Starting /dee2/code/volunteer_pipeline.sh SRR7170664 current disk space = 3088838176768 free memory = 1577736912 SRR7170664 SRAfilesize 164923e3031be010ecd8a338319f31ce SRR7170664.sra SRR7170664.sra file validated SRR7170664 is paired end SRR7170664 is conventional basespace SRR7170664 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170664_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.0805 18.0 18.0 30.0 18.0 33.0 2 30.375 31.0 29.0 33.0 27.0 33.0 3 31.00325 33.0 31.0 33.0 28.0 33.0 4 31.88975 33.0 31.0 33.0 29.0 33.0 5 32.5885 33.0 33.0 33.0 31.0 34.0 6 37.125 38.0 38.0 38.0 36.0 38.0 7 37.34 38.0 38.0 38.0 37.0 38.0 8 37.44075 38.0 38.0 38.0 37.0 38.0 9 37.37275 38.0 38.0 38.0 37.0 38.0 10-14 37.38375 38.0 38.0 38.0 37.0 38.0 15-19 37.3561 38.0 38.0 38.0 37.0 38.0 20-24 37.46294999999999 38.0 38.0 38.0 37.2 38.0 25-29 37.47035 38.0 38.0 38.0 37.2 38.0 30-34 37.4242 38.0 38.0 38.0 37.0 38.0 35-39 37.4138 38.0 38.0 38.0 37.0 38.0 40-44 37.317600000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.32935 38.0 38.0 38.0 37.0 38.0 50-54 37.183899999999994 38.0 38.0 38.0 36.4 38.0 55-59 37.10935 38.0 38.0 38.0 36.0 38.0 60-64 37.0596 38.0 38.0 38.0 36.0 38.0 65-69 37.007099999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.9304 38.0 38.0 38.0 35.4 38.0 75-79 36.65795 38.0 38.0 38.0 35.0 38.0 80-84 36.46445 38.0 38.0 38.0 34.0 38.0 85-89 36.460899999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.275150000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.191700000000004 38.0 37.4 38.0 33.8 38.0 100-104 35.988099999999996 38.0 37.2 38.0 33.2 38.0 105-109 35.8543 38.0 37.0 38.0 32.6 38.0 110-114 35.588350000000005 38.0 36.8 38.0 30.8 38.0 115-119 35.375 38.0 36.0 38.0 29.8 38.0 120-124 35.253249999999994 38.0 36.0 38.0 29.0 38.0 125-129 35.08825 38.0 35.8 38.0 29.0 38.0 130-134 34.67095 38.0 35.0 38.0 27.6 38.0 135-139 34.40915 38.0 35.0 38.0 26.0 38.0 140-144 33.8306 38.0 34.4 38.0 22.6 38.0 145-149 32.84565 38.0 33.2 38.0 17.0 38.0 150-151 27.834625 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 1.0 17 0.0 18 10.0 19 20.0 20 5.0 21 7.0 22 5.0 23 15.0 24 9.0 25 15.0 26 9.0 27 23.0 28 17.0 29 39.0 30 39.0 31 56.0 32 74.0 33 130.0 34 197.0 35 389.0 36 937.0 37 1998.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.850152905198776 18.730886850152906 14.347604485219165 30.071355759429153 2 19.475 26.0 35.449999999999996 19.075 3 15.0 31.324999999999996 30.375000000000004 23.3 4 19.8 37.025000000000006 24.3 18.875 5 21.75763645468202 35.50325488232349 24.3114672008012 18.42764146219329 6 18.6 34.1 24.175 23.125 7 12.8 20.349999999999998 45.375 21.475 8 16.725 22.025 27.825 33.425 9 16.825000000000003 23.3 29.375 30.5 10-14 18.845 30.19 26.31 24.654999999999998 15-19 18.93 29.375 27.450000000000003 24.245 20-24 19.6 29.235 27.47 23.695 25-29 19.765 29.67 27.0 23.565 30-34 20.215 29.45 26.85 23.485 35-39 19.82 29.255 27.33 23.595 40-44 20.31 29.17 26.995 23.525 45-49 19.64 29.104999999999997 27.534999999999997 23.72 50-54 19.955000000000002 28.21 27.82 24.015 55-59 19.650000000000002 28.955 27.200000000000003 24.195 60-64 19.665 29.2 27.400000000000002 23.735 65-69 19.515 29.630000000000003 26.985 23.87 70-74 19.439999999999998 29.565 27.74 23.255 75-79 19.759999999999998 29.45 26.685 24.104999999999997 80-84 19.6 28.92 27.35 24.13 85-89 20.205000000000002 29.12 26.605 24.07 90-94 20.32 28.71 27.52 23.45 95-99 20.54 28.595 27.01 23.855 100-104 20.445 28.32 27.24 23.995 105-109 20.044999999999998 28.52 26.995 24.44 110-114 20.75 28.444999999999997 27.125 23.68 115-119 20.525 28.02 27.400000000000002 24.055 120-124 20.645 28.345 27.455000000000002 23.555 125-129 20.830000000000002 28.02 27.045 24.104999999999997 130-134 20.36 28.37 27.54 23.73 135-139 20.82 27.43 27.3 24.45 140-144 20.49 27.68 27.689999999999998 24.14 145-149 20.4 28.050000000000004 27.32 24.23 150-151 20.92296148074037 28.16408204102051 27.363681840920464 23.54927463731866 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.0 22 1.0 23 2.0 24 5.0 25 7.5 26 6.0 27 8.0 28 12.0 29 20.5 30 29.5 31 36.0 32 48.0 33 53.5 34 66.5 35 99.0 36 114.5 37 119.0 38 142.0 39 166.5 40 185.5 41 211.5 42 232.0 43 247.5 44 246.0 45 239.5 46 233.5 47 225.0 48 215.5 49 189.0 50 157.5 51 141.5 52 131.0 53 99.5 54 74.0 55 57.0 56 47.5 57 38.0 58 25.0 59 20.0 60 14.0 61 10.0 62 8.0 63 4.0 64 1.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.74712349782664 96.55 2 1.0227563283047814 2.0 3 0.12784454103809767 0.375 4 0.0 0.0 5 0.0767067246228586 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025568908207619537 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 28 0.7000000000000001 TruSeq Adapter, Index 7 (97% over 35bp) CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 5 0.125 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit GTTCGATTCAGCATCCGAATCCAGAAAGCAAAAACAAAGTAGAATATTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9125000000000001 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 3.9 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.574999999999999 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCCT 10 0.0068343505 144.975 4 >>END_MODULE SRR7170664 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170664_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6575 33.0 33.0 34.0 32.0 34.0 2 32.7965 33.0 33.0 34.0 32.0 34.0 3 32.8115 34.0 33.0 34.0 32.0 34.0 4 32.7165 34.0 33.0 34.0 32.0 34.0 5 32.766 34.0 33.0 34.0 32.0 34.0 6 36.87475 38.0 38.0 38.0 36.0 38.0 7 36.95225 38.0 38.0 38.0 36.0 38.0 8 36.95025 38.0 38.0 38.0 36.0 38.0 9 36.98025 38.0 38.0 38.0 37.0 38.0 10-14 36.966899999999995 38.0 38.0 38.0 36.2 38.0 15-19 36.9726 38.0 38.0 38.0 36.4 38.0 20-24 36.91655 38.0 38.0 38.0 36.0 38.0 25-29 36.9045 38.0 38.0 38.0 36.4 38.0 30-34 36.851150000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.865950000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.843849999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.8522 38.0 38.0 38.0 36.0 38.0 50-54 36.75035 38.0 38.0 38.0 36.0 38.0 55-59 36.63805 38.0 38.0 38.0 35.2 38.0 60-64 36.63879999999999 38.0 38.0 38.0 35.6 38.0 65-69 36.617399999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.597849999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.47709999999999 38.0 38.0 38.0 35.2 38.0 80-84 36.18814999999999 38.0 38.0 38.0 34.2 38.0 85-89 36.080650000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.026650000000004 38.0 38.0 38.0 34.0 38.0 95-99 35.821600000000004 38.0 38.0 38.0 33.2 38.0 100-104 35.67215 38.0 37.6 38.0 32.8 38.0 105-109 35.6041 38.0 37.4 38.0 32.6 38.0 110-114 35.3948 38.0 37.2 38.0 31.4 38.0 115-119 35.00015 38.0 36.6 38.0 28.4 38.0 120-124 35.041250000000005 38.0 36.6 38.0 29.4 38.0 125-129 34.697050000000004 38.0 35.8 38.0 27.8 38.0 130-134 34.41785 38.0 35.4 38.0 26.4 38.0 135-139 34.08489999999999 38.0 34.2 38.0 24.2 38.0 140-144 33.58655 38.0 33.0 38.0 21.2 38.0 145-149 32.60985 38.0 33.0 38.0 11.8 38.0 150-151 27.045625 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 2.0 5 1.0 6 2.0 7 1.0 8 1.0 9 3.0 10 4.0 11 6.0 12 0.0 13 9.0 14 4.0 15 6.0 16 8.0 17 2.0 18 13.0 19 12.0 20 15.0 21 5.0 22 8.0 23 12.0 24 18.0 25 23.0 26 17.0 27 17.0 28 23.0 29 36.0 30 46.0 31 54.0 32 81.0 33 87.0 34 168.0 35 248.0 36 654.0 37 2397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.1 16.900000000000002 15.7 25.3 2 25.35 23.05 33.35 18.25 3 19.775000000000002 25.324999999999996 33.675 21.224999999999998 4 23.125 34.8 22.900000000000002 19.175 5 23.724999999999998 37.475 21.025 17.775 6 18.55927963981991 37.39369684842421 23.986993496748372 20.060030015007506 7 17.625 15.85 44.324999999999996 22.2 8 20.260130065032516 23.536768384192097 27.113556778389196 29.089544772386194 9 22.525000000000002 23.75 27.925 25.8 10-14 23.358503775566337 27.784167625143773 26.77401610241536 22.08331249687453 15-19 23.1911595579779 27.2063603180159 28.25641282064103 21.346067303365167 20-24 23.512351235123514 28.137813781378142 27.35273527352735 20.997099709971 25-29 22.42724272427243 28.91289128912891 27.53775377537754 21.122112211221122 30-34 23.491174558727938 27.68638431921596 27.471373568678437 21.35106755337767 35-39 22.826848054416324 28.078423527058117 27.953386015804742 21.141342402720817 40-44 23.322827555155335 27.570163589974484 28.26554605032768 20.8414628045425 45-49 23.678551782767414 27.244086612991946 27.914187128069212 21.163174476171427 50-54 23.026151307565378 27.50637531876594 28.196409820491024 21.271063553177658 55-59 24.46734020206062 27.243172951885562 27.333199959987997 20.95628688606582 60-64 23.424684936987397 27.855571114222844 27.550510102020404 21.16923384676935 65-69 23.356167808390417 28.026401320066004 27.416370818540926 21.20106005300265 70-74 23.794999999999998 28.439999999999998 26.455000000000002 21.310000000000002 75-79 23.487348734873486 27.84278427842784 27.477747774777477 21.19211921192119 80-84 23.875 27.96 27.485 20.68 85-89 23.957395739573958 28.182818281828183 27.647764776477647 20.212021202120212 90-94 24.4 28.04 27.265 20.294999999999998 95-99 24.14 27.975 28.04 19.845 100-104 24.805 27.265 27.525 20.405 105-109 24.275 27.785 27.82 20.119999999999997 110-114 23.690660797358813 28.51783302486119 27.377319793907258 20.414186383872742 115-119 24.422442244224424 28.17781778177818 27.507750775077504 19.891989198919894 120-124 24.615000000000002 28.03 27.21 20.145 125-129 23.52 28.075 27.855 20.549999999999997 130-134 24.490000000000002 27.685 27.415 20.41 135-139 24.874974994999 27.930586117223445 27.295459091818365 19.898979795959193 140-144 24.449779911964786 28.306322529011606 27.25090036014406 19.992997198879554 145-149 24.34 28.035 27.744999999999997 19.88 150-151 25.1875 27.787499999999998 27.187499999999996 19.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 1.5 22 2.5 23 2.5 24 1.5 25 2.0 26 7.5 27 7.5 28 9.0 29 13.0 30 17.0 31 21.5 32 25.5 33 34.0 34 45.5 35 52.0 36 70.5 37 101.5 38 121.0 39 143.0 40 172.5 41 213.5 42 249.0 43 250.5 44 253.0 45 277.0 46 277.5 47 250.0 48 203.5 49 186.0 50 186.0 51 154.5 52 137.5 53 120.0 54 98.5 55 79.5 56 65.0 57 50.5 58 25.5 59 17.0 60 16.5 61 10.5 62 6.0 63 5.0 64 4.0 65 2.0 66 1.0 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.05 9 0.0 10-14 0.015 15-19 0.005 20-24 0.01 25-29 0.01 30-34 0.005 35-39 0.03 40-44 0.055 45-49 0.015 50-54 0.005 55-59 0.03 60-64 0.02 65-69 0.005 70-74 0.0 75-79 0.01 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.045 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.04 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.56152067814024 95.92500000000001 2 1.0531723606473156 2.0500000000000003 3 0.17980991523246853 0.525 4 0.10274852298998202 0.4 5 0.07706139224248652 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025687130747495505 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 29 0.7250000000000001 Illumina Single End PCR Primer 1 (97% over 34bp) TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 5 0.125 No Hit GCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAATG 10 0.006830828 145.0 2 >>END_MODULE Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723629 spots for SRR7170664.sra Written 723629 spots for SRR7170664.sra Read 723638 spots for SRR7170664.sra Written 723638 spots for SRR7170664.sra SRR ids: ['SRR7170664.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4q1qz328 SRR7170664.sra spots: 14472589 blocks: [[1, 723629], [723630, 1447258], [1447259, 2170887], [2170888, 2894516], [2894517, 3618145], [3618146, 4341774], [4341775, 5065403], [5065404, 5789032], [5789033, 6512661], [6512662, 7236290], [7236291, 7959919], [7959920, 8683548], [8683549, 9407177], [9407178, 10130806], [10130807, 10854435], [10854436, 11578064], [11578065, 12301693], [12301694, 13025322], [13025323, 13748951], [13748952, 14472589]] SRR7170664 file size 4882585 SRR7170664 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170664 SRR7170664_1.fastq SRR7170664_2.fastq Input file: SRR7170664_1.fastq Paired file: SRR7170664_2.fastq trimmed: SRR7170664-trimmed-pair1.fastq, SRR7170664-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:03:28 2025 >> started Thu Feb 13 16:03:43 2025 >> done (15.132s) 14472589 read pairs processed; of these: 21177 ( 0.15%) short read pairs filtered out after trimming by size control 124079 ( 0.86%) empty read pairs filtered out after trimming by size control 14327333 (99.00%) read pairs available; of these: 7347031 (51.28%) trimmed read pairs available after processing 6980302 (48.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 8 0.00% 20 11 0.00% 21 8 0.00% 22 11 0.00% 23 14 0.00% 24 12 0.00% 25 10 0.00% 26 9 0.00% 27 14 0.00% 28 18 0.00% 29 8 0.00% 30 16 0.00% 31 22 0.00% 32 23 0.00% 33 18 0.00% 34 19 0.00% 35 8 0.00% 36 23 0.00% 37 28 0.00% 38 34 0.00% 39 32 0.00% 40 21 0.00% 41 44 0.00% 42 44 0.00% 43 58 0.00% 44 55 0.00% 45 57 0.00% 46 85 0.00% 47 131 0.00% 48 144 0.00% 49 115 0.00% 50 150 0.00% 51 149 0.00% 52 161 0.00% 53 176 0.00% 54 180 0.00% 55 192 0.00% 56 228 0.00% 57 259 0.00% 58 258 0.00% 59 273 0.00% 60 359 0.00% 61 388 0.00% 62 456 0.00% 63 453 0.00% 64 514 0.00% 65 552 0.00% 66 548 0.00% 67 643 0.00% 68 728 0.01% 69 778 0.01% 70 909 0.01% 71 1063 0.01% 72 1188 0.01% 73 1306 0.01% 74 1537 0.01% 75 1900 0.01% 76 2787 0.02% 77 2953 0.02% 78 2156 0.02% 79 2405 0.02% 80 2504 0.02% 81 2939 0.02% 82 3124 0.02% 83 3635 0.03% 84 4924 0.03% 85 5575 0.04% 86 6052 0.04% 87 6237 0.04% 88 6527 0.05% 89 6674 0.05% 90 7108 0.05% 91 7363 0.05% 92 7913 0.06% 93 8463 0.06% 94 8863 0.06% 95 9316 0.07% 96 9748 0.07% 97 10216 0.07% 98 10298 0.07% 99 10841 0.08% 100 11364 0.08% 101 12053 0.08% 102 12507 0.09% 103 13427 0.09% 104 13986 0.10% 105 14730 0.10% 106 15198 0.11% 107 15297 0.11% 108 16174 0.11% 109 16890 0.12% 110 17643 0.12% 111 17961 0.13% 112 18806 0.13% 113 19928 0.14% 114 20557 0.14% 115 20985 0.15% 116 21525 0.15% 117 22229 0.16% 118 22939 0.16% 119 23154 0.16% 120 24164 0.17% 121 24755 0.17% 122 25528 0.18% 123 27533 0.19% 124 28432 0.20% 125 29001 0.20% 126 30587 0.21% 127 30994 0.22% 128 32531 0.23% 129 34087 0.24% 130 35649 0.25% 131 36750 0.26% 132 39208 0.27% 133 41426 0.29% 134 43779 0.31% 135 46604 0.33% 136 49656 0.35% 137 53807 0.38% 138 58548 0.41% 139 63740 0.44% 140 70080 0.49% 141 79160 0.55% 142 90570 0.63% 143 103947 0.73% 144 120442 0.84% 145 150518 1.05% 146 192966 1.35% 147 274489 1.92% 148 415635 2.90% 149 814630 5.69% 150 3765380 26.28% 151 6980302 48.72% 14327333 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=27 prefix-density=0.81 prefix-fanout=2.3 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=34.14 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.4 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTG criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=20 prefix-density=0.71 prefix-fanout=2.2 sequence=AATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=83.04 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170664 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:04:27 Started mapping on | Feb 13 16:04:28 Finished on | Feb 13 16:06:06 Mapping speed, Million of reads per hour | 526.31 Number of input reads | 14327333 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13414303 Uniquely mapped reads % | 93.63% Average mapped length | 294.16 Number of splices: Total | 12871475 Number of splices: Annotated (sjdb) | 12591859 Number of splices: GT/AG | 12625462 Number of splices: GC/AG | 200706 Number of splices: AT/AC | 8481 Number of splices: Non-canonical | 36826 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405646 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 22079 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527677 527677 527677 N_multimapping 405646 405646 405646 N_noFeature 432377 13085686 506184 N_ambiguous 364016 911 108773 UnstrandedReadsAssigned:12617910 PositiveStrandReadsAssigned:327706 NegativeStrandReadsAssigned:12799346 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170664 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170664-trimmed-pair1.fastq SRR7170664-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,327,333 reads, 12,686,347 reads pseudoaligned [quant] estimated average fragment length: 265.499 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7170664.ke.tsv 34699 SRR7170664.se.tsv 87100 total ==> SRR7170664.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.5 887 28.1159 Potri.005G024800.1.v4.1 1035 770.501 293 21.1363 Potri.004G059700.1.v4.1 961 696.546 4 0.319187 Potri.007G009000.2.v4.1 1416 1151.5 0 0 Potri.003G141000.2.v4.1 2943 2678.5 493 10.2303 Potri.016G087400.1.v4.1 270 75.3729 701.674 517.434 Potri.015G069301.1.v4.1 564 307.219 0 0 Potri.010G195200.1.v4.1 1773 1508.5 133 4.9005 Potri.012G127500.1.v4.1 977 712.511 429 33.4657 ==> SRR7170664.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1132 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 371 Potri.001G212900.v4.1 33 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 33 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170664 completed mapping pipeline successfully