Starting /dee2/code/volunteer_pipeline.sh SRR7170665 current disk space = 3088853561344 free memory = 1577557216 SRR7170665 SRAfilesize 71355ab4b7da3e749e7021d5ce2eaa58 SRR7170665.sra SRR7170665.sra file validated SRR7170665 is paired end SRR7170665 is conventional basespace SRR7170665 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170665_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.19575 30.0 18.0 32.0 18.0 33.0 2 30.7545 31.0 29.0 33.0 27.0 33.0 3 31.544 33.0 31.0 33.0 28.0 33.0 4 31.48575 33.0 31.0 33.0 29.0 34.0 5 32.30425 33.0 33.0 33.0 31.0 34.0 6 36.20575 38.0 36.0 38.0 33.0 38.0 7 36.63675 38.0 37.0 38.0 34.0 38.0 8 36.8745 38.0 38.0 38.0 35.0 38.0 9 37.049 38.0 38.0 38.0 36.0 38.0 10-14 37.1047 38.0 38.0 38.0 36.0 38.0 15-19 37.09365 38.0 38.0 38.0 36.0 38.0 20-24 37.0852 38.0 38.0 38.0 36.0 38.0 25-29 37.079249999999995 38.0 38.0 38.0 36.0 38.0 30-34 37.0964 38.0 38.0 38.0 36.0 38.0 35-39 37.16415 38.0 38.0 38.0 36.2 38.0 40-44 37.08455 38.0 38.0 38.0 36.0 38.0 45-49 36.99605 38.0 38.0 38.0 36.0 38.0 50-54 36.841950000000004 38.0 38.0 38.0 35.2 38.0 55-59 36.71445 38.0 38.0 38.0 34.8 38.0 60-64 36.68915 38.0 38.0 38.0 34.4 38.0 65-69 36.57115 38.0 38.0 38.0 34.0 38.0 70-74 36.461650000000006 38.0 38.0 38.0 34.0 38.0 75-79 36.1699 38.0 37.6 38.0 33.2 38.0 80-84 36.061350000000004 38.0 37.0 38.0 33.0 38.0 85-89 35.9268 38.0 37.0 38.0 32.2 38.0 90-94 35.6577 38.0 37.0 38.0 30.4 38.0 95-99 35.51845 38.0 36.6 38.0 30.4 38.0 100-104 35.343149999999994 38.0 36.0 38.0 29.0 38.0 105-109 35.18895 38.0 36.0 38.0 28.8 38.0 110-114 35.101299999999995 38.0 36.0 38.0 28.2 38.0 115-119 34.88125 38.0 35.2 38.0 27.6 38.0 120-124 34.47745 38.0 35.0 38.0 25.6 38.0 125-129 34.099000000000004 38.0 34.4 38.0 23.6 38.0 130-134 33.9214 38.0 33.8 38.0 22.8 38.0 135-139 32.9613 38.0 32.2 38.0 17.4 38.0 140-144 32.1846 37.8 31.0 38.0 13.4 38.0 145-149 31.17255 37.6 30.6 38.0 8.4 38.0 150-151 24.769624999999998 32.0 14.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 4.0 15 2.0 16 5.0 17 5.0 18 6.0 19 12.0 20 7.0 21 12.0 22 8.0 23 10.0 24 22.0 25 23.0 26 24.0 27 33.0 28 59.0 29 56.0 30 62.0 31 102.0 32 138.0 33 165.0 34 247.0 35 450.0 36 992.0 37 1554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.00205973223481 16.220391349124615 14.77857878475798 30.998970133882597 2 19.75 22.625 38.35 19.275000000000002 3 16.900000000000002 29.4 29.925 23.775 4 21.45 34.75 24.075 19.725 5 22.475 35.099999999999994 22.8 19.625 6 17.299999999999997 34.35 25.5 22.85 7 13.125 21.099999999999998 45.65 20.125 8 17.974999999999998 20.625 28.775000000000002 32.625 9 18.224999999999998 23.025000000000002 30.15 28.599999999999998 10-14 20.07 29.01 26.41 24.51 15-19 19.705000000000002 28.515 27.11 24.67 20-24 19.744999999999997 28.15 27.625 24.48 25-29 20.175 28.46 27.42 23.945 30-34 19.634999999999998 28.285 28.215 23.865 35-39 20.235 29.075 26.75 23.94 40-44 20.465 28.65 26.75 24.135 45-49 20.544999999999998 28.035 27.705000000000002 23.715 50-54 20.225 27.77 27.935 24.07 55-59 19.895 27.810000000000002 27.71 24.585 60-64 20.235 27.815 27.495000000000005 24.455 65-69 20.560000000000002 27.565 27.625 24.25 70-74 20.39 28.675 27.215 23.72 75-79 20.51 28.410000000000004 27.025 24.055 80-84 20.43 27.92 27.560000000000002 24.09 85-89 20.395 28.084999999999997 27.41 24.11 90-94 20.34 28.084999999999997 27.334999999999997 24.240000000000002 95-99 21.065 27.93 27.185 23.82 100-104 20.044999999999998 27.97 27.905 24.08 105-109 21.025 27.750000000000004 26.919999999999998 24.305 110-114 20.575 27.860000000000003 27.48 24.085 115-119 20.945 27.76 27.605 23.69 120-124 20.945 27.389999999999997 27.515 24.15 125-129 21.01 28.03 27.165 23.794999999999998 130-134 20.915 27.445000000000004 27.250000000000004 24.39 135-139 21.64 27.560000000000002 26.705000000000002 24.095 140-144 21.13 27.650000000000002 27.02 24.2 145-149 21.215 27.16 26.995 24.63 150-151 21.912499999999998 27.625 26.1625 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.5 22 1.5 23 1.5 24 1.5 25 4.5 26 6.5 27 8.0 28 12.0 29 13.5 30 19.5 31 32.0 32 39.5 33 53.5 34 76.5 35 88.5 36 94.5 37 108.0 38 125.5 39 150.0 40 176.5 41 190.5 42 202.5 43 226.5 44 234.5 45 230.0 46 231.0 47 227.0 48 229.0 49 208.5 50 171.0 51 147.5 52 131.0 53 117.5 54 113.0 55 92.0 56 62.5 57 44.5 58 32.5 59 29.0 60 19.5 61 13.0 62 10.5 63 6.0 64 2.5 65 1.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.2 #Duplication Level Percentage of deduplicated Percentage of total 1 97.94238683127571 95.19999999999999 2 1.6718106995884774 3.25 3 0.30864197530864196 0.8999999999999999 4 0.051440329218107 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0257201646090535 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 18 0.44999999999999996 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.6625 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.15 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138-139 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGCCT 10 0.0060887975 150.61038 1 TTTGAGT 10 0.006836113 144.9625 6 GCCTCCA 10 0.006836113 144.9625 4 TGCCTCC 10 0.006836113 144.9625 3 ATTTGAG 10 0.006836113 144.9625 5 GCATTCA 10 0.006836113 144.9625 145 >>END_MODULE SRR7170665 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170665_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50125 33.0 33.0 34.0 31.0 34.0 2 32.65725 33.0 33.0 34.0 32.0 34.0 3 32.64375 33.0 33.0 34.0 32.0 34.0 4 32.63975 33.0 33.0 34.0 32.0 34.0 5 32.594 33.0 33.0 34.0 32.0 34.0 6 36.78375 38.0 38.0 38.0 35.0 38.0 7 36.84525 38.0 38.0 38.0 36.0 38.0 8 36.82425 38.0 38.0 38.0 36.0 38.0 9 36.8185 38.0 38.0 38.0 35.0 38.0 10-14 36.7716 38.0 38.0 38.0 35.4 38.0 15-19 36.66155 38.0 38.0 38.0 35.0 38.0 20-24 36.69205000000001 38.0 38.0 38.0 35.0 38.0 25-29 36.664 38.0 38.0 38.0 35.2 38.0 30-34 36.6431 38.0 38.0 38.0 34.8 38.0 35-39 36.5258 38.0 38.0 38.0 34.6 38.0 40-44 36.57449999999999 38.0 38.0 38.0 34.4 38.0 45-49 36.3767 38.0 38.0 38.0 33.8 38.0 50-54 36.3605 38.0 38.0 38.0 34.0 38.0 55-59 36.3794 38.0 38.0 38.0 34.0 38.0 60-64 36.31975 38.0 38.0 38.0 34.0 38.0 65-69 36.23635 38.0 38.0 38.0 33.8 38.0 70-74 36.22555 38.0 38.0 38.0 33.8 38.0 75-79 36.0952 38.0 38.0 38.0 33.6 38.0 80-84 35.90295 38.0 37.8 38.0 33.0 38.0 85-89 35.82285 38.0 37.2 38.0 32.6 38.0 90-94 35.6543 38.0 37.0 38.0 31.2 38.0 95-99 35.486749999999994 38.0 37.0 38.0 30.0 38.0 100-104 35.3052 38.0 36.4 38.0 29.8 38.0 105-109 35.163 38.0 36.0 38.0 28.8 38.0 110-114 34.92605 38.0 35.8 38.0 27.6 38.0 115-119 34.56675 38.0 35.4 38.0 25.6 38.0 120-124 34.2854 38.0 34.6 38.0 24.2 38.0 125-129 33.85895 38.0 33.4 38.0 22.4 38.0 130-134 33.3604 38.0 33.0 38.0 19.8 38.0 135-139 32.7065 38.0 33.0 38.0 16.4 38.0 140-144 31.778750000000002 38.0 31.4 38.0 13.0 38.0 145-149 30.458199999999998 36.2 28.8 38.0 5.6 38.0 150-151 25.006625 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 3.0 5 0.0 6 1.0 7 2.0 8 1.0 9 3.0 10 3.0 11 6.0 12 5.0 13 2.0 14 6.0 15 8.0 16 6.0 17 11.0 18 10.0 19 10.0 20 8.0 21 17.0 22 16.0 23 13.0 24 17.0 25 21.0 26 36.0 27 35.0 28 48.0 29 55.0 30 63.0 31 88.0 32 112.0 33 154.0 34 219.0 35 366.0 36 809.0 37 1835.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.95 17.150000000000002 13.950000000000001 28.95 2 25.074999999999996 22.650000000000002 34.1 18.175 3 20.200000000000003 27.025 31.5 21.275 4 23.375 35.625 21.675 19.325 5 23.025000000000002 39.025 20.325 17.625 6 19.25 37.75 22.225 20.775 7 17.474999999999998 18.224999999999998 42.05 22.25 8 20.825 21.525 25.75 31.900000000000002 9 22.675 22.400000000000002 28.1 26.825 10-14 23.119999999999997 28.075 26.08 22.725 15-19 23.72 27.500000000000004 27.334999999999997 21.445 20-24 23.555 27.85 27.08 21.515 25-29 23.395 28.310000000000002 26.775 21.52 30-34 23.105 27.775 27.810000000000002 21.310000000000002 35-39 23.369999999999997 27.315 27.815 21.5 40-44 23.845 27.965 26.955000000000002 21.235 45-49 23.285 27.750000000000004 27.939999999999998 21.025 50-54 23.7 26.91 27.250000000000004 22.14 55-59 23.9 27.150000000000002 27.450000000000003 21.5 60-64 23.669999999999998 27.229999999999997 27.295 21.805 65-69 23.595 27.445000000000004 26.979999999999997 21.98 70-74 23.794999999999998 27.950000000000003 26.810000000000002 21.445 75-79 23.380000000000003 27.915 27.189999999999998 21.515 80-84 24.035 27.744999999999997 26.755000000000003 21.465 85-89 23.96 28.165000000000003 27.055 20.82 90-94 23.71 27.87 27.245 21.175 95-99 23.585 28.294999999999998 27.139999999999997 20.979999999999997 100-104 24.55 27.735 26.915 20.8 105-109 23.880000000000003 28.15 26.674999999999997 21.295 110-114 24.065 28.050000000000004 27.215 20.669999999999998 115-119 23.485 28.544999999999998 27.705000000000002 20.265 120-124 24.46 27.975 26.740000000000002 20.825 125-129 24.175 27.87 27.61 20.345 130-134 24.215 27.560000000000002 27.400000000000002 20.825 135-139 24.295 28.26 26.740000000000002 20.705000000000002 140-144 24.305 28.07 26.86 20.765 145-149 24.79 27.889999999999997 26.895000000000003 20.424999999999997 150-151 25.637500000000003 27.3125 26.937499999999996 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.0 25 2.5 26 4.5 27 4.0 28 5.0 29 10.5 30 15.5 31 18.0 32 30.5 33 35.0 34 39.5 35 54.5 36 81.5 37 100.0 38 119.5 39 146.0 40 167.0 41 177.5 42 196.5 43 251.5 44 246.5 45 246.5 46 264.5 47 246.5 48 227.5 49 207.0 50 187.0 51 155.5 52 131.0 53 116.5 54 104.5 55 99.0 56 88.5 57 69.0 58 45.5 59 29.0 60 21.0 61 17.5 62 14.0 63 7.5 64 5.0 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.475 #Duplication Level Percentage of deduplicated Percentage of total 1 97.69370303187355 94.25 2 1.710287639284789 3.3000000000000003 3 0.31096138896087067 0.8999999999999999 4 0.1813941435605079 0.7000000000000001 5 0.051826898160145116 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051826898160145116 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 14 0.35000000000000003 Illumina Single End PCR Primer 1 (96% over 32bp) GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 10 0.25 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit GCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.0875 0.0 0.0 0.0 0.0 126-127 3.225 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.6625 0.0 0.0 0.0 0.0 132-133 3.9 0.0 0.0 0.0 0.0 134-135 4.175000000000001 0.0 0.0 0.0 0.0 136-137 4.45 0.0 0.0 0.0 0.0 138-139 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCTAA 10 0.006830828 145.0 5 CCTAACT 10 0.006830828 145.0 7 TAACTTA 10 0.006830828 145.0 9 CTAACTT 10 0.006830828 145.0 8 AAAGCCC 10 0.006830828 145.0 2 AAGCCCT 10 0.006830828 145.0 3 CCCTAAC 10 0.006830828 145.0 6 GTAGTGA 10 0.006830828 145.0 5 AGCCCTA 10 0.006830828 145.0 4 >>END_MODULE Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521773 spots for SRR7170665.sra Written 521773 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra Read 521764 spots for SRR7170665.sra Written 521764 spots for SRR7170665.sra SRR ids: ['SRR7170665.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_00pzmqgh SRR7170665.sra spots: 10435289 blocks: [[1, 521764], [521765, 1043528], [1043529, 1565292], [1565293, 2087056], [2087057, 2608820], [2608821, 3130584], [3130585, 3652348], [3652349, 4174112], [4174113, 4695876], [4695877, 5217640], [5217641, 5739404], [5739405, 6261168], [6261169, 6782932], [6782933, 7304696], [7304697, 7826460], [7826461, 8348224], [8348225, 8869988], [8869989, 9391752], [9391753, 9913516], [9913517, 10435289]] SRR7170665 file size 3514476 SRR7170665 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170665 SRR7170665_1.fastq SRR7170665_2.fastq Input file: SRR7170665_1.fastq Paired file: SRR7170665_2.fastq trimmed: SRR7170665-trimmed-pair1.fastq, SRR7170665-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:59:05 2025 >> started Thu Feb 13 15:59:16 2025 >> done (11.572s) 10435289 read pairs processed; of these: 17211 ( 0.16%) short read pairs filtered out after trimming by size control 76805 ( 0.74%) empty read pairs filtered out after trimming by size control 10341273 (99.10%) read pairs available; of these: 6381563 (61.71%) trimmed read pairs available after processing 3959710 (38.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 8 0.00% 21 5 0.00% 22 11 0.00% 23 10 0.00% 24 5 0.00% 25 9 0.00% 26 11 0.00% 27 9 0.00% 28 17 0.00% 29 12 0.00% 30 12 0.00% 31 11 0.00% 32 15 0.00% 33 8 0.00% 34 18 0.00% 35 11 0.00% 36 20 0.00% 37 24 0.00% 38 29 0.00% 39 24 0.00% 40 37 0.00% 41 36 0.00% 42 44 0.00% 43 34 0.00% 44 38 0.00% 45 74 0.00% 46 66 0.00% 47 101 0.00% 48 86 0.00% 49 98 0.00% 50 129 0.00% 51 118 0.00% 52 124 0.00% 53 129 0.00% 54 125 0.00% 55 167 0.00% 56 165 0.00% 57 186 0.00% 58 221 0.00% 59 254 0.00% 60 300 0.00% 61 301 0.00% 62 356 0.00% 63 369 0.00% 64 402 0.00% 65 437 0.00% 66 452 0.00% 67 516 0.00% 68 562 0.01% 69 630 0.01% 70 674 0.01% 71 792 0.01% 72 964 0.01% 73 1117 0.01% 74 1159 0.01% 75 1463 0.01% 76 1878 0.02% 77 2020 0.02% 78 1732 0.02% 79 2041 0.02% 80 1924 0.02% 81 2219 0.02% 82 2607 0.03% 83 3088 0.03% 84 4214 0.04% 85 4676 0.05% 86 4846 0.05% 87 4864 0.05% 88 5052 0.05% 89 5127 0.05% 90 5675 0.05% 91 5765 0.06% 92 6107 0.06% 93 6742 0.07% 94 6726 0.07% 95 7220 0.07% 96 7773 0.08% 97 7645 0.07% 98 8055 0.08% 99 8352 0.08% 100 8439 0.08% 101 9160 0.09% 102 9711 0.09% 103 10798 0.10% 104 10865 0.11% 105 11588 0.11% 106 12037 0.12% 107 11855 0.11% 108 12332 0.12% 109 13004 0.13% 110 13071 0.13% 111 13677 0.13% 112 14303 0.14% 113 16144 0.16% 114 15955 0.15% 115 15929 0.15% 116 16539 0.16% 117 17190 0.17% 118 17962 0.17% 119 18200 0.18% 120 19373 0.19% 121 19700 0.19% 122 20514 0.20% 123 21931 0.21% 124 22760 0.22% 125 24313 0.24% 126 25292 0.24% 127 26055 0.25% 128 27592 0.27% 129 29122 0.28% 130 30810 0.30% 131 32818 0.32% 132 35363 0.34% 133 38380 0.37% 134 41106 0.40% 135 45250 0.44% 136 49498 0.48% 137 54467 0.53% 138 59164 0.57% 139 65674 0.64% 140 73911 0.71% 141 84719 0.82% 142 95101 0.92% 143 112364 1.09% 144 132812 1.28% 145 161619 1.56% 146 209013 2.02% 147 282260 2.73% 148 435277 4.21% 149 833865 8.06% 150 2873316 27.78% 151 3959710 38.29% 10341273 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.69 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=213.10 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=11.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=14 prefix-density=0.72 prefix-fanout=2.8 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=46.54 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170665 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:00:10 Started mapping on | Feb 13 16:00:10 Finished on | Feb 13 16:03:45 Mapping speed, Million of reads per hour | 173.16 Number of input reads | 10341273 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 8324393 Uniquely mapped reads % | 80.50% Average mapped length | 293.34 Number of splices: Total | 7998215 Number of splices: Annotated (sjdb) | 7874229 Number of splices: GT/AG | 7858386 Number of splices: GC/AG | 115475 Number of splices: AT/AC | 4600 Number of splices: Non-canonical | 19754 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238384 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 103274 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.92% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1790808 1790808 1790808 N_multimapping 238384 238384 238384 N_noFeature 247228 8157476 288889 N_ambiguous 180995 581 55368 UnstrandedReadsAssigned:7896170 PositiveStrandReadsAssigned:166336 NegativeStrandReadsAssigned:7980136 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170665 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170665-trimmed-pair1.fastq SRR7170665-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,341,273 reads, 8,015,532 reads pseudoaligned [quant] estimated average fragment length: 271.971 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7170665.ke.tsv 34699 SRR7170665.se.tsv 87100 total ==> SRR7170665.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.03 358 19.0853 Potri.005G024800.1.v4.1 1035 764.029 235 28.6467 Potri.004G059700.1.v4.1 961 690.081 7 0.944745 Potri.007G009000.2.v4.1 1416 1145.03 0 0 Potri.003G141000.2.v4.1 2943 2672.03 372.693 12.9905 Potri.016G087400.1.v4.1 270 74.3056 482 604.147 Potri.015G069301.1.v4.1 564 301.208 0 0 Potri.010G195200.1.v4.1 1773 1502.03 27.7583 1.7212 Potri.012G127500.1.v4.1 977 706.053 402 53.0281 ==> SRR7170665.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 448 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR7170665 completed mapping pipeline successfully