 37.07315 38.0 38.0 38.0 35.8 38.0 15-19 37.1229 38.0 38.0 38.0 36.0 38.0 20-24 37.07075 38.0 38.0 38.0 36.2 38.0 25-29 37.138 38.0 38.0 38.0 36.0 38.0 30-34 37.15435000000001 38.0 38.0 38.0 36.6 38.0 35-39 37.1713 38.0 38.0 38.0 36.8 38.0 40-44 37.10505 38.0 38.0 38.0 36.2 38.0 45-49 37.04665 38.0 38.0 38.0 36.0 38.0 50-54 36.922900000000006 38.0 38.0 38.0 35.8 38.0 55-59 36.81335 38.0 38.0 38.0 35.0 38.0 60-64 36.731049999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.6051 38.0 38.0 38.0 34.2 38.0 70-74 36.61725 38.0 38.0 38.0 34.2 38.0 75-79 36.44235 38.0 38.0 38.0 34.0 38.0 80-84 36.287850000000006 38.0 37.6 38.0 33.6 38.0 85-89 36.2719 38.0 37.6 38.0 33.6 38.0 90-94 35.9515 38.0 37.0 38.0 32.4 38.0 95-99 35.8904 38.0 37.0 38.0 32.0 38.0 100-104 35.626099999999994 38.0 37.0 38.0 31.0 38.0 105-109 35.455799999999996 38.0 36.0 38.0 29.4 38.0 110-114 35.36514999999999 38.0 36.0 38.0 29.4 38.0 115-119 35.239700000000006 38.0 36.0 38.0 28.6 38.0 120-124 34.9865 38.0 35.2 38.0 28.0 38.0 125-129 34.55400000000001 38.0 34.8 38.0 26.2 38.0 130-134 34.52995 38.0 34.6 38.0 26.2 38.0 135-139 33.64065 38.0 33.0 38.0 21.6 38.0 140-144 32.92285 38.0 33.0 38.0 17.0 38.0 145-149 31.742700000000003 38.0 31.8 38.0 10.8 38.0 150-151 25.508375 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 2.0 18 4.0 19 5.0 20 2.0 21 5.0 22 5.0 23 8.0 24 11.0 25 16.0 26 21.0 27 23.0 28 48.0 29 65.0 30 77.0 31 94.0 32 112.0 33 175.0 34 262.0 35 493.0 36 1140.0 37 1415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.262600155078836 25.1744636857069 9.304729904368052 29.258206254846215 2 23.65 25.4 34.325 16.625 3 21.75 29.75 27.800000000000004 20.7 4 21.875 33.45 23.575 21.099999999999998 5 24.525 34.975 21.925 18.575 6 17.25 37.4 22.625 22.725 7 12.950000000000001 19.375 46.800000000000004 20.875 8 17.825 21.625 27.400000000000002 33.15 9 17.1 21.725 31.15 30.025000000000002 10-14 19.765 29.505 26.195 24.535 15-19 19.580000000000002 28.54 27.755000000000003 24.125 20-24 20.330000000000002 28.720000000000002 27.755000000000003 23.195 25-29 20.015 28.425 27.685 23.875 30-34 20.369999999999997 29.134999999999998 27.339999999999996 23.155 35-39 19.885 28.575 27.54 24.0 40-44 20.06 28.62 27.705000000000002 23.615 45-49 20.015 28.139999999999997 27.79 24.055 50-54 20.035 28.79 27.525 23.65 55-59 20.055 28.515 27.87 23.56 60-64 20.4 28.575 27.339999999999996 23.685000000000002 65-69 19.79 28.555000000000003 27.975 23.68 70-74 20.255000000000003 28.095 28.015 23.635 75-79 19.85 28.535 27.384999999999998 24.23 80-84 20.285 28.325 27.705000000000002 23.685000000000002 85-89 19.78 28.555000000000003 27.650000000000002 24.015 90-94 19.845 28.33 27.750000000000004 24.075 95-99 20.24 27.935 28.134999999999998 23.69 100-104 20.335 29.025000000000002 26.905 23.735 105-109 20.805 28.02 27.384999999999998 23.79 110-114 20.669999999999998 28.015 27.85 23.465 115-119 20.94 28.265 26.91 23.885 120-124 20.8 28.7 27.04 23.46 125-129 20.41 28.08 27.68 23.830000000000002 130-134 20.415 28.43 27.38 23.775 135-139 20.405 27.71 28.194999999999997 23.69 140-144 20.22 28.335 27.42 24.025 145-149 20.71 28.985 26.779999999999998 23.525 150-151 20.9 28.287499999999998 27.8875 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 2.0 23 4.5 24 5.0 25 4.5 26 7.0 27 8.5 28 9.5 29 17.5 30 24.5 31 26.0 32 33.0 33 43.0 34 60.0 35 80.5 36 94.5 37 113.0 38 128.5 39 153.0 40 185.0 41 205.0 42 226.5 43 265.5 44 283.0 45 265.5 46 259.5 47 248.5 48 224.0 49 193.5 50 166.5 51 157.0 52 122.5 53 93.0 54 74.5 55 51.0 56 44.5 57 36.0 58 24.0 59 15.5 60 14.0 61 10.0 62 6.0 63 3.5 64 2.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34475806451613 98.55000000000001 2 0.5292338709677419 1.05 3 0.10080645161290322 0.3 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.3250000000000002 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.35 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATGT 10 0.006830828 145.0 3 ATCAATC 10 0.006830828 145.0 9 GGAAAAA 20 3.5877043E-4 108.75 1 >>END_MODULE SRR7170662 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170662_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.226 33.0 33.0 34.0 31.0 34.0 2 32.3525 33.0 33.0 34.0 31.0 34.0 3 32.407 33.0 33.0 34.0 31.0 34.0 4 32.29575 33.0 33.0 34.0 31.0 34.0 5 32.31625 33.0 33.0 34.0 31.0 34.0 6 36.44675 38.0 38.0 38.0 34.0 38.0 7 36.47075 38.0 38.0 38.0 34.0 38.0 8 36.46275 38.0 38.0 38.0 34.0 38.0 9 36.49225 38.0 38.0 38.0 34.0 38.0 10-14 36.3202 38.0 38.0 38.0 33.6 38.0 15-19 36.2214 38.0 38.0 38.0 33.2 38.0 20-24 36.2949 38.0 38.0 38.0 33.4 38.0 25-29 36.211749999999995 38.0 38.0 38.0 33.2 38.0 30-34 36.2362 38.0 38.0 38.0 33.6 38.0 35-39 36.15625 38.0 38.0 38.0 33.0 38.0 40-44 36.223850000000006 38.0 38.0 38.0 33.0 38.0 45-49 35.98675 38.0 37.8 38.0 32.6 38.0 50-54 35.9572 38.0 37.6 38.0 31.6 38.0 55-59 35.978699999999996 38.0 38.0 38.0 31.8 38.0 60-64 35.9111 38.0 37.2 38.0 31.8 38.0 65-69 35.866550000000004 38.0 37.4 38.0 31.4 38.0 70-74 35.78314999999999 38.0 37.0 38.0 30.6 38.0 75-79 35.59105 38.0 37.0 38.0 29.4 38.0 80-84 35.54934999999999 38.0 37.0 38.0 29.8 38.0 85-89 35.3914 38.0 37.0 38.0 29.6 38.0 90-94 35.2607 38.0 36.8 38.0 28.8 38.0 95-99 35.201350000000005 38.0 36.4 38.0 28.8 38.0 100-104 34.9422 38.0 36.0 38.0 27.2 38.0 105-109 34.715250000000005 38.0 35.8 38.0 25.8 38.0 110-114 34.48805 38.0 35.4 38.0 24.4 38.0 115-119 34.168899999999994 38.0 34.6 38.0 23.0 38.0 120-124 33.7098 38.0 33.6 38.0 20.6 38.0 125-129 33.3775 38.0 33.0 38.0 19.8 38.0 130-134 32.828250000000004 38.0 32.4 38.0 15.0 38.0 135-139 32.33685 38.0 31.8 38.0 14.2 38.0 140-144 31.216699999999996 37.0 29.6 38.0 12.4 38.0 145-149 29.911400000000004 36.0 28.0 38.0 2.0 38.0 150-151 24.373625 32.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 5.0 5 3.0 6 2.0 7 0.0 8 3.0 9 3.0 10 2.0 11 5.0 12 1.0 13 3.0 14 7.0 15 7.0 16 6.0 17 9.0 18 8.0 19 13.0 20 12.0 21 21.0 22 21.0 23 26.0 24 40.0 25 31.0 26 48.0 27 48.0 28 54.0 29 67.0 30 94.0 31 105.0 32 115.0 33 162.0 34 227.0 35 381.0 36 801.0 37 1658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.474999999999994 17.5 13.275 24.75 2 23.549999999999997 23.95 33.175 19.325 3 19.950000000000003 26.700000000000003 32.2 21.15 4 25.025 34.4 21.875 18.7 5 22.875 37.5 20.8 18.825 6 18.7 37.0 24.0 20.3 7 17.7 17.150000000000002 43.925 21.224999999999998 8 19.775000000000002 22.425 28.299999999999997 29.5 9 21.925 24.675 27.500000000000004 25.900000000000002 10-14 22.075 28.975 27.41 21.54 15-19 22.775000000000002 27.66 28.875 20.69 20-24 23.185 28.27 27.61 20.935000000000002 25-29 22.16 28.64 28.144999999999996 21.055 30-34 22.375 28.199999999999996 28.325 21.099999999999998 35-39 23.31 27.775 28.1 20.815 40-44 23.03 27.985 27.99 20.995 45-49 23.44 27.765 27.675 21.12 50-54 23.34 27.810000000000002 27.88 20.97 55-59 23.26 27.43 27.884999999999998 21.425 60-64 22.634999999999998 27.72 28.349999999999998 21.295 65-69 23.155 27.915 28.055000000000003 20.875 70-74 23.515 27.525 27.715 21.245 75-79 23.13 27.985 27.755000000000003 21.13 80-84 23.59 27.889999999999997 27.339999999999996 21.18 85-89 23.799999999999997 27.47 27.465 21.265 90-94 23.23 28.18 27.634999999999998 20.955 95-99 23.77 27.345000000000002 27.834999999999997 21.05 100-104 23.025000000000002 28.185 27.98 20.810000000000002 105-109 23.565 28.03 27.544999999999998 20.86 110-114 23.665 27.725 27.860000000000003 20.75 115-119 24.175 26.99 28.32 20.515 120-124 23.674999999999997 27.775 27.825 20.724999999999998 125-129 23.97 28.155 27.13 20.745 130-134 23.765 27.584999999999997 28.23 20.419999999999998 135-139 24.195 27.315 28.03 20.46 140-144 24.310000000000002 27.765 27.47 20.455000000000002 145-149 23.549999999999997 27.584999999999997 28.24 20.625 150-151 24.15 26.625 28.425 20.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 2.0 19 3.0 20 1.5 21 1.5 22 1.5 23 1.5 24 2.5 25 4.5 26 5.0 27 5.5 28 9.5 29 11.5 30 17.5 31 22.0 32 21.5 33 32.5 34 54.0 35 65.0 36 79.0 37 108.5 38 123.5 39 157.0 40 199.5 41 213.5 42 232.0 43 235.5 44 257.5 45 282.0 46 258.5 47 242.5 48 246.5 49 235.5 50 185.5 51 142.0 52 121.0 53 98.0 54 85.0 55 62.0 56 42.0 57 36.5 58 24.5 59 20.0 60 16.0 61 10.5 62 6.5 63 2.0 64 2.0 65 4.0 66 2.5 67 2.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98785425101214 97.8 2 0.8350202429149798 1.6500000000000001 3 0.15182186234817813 0.44999999999999996 4 0.025303643724696356 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.47500000000000003 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.6375000000000002 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.35 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATAAG 10 0.006830828 145.0 6 ACCCATC 10 0.006830828 145.0 4 >>END_MODULE Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889201 spots for SRR7170662.sra Written 889201 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra Read 889192 spots for SRR7170662.sra Written 889192 spots for SRR7170662.sra SRR ids: ['SRR7170662.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uwx4o0iv SRR7170662.sra spots: 17783849 blocks: [[1, 889192], [889193, 1778384], [1778385, 2667576], [2667577, 3556768], [3556769, 4445960], [4445961, 5335152], [5335153, 6224344], [6224345, 7113536], [7113537, 8002728], [8002729, 8891920], [8891921, 9781112], [9781113, 10670304], [10670305, 11559496], [11559497, 12448688], [12448689, 13337880], [13337881, 14227072], [14227073, 15116264], [15116265, 16005456], [16005457, 16894648], [16894649, 17783849]] SRR7170662 file size 6004662 SRR7170662 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170662 SRR7170662_1.fastq SRR7170662_2.fastq Input file: SRR7170662_1.fastq Paired file: SRR7170662_2.fastq trimmed: SRR7170662-trimmed-pair1.fastq, SRR7170662-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:59:41 2025 >> started Thu Feb 13 15:00:01 2025 >> done (19.875s) 17783849 read pairs processed; of these: 32690 ( 0.18%) short read pairs filtered out after trimming by size control 47560 ( 0.27%) empty read pairs filtered out after trimming by size control 17703599 (99.55%) read pairs available; of these: 11093199 (62.66%) trimmed read pairs available after processing 6610400 (37.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 10 0.00% 21 5 0.00% 22 15 0.00% 23 10 0.00% 24 13 0.00% 25 7 0.00% 26 9 0.00% 27 12 0.00% 28 17 0.00% 29 6 0.00% 30 10 0.00% 31 19 0.00% 32 12 0.00% 33 9 0.00% 34 15 0.00% 35 11 0.00% 36 24 0.00% 37 17 0.00% 38 32 0.00% 39 21 0.00% 40 33 0.00% 41 31 0.00% 42 39 0.00% 43 55 0.00% 44 51 0.00% 45 32 0.00% 46 51 0.00% 47 71 0.00% 48 79 0.00% 49 88 0.00% 50 111 0.00% 51 144 0.00% 52 149 0.00% 53 162 0.00% 54 158 0.00% 55 159 0.00% 56 197 0.00% 57 198 0.00% 58 264 0.00% 59 242 0.00% 60 315 0.00% 61 347 0.00% 62 394 0.00% 63 429 0.00% 64 533 0.00% 65 537 0.00% 66 552 0.00% 67 646 0.00% 68 721 0.00% 69 850 0.00% 70 877 0.00% 71 995 0.01% 72 1218 0.01% 73 1293 0.01% 74 1476 0.01% 75 1655 0.01% 76 1964 0.01% 77 2048 0.01% 78 2171 0.01% 79 2386 0.01% 80 2697 0.02% 81 2983 0.02% 82 3394 0.02% 83 3997 0.02% 84 5198 0.03% 85 6208 0.04% 86 6436 0.04% 87 6670 0.04% 88 7015 0.04% 89 7213 0.04% 90 7491 0.04% 91 8281 0.05% 92 8664 0.05% 93 9057 0.05% 94 9633 0.05% 95 10088 0.06% 96 10745 0.06% 97 10907 0.06% 98 11493 0.06% 99 12065 0.07% 100 12643 0.07% 101 13211 0.07% 102 13821 0.08% 103 14917 0.08% 104 15630 0.09% 105 16202 0.09% 106 17121 0.10% 107 17476 0.10% 108 18236 0.10% 109 19009 0.11% 110 19476 0.11% 111 20692 0.12% 112 21523 0.12% 113 22984 0.13% 114 23874 0.13% 115 24840 0.14% 116 26037 0.15% 117 27418 0.15% 118 28521 0.16% 119 29529 0.17% 120 31412 0.18% 121 33042 0.19% 122 34871 0.20% 123 37510 0.21% 124 39521 0.22% 125 41665 0.24% 126 44915 0.25% 127 47494 0.27% 128 50425 0.28% 129 54376 0.31% 130 57439 0.32% 131 63141 0.36% 132 68193 0.39% 133 74014 0.42% 134 81327 0.46% 135 90164 0.51% 136 100336 0.57% 137 110184 0.62% 138 122101 0.69% 139 135923 0.77% 140 152335 0.86% 141 170752 0.96% 142 195083 1.10% 143 226486 1.28% 144 263029 1.49% 145 311545 1.76% 146 395257 2.23% 147 514997 2.91% 148 773173 4.37% 149 1430042 8.08% 150 4765047 26.92% 151 6610400 37.34% 17703599 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.63 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=302.72 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAAT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=12 prefix-density=0.79 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=23.22 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.5 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170662 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:00:43 Started mapping on | Feb 13 15:00:44 Finished on | Feb 13 15:02:32 Mapping speed, Million of reads per hour | 590.12 Number of input reads | 17703599 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16617792 Uniquely mapped reads % | 93.87% Average mapped length | 292.65 Number of splices: Total | 16689103 Number of splices: Annotated (sjdb) | 16332666 Number of splices: GT/AG | 16377175 Number of splices: GC/AG | 254268 Number of splices: AT/AC | 9204 Number of splices: Non-canonical | 48456 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441835 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 66698 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 673943 673943 673943 N_multimapping 441835 441835 441835 N_noFeature 646467 16335214 740368 N_ambiguous 307391 1347 117855 UnstrandedReadsAssigned:15663934 PositiveStrandReadsAssigned:281231 NegativeStrandReadsAssigned:15759569 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170662 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170662-trimmed-pair1.fastq SRR7170662-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,703,599 reads, 15,679,197 reads pseudoaligned [quant] estimated average fragment length: 283.2 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR7170662.ke.tsv 34699 SRR7170662.se.tsv 87100 total ==> SRR7170662.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.8 504 16.9793 Potri.005G024800.1.v4.1 1035 752.8 227 17.6334 Potri.004G059700.1.v4.1 961 678.865 8 0.689121 Potri.007G009000.2.v4.1 1416 1133.8 0 0 Potri.003G141000.2.v4.1 2943 2660.8 1024.96 22.5259 Potri.016G087400.1.v4.1 270 71.7504 692 563.989 Potri.015G069301.1.v4.1 564 291.778 0 0 Potri.010G195200.1.v4.1 1773 1490.8 65 2.54966 Potri.012G127500.1.v4.1 977 694.859 101 8.4999 ==> SRR7170662.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 780 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 30 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170662 completed mapping pipeline successfully