Starting /dee2/code/volunteer_pipeline.sh SRR7170663 current disk space = 3089306157056 free memory = 1414637348 SRR7170663 SRAfilesize da95039aa6e50e0262c6bcf660ae88f9 SRR7170663.sra SRR7170663.sra file validated SRR7170663 is paired end SRR7170663 is conventional basespace SRR7170663 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170663_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.508 18.0 18.0 30.0 18.0 32.0 2 25.204 27.0 18.0 29.0 18.0 31.0 3 24.7205 25.0 18.0 29.0 18.0 31.0 4 28.2415 29.0 27.0 31.0 25.0 33.0 5 29.81475 32.0 30.0 33.0 25.0 33.0 6 35.33225 37.0 35.0 38.0 31.0 38.0 7 36.497 38.0 37.0 38.0 34.0 38.0 8 36.53925 38.0 37.0 38.0 34.0 38.0 9 36.92975 38.0 38.0 38.0 35.0 38.0 10-14 37.07965 38.0 38.0 38.0 36.0 38.0 15-19 37.13459999999999 38.0 38.0 38.0 36.4 38.0 20-24 37.050850000000004 38.0 38.0 38.0 36.0 38.0 25-29 37.16275 38.0 38.0 38.0 36.4 38.0 30-34 37.1535 38.0 38.0 38.0 36.4 38.0 35-39 37.1862 38.0 38.0 38.0 36.8 38.0 40-44 37.101150000000004 38.0 38.0 38.0 36.2 38.0 45-49 37.07735 38.0 38.0 38.0 36.0 38.0 50-54 36.9726 38.0 38.0 38.0 36.0 38.0 55-59 36.883700000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.8281 38.0 38.0 38.0 35.2 38.0 65-69 36.7106 38.0 38.0 38.0 34.8 38.0 70-74 36.6734 38.0 38.0 38.0 34.8 38.0 75-79 36.497800000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.399950000000004 38.0 37.8 38.0 33.8 38.0 85-89 36.29015 38.0 37.6 38.0 33.8 38.0 90-94 35.95545 38.0 37.0 38.0 32.4 38.0 95-99 35.92065 38.0 37.0 38.0 32.2 38.0 100-104 35.800599999999996 38.0 37.0 38.0 31.6 38.0 105-109 35.5565 38.0 36.4 38.0 30.2 38.0 110-114 35.52525000000001 38.0 36.2 38.0 29.8 38.0 115-119 35.36415000000001 38.0 36.0 38.0 29.6 38.0 120-124 35.1168 38.0 35.6 38.0 28.2 38.0 125-129 34.5607 38.0 35.0 38.0 25.4 38.0 130-134 34.43915 38.0 34.6 38.0 25.0 38.0 135-139 33.72 38.0 33.0 38.0 22.6 38.0 140-144 32.99995 38.0 32.6 38.0 19.6 38.0 145-149 31.794550000000005 38.0 31.4 38.0 10.8 38.0 150-151 25.7865 32.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 1.0 16 0.0 17 0.0 18 4.0 19 6.0 20 3.0 21 4.0 22 3.0 23 15.0 24 19.0 25 16.0 26 21.0 27 23.0 28 28.0 29 45.0 30 59.0 31 88.0 32 120.0 33 171.0 34 295.0 35 494.0 36 1155.0 37 1415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.56410256410256 26.871794871794876 8.025641025641026 26.53846153846154 2 22.55 25.25 33.75 18.45 3 22.6 29.95 27.325 20.125 4 21.325 33.675 22.825 22.175 5 21.45 36.225 22.825 19.5 6 16.650000000000002 38.6 23.25 21.5 7 11.675 20.7 45.4 22.225 8 16.35 21.7 28.275 33.675 9 19.175 22.1 28.999999999999996 29.725 10-14 19.895 29.23 26.474999999999998 24.4 15-19 19.585 29.25 27.305 23.86 20-24 20.07 28.82 27.58 23.53 25-29 19.925 28.585 27.715 23.775 30-34 19.195 28.294999999999998 28.425 24.085 35-39 20.080000000000002 28.444999999999997 27.310000000000002 24.165 40-44 19.665 29.005 27.584999999999997 23.745 45-49 19.73 28.77 28.044999999999998 23.455000000000002 50-54 19.88 29.07 27.860000000000003 23.189999999999998 55-59 19.975 28.384999999999998 27.93 23.71 60-64 19.925 28.499999999999996 27.485 24.09 65-69 19.685 28.32 27.860000000000003 24.135 70-74 19.705000000000002 28.425 28.27 23.599999999999998 75-79 19.955000000000002 28.660000000000004 27.62 23.765 80-84 20.28 28.65 27.63 23.44 85-89 19.52 28.34 28.035 24.104999999999997 90-94 20.415 28.13 27.725 23.73 95-99 19.99 28.15 28.610000000000003 23.25 100-104 19.580000000000002 28.060000000000002 28.595 23.765 105-109 20.330000000000002 28.57 27.675 23.425 110-114 20.115 28.725 27.685 23.474999999999998 115-119 20.715 28.205000000000002 27.889999999999997 23.189999999999998 120-124 20.105 28.775000000000002 27.715 23.405 125-129 20.845 28.405 26.974999999999998 23.775 130-134 20.71 28.99 26.979999999999997 23.32 135-139 20.525 28.095 27.67 23.71 140-144 20.905 28.53 26.985 23.580000000000002 145-149 21.17 28.199999999999996 26.895000000000003 23.735 150-151 20.875 28.212500000000002 27.5625 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 5.5 25 6.0 26 8.0 27 11.5 28 11.0 29 17.0 30 27.0 31 37.5 32 45.5 33 50.5 34 60.5 35 85.0 36 93.0 37 104.0 38 134.0 39 168.0 40 198.0 41 212.5 42 230.0 43 261.0 44 269.5 45 253.5 46 246.5 47 232.0 48 219.5 49 201.5 50 172.0 51 148.0 52 120.0 53 87.0 54 69.5 55 50.0 56 32.5 57 33.5 58 31.0 59 20.0 60 12.0 61 8.5 62 4.0 63 2.5 64 2.5 65 2.5 66 2.5 67 2.0 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34508816120908 98.6 2 0.5793450881612091 1.15 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.0875 0.0 0.0 0.0 0.0 134-135 3.325 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.9250000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170663 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170663_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35875 33.0 33.0 34.0 31.0 34.0 2 32.44125 33.0 33.0 34.0 31.0 34.0 3 32.48675 33.0 33.0 34.0 31.0 34.0 4 32.37 33.0 33.0 34.0 31.0 34.0 5 32.246 33.0 33.0 34.0 31.0 34.0 6 36.39925 38.0 38.0 38.0 34.0 38.0 7 36.49825 38.0 38.0 38.0 35.0 38.0 8 36.4295 38.0 38.0 38.0 34.0 38.0 9 36.4235 38.0 38.0 38.0 34.0 38.0 10-14 36.3833 38.0 38.0 38.0 34.0 38.0 15-19 36.32115 38.0 38.0 38.0 33.8 38.0 20-24 36.298700000000004 38.0 38.0 38.0 34.0 38.0 25-29 36.2432 38.0 38.0 38.0 33.8 38.0 30-34 36.2003 38.0 38.0 38.0 33.8 38.0 35-39 36.08935 38.0 38.0 38.0 33.0 38.0 40-44 36.144600000000004 38.0 38.0 38.0 33.2 38.0 45-49 35.9782 38.0 37.8 38.0 32.2 38.0 50-54 35.93814999999999 38.0 38.0 38.0 32.2 38.0 55-59 35.9698 38.0 38.0 38.0 33.0 38.0 60-64 35.770450000000004 38.0 37.4 38.0 30.8 38.0 65-69 35.7691 38.0 37.6 38.0 31.0 38.0 70-74 35.64035 38.0 37.0 38.0 29.8 38.0 75-79 35.627500000000005 38.0 37.0 38.0 30.6 38.0 80-84 35.437 38.0 37.0 38.0 29.0 38.0 85-89 35.3532 38.0 37.0 38.0 29.0 38.0 90-94 35.160000000000004 38.0 36.6 38.0 28.6 38.0 95-99 35.038349999999994 38.0 36.0 38.0 28.0 38.0 100-104 34.7756 38.0 36.0 38.0 26.6 38.0 105-109 34.67385 38.0 36.0 38.0 26.0 38.0 110-114 34.3877 38.0 35.4 38.0 23.8 38.0 115-119 33.963849999999994 38.0 34.8 38.0 21.8 38.0 120-124 33.62520000000001 38.0 33.6 38.0 19.0 38.0 125-129 33.162749999999996 38.0 33.0 38.0 16.2 38.0 130-134 32.69835 38.0 32.4 38.0 15.0 38.0 135-139 32.131449999999994 38.0 31.4 38.0 13.4 38.0 140-144 31.1247 37.2 29.8 38.0 12.4 38.0 145-149 29.872249999999998 36.0 28.0 38.0 2.0 38.0 150-151 24.015375 32.0 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 7.0 5 3.0 6 3.0 7 2.0 8 3.0 9 4.0 10 5.0 11 2.0 12 1.0 13 9.0 14 4.0 15 10.0 16 13.0 17 7.0 18 14.0 19 12.0 20 10.0 21 15.0 22 21.0 23 28.0 24 32.0 25 23.0 26 45.0 27 40.0 28 65.0 29 74.0 30 74.0 31 85.0 32 124.0 33 178.0 34 248.0 35 333.0 36 798.0 37 1691.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.975 19.175 11.575000000000001 22.275 2 23.200000000000003 24.474999999999998 32.775 19.55 3 21.175 25.174999999999997 33.375 20.275000000000002 4 24.45 35.949999999999996 21.325 18.275 5 22.225 38.375 20.724999999999998 18.675 6 18.725 37.425000000000004 24.2 19.650000000000002 7 17.474999999999998 17.599999999999998 42.975 21.95 8 19.925 22.1 27.1 30.875000000000004 9 21.125 25.0 27.650000000000002 26.224999999999998 10-14 22.855 28.315 27.474999999999998 21.355 15-19 22.35 27.715 28.605000000000004 21.33 20-24 22.21 28.13 28.055000000000003 21.605 25-29 23.205000000000002 27.915 28.144999999999996 20.735 30-34 22.745 28.4 27.955000000000002 20.9 35-39 22.965 27.625 28.34 21.07 40-44 22.900000000000002 28.055000000000003 28.005000000000003 21.04 45-49 22.645 28.125 28.665000000000003 20.565 50-54 22.509999999999998 27.235 28.965000000000003 21.29 55-59 22.73 27.975 28.410000000000004 20.885 60-64 23.075000000000003 27.3 28.475 21.15 65-69 23.235 27.905 27.73 21.13 70-74 22.95 27.439999999999998 28.735 20.875 75-79 23.285 28.09 28.055000000000003 20.57 80-84 22.775000000000002 27.834999999999997 27.845 21.545 85-89 23.265 27.765 28.044999999999998 20.925 90-94 22.655 28.310000000000002 28.535 20.5 95-99 22.97 28.575 27.894999999999996 20.560000000000002 100-104 23.43 27.99 28.060000000000002 20.52 105-109 22.830000000000002 27.875 28.499999999999996 20.794999999999998 110-114 23.66 27.985 28.01 20.345 115-119 23.419999999999998 27.834999999999997 28.205000000000002 20.54 120-124 23.775 27.775 27.905 20.544999999999998 125-129 24.02 27.91 28.21 19.86 130-134 23.71 27.525 28.444999999999997 20.32 135-139 23.150000000000002 27.68 28.470000000000002 20.7 140-144 23.365 27.93 28.199999999999996 20.505000000000003 145-149 24.224999999999998 27.76 27.92 20.095 150-151 23.962500000000002 27.525 28.537499999999998 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 2.0 20 2.5 21 2.0 22 1.5 23 2.0 24 1.5 25 1.5 26 4.5 27 8.5 28 15.0 29 18.0 30 21.0 31 27.5 32 33.0 33 42.0 34 52.0 35 62.0 36 81.0 37 112.5 38 139.0 39 169.5 40 206.0 41 234.5 42 254.5 43 255.5 44 257.0 45 262.0 46 244.5 47 228.0 48 215.5 49 201.0 50 171.0 51 133.5 52 108.0 53 82.5 54 75.5 55 66.0 56 49.0 57 44.5 58 39.0 59 25.5 60 16.0 61 11.5 62 4.5 63 4.5 64 4.5 65 1.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26841574167507 98.375 2 0.6306760847628659 1.25 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 2.05 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.0999999999999996 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 3.5999999999999996 0.0 0.0 0.0 0.0 138-139 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTACT 10 0.006830828 145.0 145 CTCTCAC 10 0.006830828 145.0 145 >>END_MODULE Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775460 spots for SRR7170663.sra Written 775460 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra Read 775450 spots for SRR7170663.sra Written 775450 spots for SRR7170663.sra SRR ids: ['SRR7170663.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g6525pd4 SRR7170663.sra spots: 15509010 blocks: [[1, 775450], [775451, 1550900], [1550901, 2326350], [2326351, 3101800], [3101801, 3877250], [3877251, 4652700], [4652701, 5428150], [5428151, 6203600], [6203601, 6979050], [6979051, 7754500], [7754501, 8529950], [8529951, 9305400], [9305401, 10080850], [10080851, 10856300], [10856301, 11631750], [11631751, 12407200], [12407201, 13182650], [13182651, 13958100], [13958101, 14733550], [14733551, 15509010]] SRR7170663 file size 5233794 SRR7170663 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170663 SRR7170663_1.fastq SRR7170663_2.fastq Input file: SRR7170663_1.fastq Paired file: SRR7170663_2.fastq trimmed: SRR7170663-trimmed-pair1.fastq, SRR7170663-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:56:28 2025 >> started Thu Feb 13 14:56:57 2025 >> done (28.924s) 15509010 read pairs processed; of these: 38626 ( 0.25%) short read pairs filtered out after trimming by size control 47111 ( 0.30%) empty read pairs filtered out after trimming by size control 15423273 (99.45%) read pairs available; of these: 9682952 (62.78%) trimmed read pairs available after processing 5740321 (37.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 9 0.00% 21 12 0.00% 22 6 0.00% 23 8 0.00% 24 7 0.00% 25 7 0.00% 26 9 0.00% 27 7 0.00% 28 23 0.00% 29 6 0.00% 30 10 0.00% 31 9 0.00% 32 10 0.00% 33 12 0.00% 34 11 0.00% 35 8 0.00% 36 20 0.00% 37 11 0.00% 38 19 0.00% 39 21 0.00% 40 25 0.00% 41 28 0.00% 42 30 0.00% 43 34 0.00% 44 35 0.00% 45 46 0.00% 46 39 0.00% 47 43 0.00% 48 49 0.00% 49 61 0.00% 50 82 0.00% 51 86 0.00% 52 87 0.00% 53 104 0.00% 54 119 0.00% 55 107 0.00% 56 140 0.00% 57 141 0.00% 58 143 0.00% 59 173 0.00% 60 215 0.00% 61 241 0.00% 62 293 0.00% 63 273 0.00% 64 331 0.00% 65 345 0.00% 66 416 0.00% 67 437 0.00% 68 488 0.00% 69 549 0.00% 70 644 0.00% 71 695 0.00% 72 863 0.01% 73 909 0.01% 74 1043 0.01% 75 1234 0.01% 76 1387 0.01% 77 1424 0.01% 78 1484 0.01% 79 1796 0.01% 80 1986 0.01% 81 2278 0.01% 82 2544 0.02% 83 3076 0.02% 84 4574 0.03% 85 5410 0.04% 86 5487 0.04% 87 5737 0.04% 88 5950 0.04% 89 6025 0.04% 90 6243 0.04% 91 6699 0.04% 92 7337 0.05% 93 7642 0.05% 94 8282 0.05% 95 8492 0.06% 96 8921 0.06% 97 9276 0.06% 98 9689 0.06% 99 10364 0.07% 100 10653 0.07% 101 11424 0.07% 102 12130 0.08% 103 13015 0.08% 104 13724 0.09% 105 14326 0.09% 106 14560 0.09% 107 15119 0.10% 108 15667 0.10% 109 16214 0.11% 110 17114 0.11% 111 18179 0.12% 112 19021 0.12% 113 19899 0.13% 114 21131 0.14% 115 22161 0.14% 116 22924 0.15% 117 24467 0.16% 118 25078 0.16% 119 26107 0.17% 120 27321 0.18% 121 29068 0.19% 122 30912 0.20% 123 32901 0.21% 124 35164 0.23% 125 37291 0.24% 126 39593 0.26% 127 41433 0.27% 128 44132 0.29% 129 47669 0.31% 130 50363 0.33% 131 54525 0.35% 132 58700 0.38% 133 64965 0.42% 134 71083 0.46% 135 78190 0.51% 136 86498 0.56% 137 95037 0.62% 138 104760 0.68% 139 116694 0.76% 140 131297 0.85% 141 147609 0.96% 142 166752 1.08% 143 193724 1.26% 144 226750 1.47% 145 269443 1.75% 146 343039 2.22% 147 449159 2.91% 148 677057 4.39% 149 1259579 8.17% 150 4176442 27.08% 151 5740321 37.22% 15423273 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=23 fanout-score=30.25 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=10.4 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=14.88 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.0 sequence=AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTG SRR7170663 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:57:55 Started mapping on | Feb 13 14:57:56 Finished on | Feb 13 15:00:57 Mapping speed, Million of reads per hour | 306.76 Number of input reads | 15423273 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14306371 Uniquely mapped reads % | 92.76% Average mapped length | 292.79 Number of splices: Total | 14018094 Number of splices: Annotated (sjdb) | 13707354 Number of splices: GT/AG | 13754310 Number of splices: GC/AG | 218053 Number of splices: AT/AC | 8049 Number of splices: Non-canonical | 37682 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416838 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 57410 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 731493 731493 731493 N_multimapping 416838 416838 416838 N_noFeature 559208 14098925 644382 N_ambiguous 220727 937 97914 UnstrandedReadsAssigned:13526436 PositiveStrandReadsAssigned:206509 NegativeStrandReadsAssigned:13564075 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170663 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170663-trimmed-pair1.fastq SRR7170663-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,423,273 reads, 13,571,224 reads pseudoaligned [quant] estimated average fragment length: 275.868 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR7170663.ke.tsv 34699 SRR7170663.se.tsv 87100 total ==> SRR7170663.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.13 444 18.5703 Potri.005G024800.1.v4.1 1035 760.132 192 18.4153 Potri.004G059700.1.v4.1 961 686.259 6 0.637426 Potri.007G009000.2.v4.1 1416 1141.13 0 0 Potri.003G141000.2.v4.1 2943 2668.13 605.014 16.532 Potri.016G087400.1.v4.1 270 71.7057 609 619.199 Potri.015G069301.1.v4.1 564 298.111 0 0 Potri.010G195200.1.v4.1 1773 1498.13 21 1.02196 Potri.012G127500.1.v4.1 977 702.175 352 36.548 ==> SRR7170663.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 478 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 96 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7170663 completed mapping pipeline successfully