Starting /dee2/code/volunteer_pipeline.sh SRR7170667 current disk space = 3088803168256 free memory = 1487532060 SRR7170667 SRAfilesize d261d1f353dba82e3b7203d69cb42f16 SRR7170667.sra SRR7170667.sra file validated SRR7170667 is paired end SRR7170667 is conventional basespace SRR7170667 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170667_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.48725 25.0 18.0 32.0 18.0 33.0 2 24.772 25.0 18.0 29.0 18.0 31.0 3 29.12825 30.0 27.0 31.0 25.0 33.0 4 32.07425 33.0 32.0 33.0 32.0 33.0 5 32.4565 33.0 33.0 33.0 32.0 33.0 6 36.409 38.0 37.0 38.0 34.0 38.0 7 36.8485 38.0 37.0 38.0 35.0 38.0 8 37.219 38.0 38.0 38.0 36.0 38.0 9 37.2875 38.0 38.0 38.0 36.0 38.0 10-14 37.28725 38.0 38.0 38.0 36.6 38.0 15-19 37.3391 38.0 38.0 38.0 37.0 38.0 20-24 37.504200000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.5515 38.0 38.0 38.0 38.0 38.0 30-34 37.49395 38.0 38.0 38.0 37.8 38.0 35-39 37.529199999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.46445 38.0 38.0 38.0 37.2 38.0 45-49 37.451049999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.360800000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.274300000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.22425 38.0 38.0 38.0 36.4 38.0 65-69 37.13555 38.0 38.0 38.0 36.0 38.0 70-74 37.1265 38.0 38.0 38.0 36.0 38.0 75-79 37.05355 38.0 38.0 38.0 35.8 38.0 80-84 36.93965 38.0 38.0 38.0 35.6 38.0 85-89 36.85365 38.0 38.0 38.0 35.0 38.0 90-94 36.77575 38.0 38.0 38.0 34.8 38.0 95-99 36.632999999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.4175 38.0 37.6 38.0 34.0 38.0 105-109 36.27005 38.0 37.0 38.0 33.8 38.0 110-114 36.094849999999994 38.0 37.0 38.0 33.2 38.0 115-119 35.7889 38.0 36.4 38.0 31.4 38.0 120-124 35.617900000000006 38.0 36.0 38.0 31.0 38.0 125-129 35.55945 38.0 36.0 38.0 31.0 38.0 130-134 35.3247 38.0 35.6 38.0 29.8 38.0 135-139 34.78465 38.0 34.6 38.0 27.6 38.0 140-144 33.90295 38.0 33.8 38.0 22.8 38.0 145-149 33.48465 38.0 33.0 38.0 22.6 38.0 150-151 28.844749999999998 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 3.0 20 3.0 21 3.0 22 2.0 23 5.0 24 8.0 25 8.0 26 13.0 27 18.0 28 27.0 29 23.0 30 33.0 31 56.0 32 75.0 33 111.0 34 203.0 35 388.0 36 1039.0 37 1977.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.41755454084221 17.402333840690005 11.39015728056824 33.789954337899545 2 19.6 24.6 36.7 19.1 3 16.075 30.175 28.849999999999998 24.9 4 19.950000000000003 37.525 22.375 20.150000000000002 5 20.75 36.575 23.400000000000002 19.275000000000002 6 15.925 36.5 24.2 23.375 7 11.600000000000001 19.3 48.1 21.0 8 17.375 20.45 27.975 34.2 9 17.349999999999998 21.925 31.3 29.425 10-14 19.77 28.96 26.665 24.605 15-19 19.744999999999997 28.315 27.63 24.310000000000002 20-24 19.63 28.815 27.529999999999998 24.025 25-29 19.655 28.99 27.62 23.735 30-34 19.384999999999998 28.835 28.035 23.745 35-39 19.905 28.634999999999998 28.04 23.419999999999998 40-44 19.744999999999997 28.99 27.46 23.805 45-49 19.855 28.46 27.965 23.72 50-54 19.625 28.535 27.87 23.97 55-59 19.765 28.999999999999996 27.61 23.625 60-64 19.8 28.675 27.92 23.605 65-69 20.175 28.28 27.74 23.805 70-74 20.1 28.555000000000003 27.884999999999998 23.46 75-79 20.185 28.18 27.495000000000005 24.14 80-84 20.255000000000003 28.939999999999998 27.084999999999997 23.72 85-89 19.869999999999997 28.58 28.139999999999997 23.41 90-94 20.075000000000003 28.53 27.63 23.765 95-99 19.825 27.965 28.144999999999996 24.065 100-104 20.150000000000002 28.384999999999998 27.955000000000002 23.51 105-109 20.349999999999998 28.42 27.744999999999997 23.485 110-114 20.27 28.115000000000002 28.165000000000003 23.45 115-119 20.275000000000002 28.194999999999997 28.035 23.494999999999997 120-124 20.76 28.075 27.595 23.57 125-129 20.175 28.425 27.6 23.799999999999997 130-134 20.72 28.27 26.740000000000002 24.27 135-139 20.580000000000002 27.91 27.97 23.54 140-144 20.599999999999998 27.985 27.589999999999996 23.825 145-149 20.424999999999997 28.685 27.29 23.599999999999998 150-151 20.8 28.8875 26.625 23.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.5 23 3.5 24 3.5 25 4.5 26 8.5 27 12.5 28 14.0 29 18.5 30 24.0 31 29.0 32 37.0 33 44.5 34 58.0 35 72.5 36 86.5 37 110.0 38 130.5 39 164.5 40 196.0 41 223.0 42 257.0 43 246.5 44 255.5 45 275.0 46 257.5 47 255.0 48 240.0 49 204.5 50 176.0 51 136.5 52 103.0 53 85.5 54 73.5 55 61.5 56 42.0 57 24.5 58 15.5 59 15.5 60 12.0 61 7.5 62 5.5 63 3.5 64 0.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.925 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.7249999999999996 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCTG 10 0.006830828 145.0 7 AAAAAAA 30 0.0014437955 24.166668 15-19 >>END_MODULE SRR7170667 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170667_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82675 33.0 33.0 34.0 32.0 34.0 2 32.98875 34.0 33.0 34.0 32.0 34.0 3 33.02625 34.0 33.0 34.0 32.0 34.0 4 32.94 34.0 33.0 34.0 32.0 34.0 5 32.954 34.0 33.0 34.0 32.0 34.0 6 37.26325 38.0 38.0 38.0 37.0 38.0 7 37.25525 38.0 38.0 38.0 37.0 38.0 8 37.2805 38.0 38.0 38.0 37.0 38.0 9 37.1825 38.0 38.0 38.0 37.0 38.0 10-14 37.21825 38.0 38.0 38.0 37.0 38.0 15-19 37.22189999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.12615 38.0 38.0 38.0 37.0 38.0 25-29 37.05 38.0 38.0 38.0 36.6 38.0 30-34 37.064499999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.055150000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.069849999999995 38.0 38.0 38.0 36.6 38.0 45-49 37.027 38.0 38.0 38.0 36.0 38.0 50-54 36.95115 38.0 38.0 38.0 36.0 38.0 55-59 36.90175 38.0 38.0 38.0 36.0 38.0 60-64 36.84755 38.0 38.0 38.0 36.0 38.0 65-69 36.771699999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.731 38.0 38.0 38.0 35.4 38.0 75-79 36.621449999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.6559 38.0 38.0 38.0 35.0 38.0 85-89 36.540400000000005 38.0 38.0 38.0 34.8 38.0 90-94 36.446400000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.2262 38.0 38.0 38.0 34.0 38.0 100-104 36.08925 38.0 37.8 38.0 33.4 38.0 105-109 36.0266 38.0 37.8 38.0 33.4 38.0 110-114 35.8155 38.0 37.0 38.0 32.6 38.0 115-119 35.572449999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.46375 38.0 36.2 38.0 30.6 38.0 125-129 35.154250000000005 38.0 36.0 38.0 29.6 38.0 130-134 34.6502 38.0 35.2 38.0 27.4 38.0 135-139 34.24665 38.0 33.6 38.0 25.6 38.0 140-144 33.5771 38.0 33.0 38.0 21.6 38.0 145-149 32.295700000000004 38.0 33.0 38.0 10.8 38.0 150-151 26.996375 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 3.0 6 3.0 7 1.0 8 1.0 9 2.0 10 1.0 11 0.0 12 3.0 13 1.0 14 3.0 15 6.0 16 4.0 17 4.0 18 6.0 19 4.0 20 5.0 21 4.0 22 12.0 23 14.0 24 13.0 25 10.0 26 19.0 27 23.0 28 36.0 29 38.0 30 51.0 31 54.0 32 72.0 33 94.0 34 167.0 35 257.0 36 728.0 37 2354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.400000000000006 16.125 13.950000000000001 29.525000000000002 2 24.975 22.7 35.825 16.5 3 19.2 26.474999999999998 31.900000000000002 22.425 4 23.175 36.225 22.15 18.45 5 22.675 37.075 21.625 18.625 6 17.625 37.85 23.25 21.275 7 17.299999999999997 16.375 44.824999999999996 21.5 8 18.45 21.349999999999998 28.15 32.05 9 21.125 22.650000000000002 29.75 26.474999999999998 10-14 22.325 28.65 27.345000000000002 21.68 15-19 22.665 27.195000000000004 28.53 21.61 20-24 22.37 28.22 28.04 21.37 25-29 22.17 28.675 27.79 21.365000000000002 30-34 22.770000000000003 28.665000000000003 27.944999999999997 20.62 35-39 22.93 27.67 28.455000000000002 20.945 40-44 23.165 28.365000000000002 28.044999999999998 20.424999999999997 45-49 22.775000000000002 28.27 27.97 20.985 50-54 23.044999999999998 27.73 28.315 20.91 55-59 22.99 27.860000000000003 27.675 21.475 60-64 22.919999999999998 27.894999999999996 28.375 20.810000000000002 65-69 22.865 28.389999999999997 27.6 21.145 70-74 22.634999999999998 28.084999999999997 27.71 21.57 75-79 22.965 27.950000000000003 28.194999999999997 20.89 80-84 23.01 27.555000000000003 28.595 20.84 85-89 23.135 27.735 28.515 20.615 90-94 23.365 27.765 28.000000000000004 20.87 95-99 23.425 27.155 28.095 21.325 100-104 23.29 28.08 27.644999999999996 20.985 105-109 23.23 27.51 28.27 20.990000000000002 110-114 23.385 27.779999999999998 27.93 20.905 115-119 23.075000000000003 28.26 28.04 20.625 120-124 23.875 28.115000000000002 27.779999999999998 20.23 125-129 23.515 29.235 27.045 20.205000000000002 130-134 23.98 28.044999999999998 27.900000000000002 20.075000000000003 135-139 23.84 28.125 28.025 20.01 140-144 24.115000000000002 28.53 27.49 19.865 145-149 24.33 27.97 27.560000000000002 20.14 150-151 24.337500000000002 27.325 28.475 19.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 4.0 24 4.0 25 2.5 26 5.5 27 8.5 28 7.5 29 8.0 30 15.5 31 22.0 32 27.5 33 35.0 34 52.5 35 70.5 36 73.5 37 106.0 38 139.0 39 163.5 40 200.0 41 225.0 42 249.5 43 263.0 44 275.0 45 280.0 46 275.5 47 260.5 48 236.5 49 196.5 50 158.5 51 139.5 52 107.5 53 79.5 54 66.5 55 60.5 56 51.0 57 39.5 58 28.5 59 20.5 60 14.5 61 6.5 62 3.0 63 4.0 64 3.5 65 1.0 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3375000000000004 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.7750000000000004 0.0 0.0 0.0 0.0 130-131 2.925 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.275 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAACG 10 0.006830828 145.0 2 AAGATCT 10 0.006830828 145.0 3 CGGCAAC 10 0.006830828 145.0 1 >>END_MODULE Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734836 spots for SRR7170667.sra Written 734836 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra Read 734830 spots for SRR7170667.sra Written 734830 spots for SRR7170667.sra SRR ids: ['SRR7170667.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ysm3siz SRR7170667.sra spots: 14696606 blocks: [[1, 734830], [734831, 1469660], [1469661, 2204490], [2204491, 2939320], [2939321, 3674150], [3674151, 4408980], [4408981, 5143810], [5143811, 5878640], [5878641, 6613470], [6613471, 7348300], [7348301, 8083130], [8083131, 8817960], [8817961, 9552790], [9552791, 10287620], [10287621, 11022450], [11022451, 11757280], [11757281, 12492110], [12492111, 13226940], [13226941, 13961770], [13961771, 14696606]] SRR7170667 file size 4958497 SRR7170667 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170667 SRR7170667_1.fastq SRR7170667_2.fastq Input file: SRR7170667_1.fastq Paired file: SRR7170667_2.fastq trimmed: SRR7170667-trimmed-pair1.fastq, SRR7170667-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:40:37 2025 >> started Thu Feb 13 15:40:54 2025 >> done (16.703s) 14696606 read pairs processed; of these: 12022 ( 0.08%) short read pairs filtered out after trimming by size control 15045 ( 0.10%) empty read pairs filtered out after trimming by size control 14669539 (99.82%) read pairs available; of these: 7851974 (53.53%) trimmed read pairs available after processing 6817565 (46.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 5 0.00% 21 5 0.00% 22 12 0.00% 23 10 0.00% 24 16 0.00% 25 6 0.00% 26 10 0.00% 27 7 0.00% 28 13 0.00% 29 10 0.00% 30 9 0.00% 31 6 0.00% 32 10 0.00% 33 11 0.00% 34 8 0.00% 35 14 0.00% 36 15 0.00% 37 8 0.00% 38 14 0.00% 39 11 0.00% 40 19 0.00% 41 25 0.00% 42 30 0.00% 43 18 0.00% 44 33 0.00% 45 34 0.00% 46 37 0.00% 47 52 0.00% 48 40 0.00% 49 51 0.00% 50 67 0.00% 51 79 0.00% 52 82 0.00% 53 79 0.00% 54 98 0.00% 55 66 0.00% 56 95 0.00% 57 120 0.00% 58 147 0.00% 59 142 0.00% 60 187 0.00% 61 218 0.00% 62 236 0.00% 63 264 0.00% 64 246 0.00% 65 278 0.00% 66 312 0.00% 67 372 0.00% 68 421 0.00% 69 481 0.00% 70 535 0.00% 71 640 0.00% 72 700 0.00% 73 747 0.01% 74 854 0.01% 75 926 0.01% 76 1093 0.01% 77 1227 0.01% 78 1221 0.01% 79 1327 0.01% 80 1514 0.01% 81 1704 0.01% 82 2121 0.01% 83 2265 0.02% 84 2990 0.02% 85 3505 0.02% 86 3761 0.03% 87 3972 0.03% 88 4167 0.03% 89 4449 0.03% 90 4785 0.03% 91 4978 0.03% 92 5343 0.04% 93 5618 0.04% 94 5973 0.04% 95 6332 0.04% 96 6590 0.04% 97 7130 0.05% 98 7403 0.05% 99 7908 0.05% 100 8186 0.06% 101 8553 0.06% 102 9163 0.06% 103 9590 0.07% 104 10272 0.07% 105 10739 0.07% 106 11355 0.08% 107 11587 0.08% 108 11805 0.08% 109 12537 0.09% 110 13013 0.09% 111 13468 0.09% 112 14454 0.10% 113 14877 0.10% 114 15617 0.11% 115 16148 0.11% 116 16902 0.12% 117 17344 0.12% 118 18305 0.12% 119 18393 0.13% 120 19500 0.13% 121 20543 0.14% 122 21479 0.15% 123 22693 0.15% 124 23757 0.16% 125 24159 0.16% 126 25633 0.17% 127 26995 0.18% 128 28166 0.19% 129 30269 0.21% 130 31492 0.21% 131 33621 0.23% 132 35627 0.24% 133 38538 0.26% 134 41828 0.29% 135 44545 0.30% 136 48801 0.33% 137 53540 0.36% 138 58833 0.40% 139 66085 0.45% 140 74165 0.51% 141 83856 0.57% 142 96548 0.66% 143 113676 0.77% 144 136849 0.93% 145 173620 1.18% 146 223263 1.52% 147 314853 2.15% 148 498915 3.40% 149 1004923 6.85% 150 4066580 27.72% 151 6817565 46.47% 14669539 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=29.95 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.9 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=13 prefix-density=0.78 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=80.28 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170667 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:41:38 Started mapping on | Feb 13 15:41:38 Finished on | Feb 13 15:42:58 Mapping speed, Million of reads per hour | 660.13 Number of input reads | 14669539 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13871056 Uniquely mapped reads % | 94.56% Average mapped length | 295.09 Number of splices: Total | 13897375 Number of splices: Annotated (sjdb) | 13581200 Number of splices: GT/AG | 13637140 Number of splices: GC/AG | 214223 Number of splices: AT/AC | 8210 Number of splices: Non-canonical | 37802 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399126 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 13690 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411822 411822 411822 N_multimapping 399126 399126 399126 N_noFeature 522586 13660257 606818 N_ambiguous 223621 776 96600 UnstrandedReadsAssigned:13124849 PositiveStrandReadsAssigned:210023 NegativeStrandReadsAssigned:13167638 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170667 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170667-trimmed-pair1.fastq SRR7170667-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,669,539 reads, 13,103,070 reads pseudoaligned [quant] estimated average fragment length: 285.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7170667.ke.tsv 34699 SRR7170667.se.tsv 87100 total ==> SRR7170667.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.94 610 26.7953 Potri.005G024800.1.v4.1 1035 750.935 160 16.2285 Potri.004G059700.1.v4.1 961 677.01 13 1.46255 Potri.007G009000.2.v4.1 1416 1131.94 0 0 Potri.003G141000.2.v4.1 2943 2658.94 817.203 23.409 Potri.016G087400.1.v4.1 270 71.0372 649 695.857 Potri.015G069301.1.v4.1 564 291.11 0 0 Potri.010G195200.1.v4.1 1773 1488.94 31 1.5858 Potri.012G127500.1.v4.1 977 692.974 108 11.8705 ==> SRR7170667.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 772 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170667 completed mapping pipeline successfully