Starting /dee2/code/volunteer_pipeline.sh SRR7170666 current disk space = 3088836554752 free memory = 1576951520 SRR7170666 SRAfilesize 3e6fd320aaffa395443e07043aa890a5 SRR7170666.sra SRR7170666.sra file validated SRR7170666 is paired end SRR7170666 is conventional basespace SRR7170666 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170666_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.2855 28.0 18.0 32.0 18.0 33.0 2 31.16275 33.0 30.0 33.0 27.0 33.0 3 31.75125 33.0 31.0 33.0 29.0 33.0 4 32.0935 33.0 33.0 33.0 30.0 34.0 5 32.75325 33.0 33.0 34.0 31.0 34.0 6 36.946 38.0 37.0 38.0 35.0 38.0 7 37.15075 38.0 38.0 38.0 36.0 38.0 8 37.30525 38.0 38.0 38.0 37.0 38.0 9 37.39225 38.0 38.0 38.0 37.0 38.0 10-14 37.37565 38.0 38.0 38.0 37.0 38.0 15-19 37.3532 38.0 38.0 38.0 37.0 38.0 20-24 37.461400000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.47275 38.0 38.0 38.0 37.6 38.0 30-34 37.4785 38.0 38.0 38.0 37.4 38.0 35-39 37.4235 38.0 38.0 38.0 37.0 38.0 40-44 37.39175 38.0 38.0 38.0 37.0 38.0 45-49 37.33495 38.0 38.0 38.0 37.0 38.0 50-54 37.2482 38.0 38.0 38.0 36.8 38.0 55-59 37.12345 38.0 38.0 38.0 36.0 38.0 60-64 37.0552 38.0 38.0 38.0 36.0 38.0 65-69 37.040499999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.945350000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.65305 38.0 38.0 38.0 34.8 38.0 80-84 36.4814 38.0 38.0 38.0 34.2 38.0 85-89 36.3994 38.0 38.0 38.0 34.0 38.0 90-94 36.29709999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.0972 38.0 37.4 38.0 33.4 38.0 100-104 35.95525 38.0 37.0 38.0 33.0 38.0 105-109 35.797200000000004 38.0 37.0 38.0 32.2 38.0 110-114 35.484049999999996 38.0 36.8 38.0 30.6 38.0 115-119 35.351800000000004 38.0 36.0 38.0 30.2 38.0 120-124 35.26950000000001 38.0 36.0 38.0 29.8 38.0 125-129 35.0422 38.0 35.6 38.0 28.0 38.0 130-134 34.7481 38.0 35.0 38.0 27.4 38.0 135-139 34.40085 38.0 35.0 38.0 26.0 38.0 140-144 33.823 38.0 34.2 38.0 22.8 38.0 145-149 32.96319999999999 38.0 33.2 38.0 18.6 38.0 150-151 27.849625 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 2.0 17 3.0 18 11.0 19 22.0 20 4.0 21 8.0 22 3.0 23 7.0 24 8.0 25 12.0 26 16.0 27 15.0 28 26.0 29 33.0 30 42.0 31 61.0 32 93.0 33 107.0 34 194.0 35 358.0 36 918.0 37 2053.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.55558382091071 17.196642075807684 14.347494276265582 31.900279827016025 2 18.975 25.624999999999996 38.25 17.150000000000002 3 15.6 32.7 29.599999999999998 22.1 4 20.0 37.475 22.525000000000002 20.0 5 20.080120180270406 37.20580871306961 24.13620430645969 18.5778668002003 6 15.525 36.7 25.900000000000002 21.875 7 11.825 21.025 46.625 20.525 8 16.6 24.2 28.7 30.5 9 17.224999999999998 22.7 31.15 28.925 10-14 18.665000000000003 31.65 26.58 23.105 15-19 19.225 30.064999999999998 27.985 22.725 20-24 19.24 30.435000000000002 26.82 23.505000000000003 25-29 18.965 30.97 26.93 23.135 30-34 19.21 30.505 27.525 22.759999999999998 35-39 19.115 30.8 27.175 22.91 40-44 18.905 30.945 26.919999999999998 23.23 45-49 19.345000000000002 30.575000000000003 27.02 23.06 50-54 19.28 29.875 27.73 23.115 55-59 19.55 29.775000000000002 27.605 23.07 60-64 19.155 29.970000000000002 27.265 23.61 65-69 19.265 30.205 26.784999999999997 23.745 70-74 18.895 30.15 27.21 23.745 75-79 18.985 30.03 27.47 23.515 80-84 19.085 29.415000000000003 27.060000000000002 24.44 85-89 19.89 29.775000000000002 26.995 23.34 90-94 19.495 29.37 27.425 23.71 95-99 20.155 29.270000000000003 27.084999999999997 23.49 100-104 19.71 29.5 27.005000000000003 23.785 105-109 20.26 28.985 27.12 23.635 110-114 19.955000000000002 28.884999999999998 27.245 23.915 115-119 20.349999999999998 29.580000000000002 26.97 23.1 120-124 20.07 28.87 27.425 23.635 125-129 20.135 28.505000000000003 27.35 24.01 130-134 20.380000000000003 29.095 26.009999999999998 24.515 135-139 20.505000000000003 28.384999999999998 27.389999999999997 23.72 140-144 20.810000000000002 27.889999999999997 27.305 23.995 145-149 19.88 28.945 26.924999999999997 24.25 150-151 20.80260032504063 29.16614576822103 25.99074884360545 24.04050506313289 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 5.0 24 7.0 25 8.5 26 13.0 27 19.0 28 26.0 29 34.5 30 45.0 31 56.0 32 70.0 33 84.5 34 107.0 35 136.5 36 153.5 37 161.5 38 173.5 39 181.5 40 186.5 41 199.0 42 201.0 43 205.5 44 201.5 45 195.0 46 196.5 47 195.0 48 181.0 49 155.0 50 152.0 51 124.5 52 98.0 53 94.5 54 79.0 55 66.0 56 47.0 57 33.0 58 29.0 59 26.0 60 18.0 61 10.0 62 8.5 63 4.0 64 0.5 65 0.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.06850373422611 95.19999999999999 2 1.6224568632500644 3.15 3 0.1545197012619109 0.44999999999999996 4 0.05150656708730364 0.2 5 0.05150656708730364 0.25 6 0.0 0.0 7 0.02575328354365182 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02575328354365182 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 23 0.575 TruSeq Adapter, Index 13 (97% over 38bp) CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 7 0.17500000000000002 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.7375 0.0 0.0 0.0 0.0 124-125 5.2125 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.8375 0.0 0.0 0.0 0.0 130-131 6.3375 0.0 0.0 0.0 0.0 132-133 6.675 0.0 0.0 0.0 0.0 134-135 7.0 0.0 0.0 0.0 0.0 136-137 7.425000000000001 0.0 0.0 0.0 0.0 138-139 7.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTAAAA 10 0.006577216 146.82278 1 >>END_MODULE SRR7170666 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170666_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.759 33.0 33.0 34.0 32.0 34.0 2 32.89475 33.0 33.0 34.0 32.0 34.0 3 32.92525 34.0 33.0 34.0 32.0 34.0 4 32.89225 34.0 33.0 34.0 32.0 34.0 5 32.95275 34.0 33.0 34.0 32.0 34.0 6 37.14875 38.0 38.0 38.0 37.0 38.0 7 37.09725 38.0 38.0 38.0 37.0 38.0 8 37.14275 38.0 38.0 38.0 37.0 38.0 9 37.13875 38.0 38.0 38.0 37.0 38.0 10-14 37.11825 38.0 38.0 38.0 37.0 38.0 15-19 37.099650000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.0479 38.0 38.0 38.0 37.0 38.0 25-29 36.9933 38.0 38.0 38.0 37.0 38.0 30-34 36.964349999999996 38.0 38.0 38.0 36.8 38.0 35-39 37.021249999999995 38.0 38.0 38.0 37.0 38.0 40-44 36.976350000000004 38.0 38.0 38.0 37.0 38.0 45-49 36.939499999999995 38.0 38.0 38.0 36.6 38.0 50-54 36.8513 38.0 38.0 38.0 36.0 38.0 55-59 36.791900000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.774950000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.76795 38.0 38.0 38.0 36.0 38.0 70-74 36.6944 38.0 38.0 38.0 36.0 38.0 75-79 36.7188 38.0 38.0 38.0 36.0 38.0 80-84 36.40225 38.0 38.0 38.0 35.2 38.0 85-89 36.307050000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.2536 38.0 38.0 38.0 34.4 38.0 95-99 36.1474 38.0 38.0 38.0 34.2 38.0 100-104 36.03715 38.0 38.0 38.0 34.0 38.0 105-109 35.94525 38.0 38.0 38.0 33.8 38.0 110-114 35.74525 38.0 37.6 38.0 33.0 38.0 115-119 35.29559999999999 38.0 36.8 38.0 30.0 38.0 120-124 35.350950000000005 38.0 37.0 38.0 31.0 38.0 125-129 35.14725 38.0 36.2 38.0 30.2 38.0 130-134 34.716899999999995 38.0 36.0 38.0 28.0 38.0 135-139 34.45815 38.0 35.6 38.0 27.2 38.0 140-144 33.80315 38.0 33.4 38.0 22.4 38.0 145-149 32.94015 38.0 33.0 38.0 15.0 38.0 150-151 27.431625 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 14.0 4 1.0 5 3.0 6 2.0 7 3.0 8 2.0 9 0.0 10 2.0 11 2.0 12 2.0 13 2.0 14 1.0 15 3.0 16 7.0 17 6.0 18 10.0 19 13.0 20 12.0 21 3.0 22 7.0 23 8.0 24 11.0 25 19.0 26 21.0 27 14.0 28 22.0 29 33.0 30 35.0 31 41.0 32 61.0 33 87.0 34 126.0 35 235.0 36 648.0 37 2534.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.65 15.85 15.0 28.499999999999996 2 24.625 23.075000000000003 35.0 17.299999999999997 3 21.125 25.474999999999998 33.85 19.55 4 25.074999999999996 33.324999999999996 21.275 20.325 5 25.6 36.199999999999996 20.45 17.75 6 18.05902951475738 37.74387193596798 23.6368184092046 20.560280140070038 7 18.48424212106053 17.883941970985493 41.84592296148074 21.785892946473236 8 21.010505252626313 22.0360180090045 27.538769384692348 29.41470735367684 9 23.88694347173587 23.111555777888945 27.41370685342671 25.587793896948476 10-14 23.34667333666833 28.574287143571787 26.923461730865434 21.155577788894448 15-19 23.29664832416208 26.848424212106053 28.479239619809903 21.375687843921963 20-24 23.771885942971487 28.46423211605803 27.55877938969485 20.20510255127564 25-29 23.52176088044022 28.059029514757377 27.428714357178592 20.990495247623812 30-34 23.261630815407706 28.049024512256125 28.039019509754876 20.65032516258129 35-39 23.896948474237117 27.378689344672335 28.14407203601801 20.580290145072535 40-44 23.946973486743374 27.963981990995496 27.573786893446723 20.515257628814407 45-49 23.74687343671836 27.743871935967984 28.039019509754876 20.47023511755878 50-54 23.271635817908955 27.378689344672335 28.249124562281143 21.100550275137568 55-59 24.242121060530263 27.573786893446723 27.138569284642323 21.045522761380692 60-64 23.36168084042021 27.34367183591796 28.059029514757377 21.235617808904454 65-69 23.856928464232116 27.048524262131064 27.988994497248626 21.105552776388194 70-74 23.57825238833592 28.114840194067924 27.374581103386188 20.932326314209973 75-79 23.864545818327333 27.546018407362943 27.951180472188874 20.638255302120847 80-84 23.982194658397518 28.47854356306892 27.598279483845158 19.940982294688407 85-89 24.094637855142057 28.0062024809924 28.00120048019208 19.897959183673468 90-94 23.448206872405343 27.674686140149053 28.830090531686093 20.04701645575952 95-99 23.568535280292043 27.519127869180377 28.484272640896137 20.428064209631444 100-104 23.744748949789958 27.680536107221442 28.385677135427084 20.189037807561512 105-109 24.035816117252764 28.167675453954278 28.26271822320044 19.533790205592517 110-114 24.183300815448497 28.10045525038771 27.81529841412777 19.90094552003602 115-119 23.90695347673837 28.61930965482741 27.523761880940473 19.949974987493746 120-124 24.491020959431744 27.992596668500823 27.817517883047373 19.69886448902006 125-129 24.004601840736296 27.67607042817127 28.51640656262505 19.802921168467385 130-134 24.674869947979193 27.66106442577031 28.13625450180072 19.52781112444978 135-139 24.7623811905953 27.923961980990498 28.034017008504254 19.279639819909956 140-144 25.227613806903452 28.099049524762382 28.054027013506754 18.619309654827415 145-149 25.14251425142514 28.03780378037804 28.092809280928094 18.726872687268727 150-151 25.650000000000002 27.8125 27.775 18.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 3.0 20 3.0 21 1.0 22 1.5 23 2.0 24 1.0 25 2.5 26 6.0 27 4.5 28 6.5 29 15.0 30 17.5 31 23.0 32 26.0 33 35.5 34 57.5 35 76.5 36 91.5 37 105.5 38 135.0 39 163.0 40 181.0 41 202.0 42 215.0 43 238.5 44 243.5 45 240.5 46 234.5 47 232.0 48 238.5 49 209.0 50 178.0 51 151.5 52 131.0 53 111.0 54 100.5 55 89.5 56 68.0 57 54.5 58 34.5 59 26.5 60 19.0 61 7.0 62 4.5 63 1.0 64 1.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.05 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.034999999999999996 75-79 0.04 80-84 0.03 85-89 0.04 90-94 0.034999999999999996 95-99 0.015 100-104 0.02 105-109 0.045 110-114 0.055 115-119 0.05 120-124 0.045 125-129 0.04 130-134 0.04 135-139 0.05 140-144 0.05 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.22348094747683 95.375 2 1.3388259526261586 2.6 3 0.28321318228630277 0.8250000000000001 4 0.10298661174047373 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025746652935118432 0.2 9 0.0 0.0 >10 0.025746652935118432 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 24 0.6 Illumina Single End PCR Primer 1 (96% over 32bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.425 0.0 0.0 0.0 0.0 122-123 4.7375 0.0 0.0 0.0 0.0 124-125 5.2 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.825 0.0 0.0 0.0 0.0 130-131 6.300000000000001 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.3875 0.0 0.0 0.0 0.0 138-139 7.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGTT 10 0.006830828 145.0 1 >>END_MODULE Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra Read 574903 spots for SRR7170666.sra Written 574903 spots for SRR7170666.sra Read 574899 spots for SRR7170666.sra Written 574899 spots for SRR7170666.sra SRR ids: ['SRR7170666.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kt_23cbk SRR7170666.sra spots: 11497984 blocks: [[1, 574899], [574900, 1149798], [1149799, 1724697], [1724698, 2299596], [2299597, 2874495], [2874496, 3449394], [3449395, 4024293], [4024294, 4599192], [4599193, 5174091], [5174092, 5748990], [5748991, 6323889], [6323890, 6898788], [6898789, 7473687], [7473688, 8048586], [8048587, 8623485], [8623486, 9198384], [9198385, 9773283], [9773284, 10348182], [10348183, 10923081], [10923082, 11497984]] SRR7170666 file size 3874589 SRR7170666 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170666 SRR7170666_1.fastq SRR7170666_2.fastq Input file: SRR7170666_1.fastq Paired file: SRR7170666_2.fastq trimmed: SRR7170666-trimmed-pair1.fastq, SRR7170666-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:03:08 2025 >> started Thu Feb 13 16:03:21 2025 >> done (12.359s) 11497984 read pairs processed; of these: 10334 ( 0.09%) short read pairs filtered out after trimming by size control 72388 ( 0.63%) empty read pairs filtered out after trimming by size control 11415262 (99.28%) read pairs available; of these: 6015497 (52.70%) trimmed read pairs available after processing 5399765 (47.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 9 0.00% 22 7 0.00% 23 7 0.00% 24 12 0.00% 25 7 0.00% 26 19 0.00% 27 20 0.00% 28 10 0.00% 29 12 0.00% 30 18 0.00% 31 83 0.00% 32 8 0.00% 33 18 0.00% 34 18 0.00% 35 13 0.00% 36 24 0.00% 37 26 0.00% 38 35 0.00% 39 29 0.00% 40 29 0.00% 41 34 0.00% 42 47 0.00% 43 40 0.00% 44 43 0.00% 45 47 0.00% 46 88 0.00% 47 101 0.00% 48 108 0.00% 49 107 0.00% 50 131 0.00% 51 145 0.00% 52 160 0.00% 53 186 0.00% 54 189 0.00% 55 231 0.00% 56 207 0.00% 57 255 0.00% 58 304 0.00% 59 323 0.00% 60 387 0.00% 61 446 0.00% 62 468 0.00% 63 522 0.00% 64 630 0.01% 65 630 0.01% 66 684 0.01% 67 688 0.01% 68 775 0.01% 69 923 0.01% 70 1048 0.01% 71 1222 0.01% 72 1446 0.01% 73 1531 0.01% 74 1895 0.02% 75 2094 0.02% 76 2877 0.03% 77 3257 0.03% 78 2708 0.02% 79 3066 0.03% 80 3067 0.03% 81 3525 0.03% 82 3956 0.03% 83 4598 0.04% 84 5764 0.05% 85 6226 0.05% 86 6608 0.06% 87 6826 0.06% 88 7138 0.06% 89 7535 0.07% 90 8056 0.07% 91 8646 0.08% 92 9282 0.08% 93 10178 0.09% 94 10555 0.09% 95 11098 0.10% 96 11839 0.10% 97 11886 0.10% 98 12184 0.11% 99 12822 0.11% 100 13518 0.12% 101 14343 0.13% 102 15246 0.13% 103 16265 0.14% 104 16907 0.15% 105 17807 0.16% 106 18565 0.16% 107 18288 0.16% 108 18497 0.16% 109 19591 0.17% 110 19626 0.17% 111 20306 0.18% 112 21782 0.19% 113 23355 0.20% 114 24133 0.21% 115 24263 0.21% 116 25344 0.22% 117 25239 0.22% 118 25739 0.23% 119 25902 0.23% 120 26717 0.23% 121 27220 0.24% 122 28091 0.25% 123 29623 0.26% 124 31016 0.27% 125 31082 0.27% 126 32468 0.28% 127 32880 0.29% 128 33727 0.30% 129 34903 0.31% 130 35662 0.31% 131 36726 0.32% 132 38247 0.34% 133 40304 0.35% 134 42216 0.37% 135 44668 0.39% 136 47046 0.41% 137 49690 0.44% 138 52650 0.46% 139 55945 0.49% 140 59415 0.52% 141 65773 0.58% 142 73626 0.64% 143 83851 0.73% 144 95479 0.84% 145 116902 1.02% 146 146838 1.29% 147 207334 1.82% 148 311036 2.72% 149 608504 5.33% 150 2898890 25.39% 151 5399765 47.30% 11415262 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=6.80 fanout-score-rank=14 prefix-density=0.48 prefix-fanout=4.0 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=37 fanout-score=61.95 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.5 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=33 prefix-density=0.62 prefix-fanout=2.0 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=23.91 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7170666 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:04:06 Started mapping on | Feb 13 16:04:06 Finished on | Feb 13 16:05:54 Mapping speed, Million of reads per hour | 380.51 Number of input reads | 11415262 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10350735 Uniquely mapped reads % | 90.67% Average mapped length | 292.24 Number of splices: Total | 8458240 Number of splices: Annotated (sjdb) | 8260717 Number of splices: GT/AG | 8287424 Number of splices: GC/AG | 132435 Number of splices: AT/AC | 7362 Number of splices: Non-canonical | 31019 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290064 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 18669 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.53% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 785260 785260 785260 N_multimapping 290064 290064 290064 N_noFeature 296279 10044557 352675 N_ambiguous 340828 973 90808 UnstrandedReadsAssigned:9713628 PositiveStrandReadsAssigned:305205 NegativeStrandReadsAssigned:9907252 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170666 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170666-trimmed-pair1.fastq SRR7170666-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,415,262 reads, 9,846,911 reads pseudoaligned [quant] estimated average fragment length: 237.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7170666.ke.tsv 34699 SRR7170666.se.tsv 87100 total ==> SRR7170666.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.63 280 10.8748 Potri.005G024800.1.v4.1 1035 798.63 186 16.1157 Potri.004G059700.1.v4.1 961 724.634 5 0.477456 Potri.007G009000.2.v4.1 1416 1179.63 0 0 Potri.003G141000.2.v4.1 2943 2706.63 493 12.6038 Potri.016G087400.1.v4.1 270 81.993 697 588.218 Potri.015G069301.1.v4.1 564 330.895 0 0 Potri.010G195200.1.v4.1 1773 1536.63 105 4.72827 Potri.012G127500.1.v4.1 977 740.63 74 6.91374 ==> SRR7170666.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 530 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 60 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 13 SRR7170666 completed mapping pipeline successfully