Starting /dee2/code/volunteer_pipeline.sh SRR7170668 current disk space = 3089075425280 free memory = 1414499796 SRR7170668 SRAfilesize 649449113b4b4f6823c490fd4ef31a9c SRR7170668.sra SRR7170668.sra file validated SRR7170668 is paired end SRR7170668 is conventional basespace SRR7170668 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170668_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.23925 25.0 18.0 32.0 18.0 33.0 2 24.637 25.0 18.0 29.0 18.0 33.0 3 27.953 29.0 27.0 31.0 18.0 33.0 4 30.80525 31.0 30.0 33.0 27.0 33.0 5 32.064 33.0 32.0 33.0 32.0 33.0 6 36.47925 38.0 37.0 38.0 34.0 38.0 7 36.93475 38.0 37.0 38.0 35.0 38.0 8 37.34475 38.0 38.0 38.0 37.0 38.0 9 37.375 38.0 38.0 38.0 37.0 38.0 10-14 37.385200000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.374 38.0 38.0 38.0 37.0 38.0 20-24 37.5166 38.0 38.0 38.0 37.8 38.0 25-29 37.4715 38.0 38.0 38.0 37.8 38.0 30-34 37.4557 38.0 38.0 38.0 37.2 38.0 35-39 37.4343 38.0 38.0 38.0 37.0 38.0 40-44 37.3125 38.0 38.0 38.0 37.0 38.0 45-49 37.3355 38.0 38.0 38.0 37.0 38.0 50-54 37.25545 38.0 38.0 38.0 36.8 38.0 55-59 37.166599999999995 38.0 38.0 38.0 36.2 38.0 60-64 37.13075 38.0 38.0 38.0 36.0 38.0 65-69 37.0177 38.0 38.0 38.0 36.0 38.0 70-74 36.88695 38.0 38.0 38.0 35.4 38.0 75-79 36.822500000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.878550000000004 38.0 38.0 38.0 35.2 38.0 85-89 36.664249999999996 38.0 38.0 38.0 34.6 38.0 90-94 36.4835 38.0 38.0 38.0 34.0 38.0 95-99 36.38145 38.0 38.0 38.0 34.0 38.0 100-104 36.188900000000004 38.0 37.0 38.0 33.4 38.0 105-109 36.088899999999995 38.0 37.0 38.0 33.2 38.0 110-114 35.904650000000004 38.0 36.8 38.0 32.2 38.0 115-119 35.7829 38.0 36.8 38.0 31.4 38.0 120-124 35.68755 38.0 36.0 38.0 31.4 38.0 125-129 35.34525 38.0 36.0 38.0 29.4 38.0 130-134 34.80905 38.0 35.0 38.0 27.4 38.0 135-139 34.3283 38.0 34.2 38.0 25.2 38.0 140-144 33.5478 38.0 33.4 38.0 21.4 38.0 145-149 32.862 38.0 33.2 38.0 18.0 38.0 150-151 28.646124999999998 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 3.0 17 2.0 18 1.0 19 5.0 20 1.0 21 3.0 22 6.0 23 7.0 24 8.0 25 11.0 26 13.0 27 22.0 28 19.0 29 43.0 30 43.0 31 57.0 32 102.0 33 152.0 34 194.0 35 404.0 36 982.0 37 1918.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.964065708418886 15.374743326488707 11.267967145790553 33.393223819301845 2 21.2 23.575 39.25 15.975 3 16.650000000000002 29.15 27.474999999999998 26.724999999999998 4 20.474999999999998 36.8 22.625 20.1 5 20.540405303977984 37.77833375031274 22.942206654991242 18.739054290718038 6 15.65 35.65 26.724999999999998 21.975 7 12.1 19.45 45.45 23.0 8 18.7 20.1 28.1 33.1 9 17.424999999999997 20.75 30.599999999999998 31.225 10-14 19.384999999999998 28.51 27.355 24.75 15-19 20.175 28.28 27.37 24.175 20-24 20.035 28.415000000000003 27.715 23.835 25-29 20.525 28.58 27.205000000000002 23.69 30-34 19.97 28.92 27.405 23.705000000000002 35-39 19.939999999999998 28.470000000000002 27.474999999999998 24.115000000000002 40-44 20.669999999999998 28.175 27.68 23.474999999999998 45-49 20.44 28.025 27.750000000000004 23.785 50-54 21.41 27.46 27.750000000000004 23.380000000000003 55-59 20.544999999999998 27.965 27.889999999999997 23.599999999999998 60-64 20.345 28.244999999999997 27.85 23.56 65-69 20.185 28.505000000000003 27.6 23.71 70-74 20.275000000000002 27.825 27.93 23.97 75-79 20.349999999999998 28.499999999999996 27.435 23.715 80-84 20.525 27.650000000000002 27.334999999999997 24.490000000000002 85-89 20.59 27.88 27.834999999999997 23.695 90-94 20.91 27.889999999999997 27.595 23.605 95-99 20.835 27.794999999999998 27.77 23.599999999999998 100-104 21.3 28.044999999999998 27.439999999999998 23.215 105-109 21.005 27.865000000000002 27.839999999999996 23.29 110-114 21.15 27.77 27.965 23.115 115-119 20.625 27.625 27.565 24.185000000000002 120-124 20.880000000000003 27.465 27.55 24.104999999999997 125-129 20.82 27.944999999999997 27.235 24.0 130-134 21.515 27.334999999999997 27.61 23.54 135-139 20.365 27.584999999999997 27.675 24.375 140-144 21.48 27.944999999999997 27.41 23.165 145-149 20.979999999999997 28.005000000000003 26.779999999999998 24.235 150-151 21.587500000000002 28.15 26.637499999999996 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.0 24 2.5 25 1.0 26 4.0 27 6.0 28 8.5 29 17.0 30 23.5 31 28.5 32 31.0 33 34.5 34 52.0 35 72.5 36 88.0 37 98.0 38 124.0 39 157.5 40 179.5 41 212.0 42 230.5 43 232.5 44 257.5 45 276.0 46 270.0 47 272.0 48 246.0 49 212.5 50 181.0 51 147.0 52 112.5 53 94.5 54 86.5 55 57.0 56 43.5 57 41.5 58 31.5 59 20.5 60 16.5 61 10.0 62 6.0 63 2.5 64 0.5 65 1.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16603487490522 98.1 2 0.7328784432650998 1.4500000000000002 3 0.025271670457417232 0.075 4 0.025271670457417232 0.1 5 0.025271670457417232 0.125 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 6 0.15 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.5499999999999998 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.15 0.0 0.0 0.0 0.0 132-133 2.3499999999999996 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.7375 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170668 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170668_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60025 33.0 33.0 34.0 32.0 34.0 2 32.753 33.0 33.0 34.0 32.0 34.0 3 32.7335 33.0 33.0 34.0 32.0 34.0 4 32.6435 33.0 33.0 34.0 32.0 34.0 5 32.71475 33.0 33.0 34.0 32.0 34.0 6 36.774 38.0 38.0 38.0 35.0 38.0 7 36.767 38.0 38.0 38.0 36.0 38.0 8 36.8375 38.0 38.0 38.0 36.0 38.0 9 36.8645 38.0 38.0 38.0 36.0 38.0 10-14 36.8556 38.0 38.0 38.0 36.0 38.0 15-19 36.8312 38.0 38.0 38.0 36.0 38.0 20-24 36.741150000000005 38.0 38.0 38.0 35.4 38.0 25-29 36.6942 38.0 38.0 38.0 35.2 38.0 30-34 36.6378 38.0 38.0 38.0 35.0 38.0 35-39 36.69995 38.0 38.0 38.0 35.0 38.0 40-44 36.676 38.0 38.0 38.0 35.0 38.0 45-49 36.550599999999996 38.0 38.0 38.0 34.4 38.0 50-54 36.4882 38.0 38.0 38.0 34.0 38.0 55-59 36.4253 38.0 38.0 38.0 34.0 38.0 60-64 36.4317 38.0 38.0 38.0 34.2 38.0 65-69 36.33665 38.0 38.0 38.0 33.8 38.0 70-74 36.29879999999999 38.0 38.0 38.0 34.0 38.0 75-79 36.201750000000004 38.0 38.0 38.0 33.6 38.0 80-84 36.025099999999995 38.0 38.0 38.0 33.2 38.0 85-89 35.8974 38.0 37.2 38.0 32.6 38.0 90-94 35.79845000000001 38.0 37.0 38.0 31.6 38.0 95-99 35.544349999999994 38.0 37.0 38.0 29.8 38.0 100-104 35.2829 38.0 36.6 38.0 29.0 38.0 105-109 35.2375 38.0 36.2 38.0 29.2 38.0 110-114 35.08735 38.0 36.0 38.0 28.4 38.0 115-119 34.8457 38.0 35.8 38.0 27.4 38.0 120-124 34.56485 38.0 35.4 38.0 25.6 38.0 125-129 34.0593 38.0 34.2 38.0 22.6 38.0 130-134 33.57350000000001 38.0 33.0 38.0 21.4 38.0 135-139 33.2193 38.0 33.0 38.0 18.6 38.0 140-144 32.50025 38.0 33.0 38.0 14.4 38.0 145-149 31.28725 38.0 31.4 38.0 8.2 38.0 150-151 26.07825 33.5 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 4.0 5 2.0 6 0.0 7 0.0 8 2.0 9 5.0 10 2.0 11 6.0 12 1.0 13 1.0 14 6.0 15 8.0 16 3.0 17 10.0 18 9.0 19 8.0 20 5.0 21 16.0 22 14.0 23 16.0 24 20.0 25 25.0 26 34.0 27 35.0 28 48.0 29 66.0 30 55.0 31 86.0 32 84.0 33 157.0 34 191.0 35 319.0 36 730.0 37 2025.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.525 15.5 14.424999999999999 33.550000000000004 2 22.45 23.175 37.85 16.525000000000002 3 19.875 25.05 31.8 23.275000000000002 4 23.075000000000003 35.825 21.425 19.675 5 21.325 38.05 21.65 18.975 6 16.08304152076038 38.444222111055524 24.637318659329665 20.83541770885443 7 16.30815407703852 15.532766383191596 46.97348674337169 21.1855927963982 8 19.884942471235618 21.235617808904454 28.114057028514257 30.76538269134567 9 21.48574287143572 24.062031015507753 27.938969484742373 26.513256628314156 10-14 21.955977988994498 29.27463731865933 26.68334167083542 22.086043021510758 15-19 22.451225612806404 27.688844422211105 28.174087043521762 21.68584292146073 20-24 22.163865546218485 28.291316526610643 28.08623449379752 21.45858343337335 25-29 22.396198099049524 27.91895947973987 27.91895947973987 21.765882941470736 30-34 22.471235617808905 28.039019509754876 27.793896948474238 21.69584792396198 35-39 22.391195597798898 28.23911955977989 27.678839419709856 21.690845422711355 40-44 22.181090545272635 27.973986993496748 27.878939469734863 21.965982991495746 45-49 22.121060530265133 27.75887943971986 27.528764382191095 22.591295647823912 50-54 22.416208104052025 27.348674337168582 28.129064532266135 22.106053026513255 55-59 22.621310655327665 27.40370185092546 27.79889944972486 22.17608804402201 60-64 22.951475737868936 27.573786893446723 27.673836918459227 21.800900450225114 65-69 22.9518855656697 27.35820746223867 27.95838751625488 21.73151945583675 70-74 23.595 27.779999999999998 27.175 21.45 75-79 22.86457291458292 27.755551110222044 27.575515103020603 21.804360872174435 80-84 23.014602920584117 27.640528105621126 27.850570114022805 21.494298859771956 85-89 23.387338733873385 28.16281628162816 26.692669266926693 21.75717571757176 90-94 22.355 27.794999999999998 28.055000000000003 21.795 95-99 23.380000000000003 27.315 27.79 21.515 100-104 23.96 27.495000000000005 27.235 21.310000000000002 105-109 23.644728945789158 27.470494098819763 27.15543108621724 21.729345869173837 110-114 23.19159579789895 27.978989494747374 27.528764382191095 21.300650325162582 115-119 23.584433773509403 27.77611044417767 27.330932372949178 21.308523409363744 120-124 23.787378737873787 27.767776777677767 27.557755775577558 20.887088708870888 125-129 24.075 27.96 27.41 20.555 130-134 23.802140642192658 28.06842052615785 27.283184955486643 20.846253876162848 135-139 23.33166583291646 28.0040020010005 27.39869934967484 21.265632816408203 140-144 24.02201100550275 28.469234617308654 26.898449224612307 20.610305152576288 145-149 24.349999999999998 27.63 27.125 20.895 150-151 24.65 28.1875 26.7625 20.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.0 24 2.0 25 3.5 26 5.0 27 6.5 28 10.5 29 13.0 30 14.5 31 17.5 32 21.5 33 32.0 34 51.0 35 64.0 36 79.0 37 95.0 38 127.0 39 170.5 40 191.0 41 204.0 42 217.5 43 240.5 44 262.5 45 264.5 46 266.0 47 264.0 48 245.5 49 216.5 50 187.0 51 151.5 52 121.0 53 107.0 54 91.5 55 66.5 56 47.0 57 40.0 58 29.5 59 19.0 60 12.5 61 9.5 62 8.5 63 5.5 64 3.5 65 2.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.05 20-24 0.04 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.03 70-74 0.0 75-79 0.02 80-84 0.02 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.05 115-119 0.04 120-124 0.01 125-129 0.0 130-134 0.03 135-139 0.05 140-144 0.05 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88154550076258 97.25 2 0.9150991357397051 1.7999999999999998 3 0.0762582613116421 0.22499999999999998 4 0.0762582613116421 0.3 5 0.0 0.0 6 0.02541942043721403 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02541942043721403 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 11 0.27499999999999997 No Hit CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2875 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.8875 0.0 0.0 0.0 0.0 138-139 2.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTCTT 10 0.006830828 145.0 1 TCCATGT 10 0.006830828 145.0 7 TTCAGCA 10 0.006830828 145.0 7 CGTCTTC 10 0.006830828 145.0 2 >>END_MODULE Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894114 spots for SRR7170668.sra Written 894114 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra Read 894098 spots for SRR7170668.sra Written 894098 spots for SRR7170668.sra SRR ids: ['SRR7170668.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q6vxom1s SRR7170668.sra spots: 17881976 blocks: [[1, 894098], [894099, 1788196], [1788197, 2682294], [2682295, 3576392], [3576393, 4470490], [4470491, 5364588], [5364589, 6258686], [6258687, 7152784], [7152785, 8046882], [8046883, 8940980], [8940981, 9835078], [9835079, 10729176], [10729177, 11623274], [11623275, 12517372], [12517373, 13411470], [13411471, 14305568], [14305569, 15199666], [15199667, 16093764], [16093765, 16987862], [16987863, 17881976]] SRR7170668 file size 6037914 SRR7170668 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170668 SRR7170668_1.fastq SRR7170668_2.fastq Input file: SRR7170668_1.fastq Paired file: SRR7170668_2.fastq trimmed: SRR7170668-trimmed-pair1.fastq, SRR7170668-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:14:26 2025 >> started Thu Feb 13 15:14:57 2025 >> done (30.808s) 17881976 read pairs processed; of these: 19117 ( 0.11%) short read pairs filtered out after trimming by size control 16157 ( 0.09%) empty read pairs filtered out after trimming by size control 17846702 (99.80%) read pairs available; of these: 9201136 (51.56%) trimmed read pairs available after processing 8645566 (48.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 12 0.00% 20 7 0.00% 21 9 0.00% 22 9 0.00% 23 14 0.00% 24 11 0.00% 25 13 0.00% 26 12 0.00% 27 11 0.00% 28 6 0.00% 29 9 0.00% 30 9 0.00% 31 10 0.00% 32 6 0.00% 33 11 0.00% 34 8 0.00% 35 15 0.00% 36 23 0.00% 37 20 0.00% 38 22 0.00% 39 21 0.00% 40 26 0.00% 41 22 0.00% 42 21 0.00% 43 15 0.00% 44 38 0.00% 45 31 0.00% 46 45 0.00% 47 64 0.00% 48 53 0.00% 49 60 0.00% 50 83 0.00% 51 69 0.00% 52 103 0.00% 53 91 0.00% 54 109 0.00% 55 82 0.00% 56 104 0.00% 57 133 0.00% 58 141 0.00% 59 165 0.00% 60 188 0.00% 61 213 0.00% 62 236 0.00% 63 224 0.00% 64 308 0.00% 65 303 0.00% 66 356 0.00% 67 394 0.00% 68 418 0.00% 69 513 0.00% 70 570 0.00% 71 599 0.00% 72 715 0.00% 73 886 0.00% 74 950 0.01% 75 1033 0.01% 76 1239 0.01% 77 1374 0.01% 78 1384 0.01% 79 1521 0.01% 80 1738 0.01% 81 2021 0.01% 82 2167 0.01% 83 2506 0.01% 84 3448 0.02% 85 4075 0.02% 86 4275 0.02% 87 4878 0.03% 88 4725 0.03% 89 5040 0.03% 90 5323 0.03% 91 5661 0.03% 92 6184 0.03% 93 6605 0.04% 94 7075 0.04% 95 7684 0.04% 96 7668 0.04% 97 8184 0.05% 98 8379 0.05% 99 8897 0.05% 100 9482 0.05% 101 10182 0.06% 102 10759 0.06% 103 11636 0.07% 104 12110 0.07% 105 12599 0.07% 106 13222 0.07% 107 13855 0.08% 108 14296 0.08% 109 14895 0.08% 110 15583 0.09% 111 16158 0.09% 112 17477 0.10% 113 18182 0.10% 114 19241 0.11% 115 19282 0.11% 116 20578 0.12% 117 21432 0.12% 118 22149 0.12% 119 22733 0.13% 120 24410 0.14% 121 25086 0.14% 122 26347 0.15% 123 28091 0.16% 124 29759 0.17% 125 31398 0.18% 126 32600 0.18% 127 34439 0.19% 128 37241 0.21% 129 37897 0.21% 130 39688 0.22% 131 42636 0.24% 132 45673 0.26% 133 49156 0.28% 134 53207 0.30% 135 56530 0.32% 136 61543 0.34% 137 67742 0.38% 138 75318 0.42% 139 83985 0.47% 140 93699 0.53% 141 105913 0.59% 142 121192 0.68% 143 143076 0.80% 144 169355 0.95% 145 206952 1.16% 146 264096 1.48% 147 369879 2.07% 148 559455 3.13% 149 1102809 6.18% 150 4744434 26.58% 151 8645566 48.44% 17846702 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.75 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=20 fanout-score=31.33 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=10.4 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=24 prefix-density=0.78 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=37.21 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCTAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR7170668 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:15:50 Started mapping on | Feb 13 15:15:50 Finished on | Feb 13 15:18:38 Mapping speed, Million of reads per hour | 382.43 Number of input reads | 17846702 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16936364 Uniquely mapped reads % | 94.90% Average mapped length | 295.24 Number of splices: Total | 16474146 Number of splices: Annotated (sjdb) | 16155620 Number of splices: GT/AG | 16144212 Number of splices: GC/AG | 282316 Number of splices: AT/AC | 8446 Number of splices: Non-canonical | 39172 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 513065 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 35255 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 413568 413568 413568 N_multimapping 513065 513065 513065 N_noFeature 542833 16700902 633992 N_ambiguous 258743 1151 113631 UnstrandedReadsAssigned:16134788 PositiveStrandReadsAssigned:234311 NegativeStrandReadsAssigned:16188741 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170668 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170668-trimmed-pair1.fastq SRR7170668-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,846,702 reads, 16,116,344 reads pseudoaligned [quant] estimated average fragment length: 291.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR7170668.ke.tsv 34699 SRR7170668.se.tsv 87100 total ==> SRR7170668.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.91 468 16.4127 Potri.005G024800.1.v4.1 1035 744.909 171 13.9106 Potri.004G059700.1.v4.1 961 671.051 10 0.903023 Potri.007G009000.2.v4.1 1416 1125.91 0 0 Potri.003G141000.2.v4.1 2943 2652.91 700 15.9893 Potri.016G087400.1.v4.1 270 70.1359 535.628 462.782 Potri.015G069301.1.v4.1 564 286.401 0 0 Potri.010G195200.1.v4.1 1773 1482.91 8 0.326911 Potri.012G127500.1.v4.1 977 687.007 657 57.9507 ==> SRR7170668.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 154 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 435 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 473 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 15 SRR7170668 completed mapping pipeline successfully