Starting /dee2/code/volunteer_pipeline.sh SRR7170669 current disk space = 3089044258816 free memory = 1403722352 SRR7170669 SRAfilesize 94b174e5651fdb41836b527dd70a2115 SRR7170669.sra SRR7170669.sra file validated SRR7170669 is paired end SRR7170669 is conventional basespace SRR7170669 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170669_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.976 18.0 18.0 30.0 18.0 33.0 2 30.7425 31.0 30.0 33.0 27.0 33.0 3 31.72575 33.0 31.0 33.0 29.0 33.0 4 32.04525 33.0 33.0 33.0 31.0 34.0 5 32.834 33.0 33.0 34.0 32.0 34.0 6 37.12025 38.0 38.0 38.0 36.0 38.0 7 37.25525 38.0 38.0 38.0 36.0 38.0 8 37.35575 38.0 38.0 38.0 37.0 38.0 9 37.38775 38.0 38.0 38.0 37.0 38.0 10-14 37.37725 38.0 38.0 38.0 37.0 38.0 15-19 37.42190000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.47775 38.0 38.0 38.0 37.4 38.0 25-29 37.4027 38.0 38.0 38.0 37.2 38.0 30-34 37.41565 38.0 38.0 38.0 37.0 38.0 35-39 37.428399999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.382400000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.382400000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.23994999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.2145 38.0 38.0 38.0 36.4 38.0 60-64 37.154849999999996 38.0 38.0 38.0 36.2 38.0 65-69 37.1 38.0 38.0 38.0 36.0 38.0 70-74 37.05055 38.0 38.0 38.0 36.0 38.0 75-79 36.9981 38.0 38.0 38.0 36.0 38.0 80-84 36.908699999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.8232 38.0 38.0 38.0 35.2 38.0 90-94 36.698249999999994 38.0 38.0 38.0 35.0 38.0 95-99 36.5355 38.0 38.0 38.0 34.2 38.0 100-104 36.448899999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.34985 38.0 37.8 38.0 34.0 38.0 110-114 36.199799999999996 38.0 37.2 38.0 33.6 38.0 115-119 35.973800000000004 38.0 37.0 38.0 33.0 38.0 120-124 35.853300000000004 38.0 37.0 38.0 32.2 38.0 125-129 35.74575 38.0 36.6 38.0 31.4 38.0 130-134 35.40385 38.0 36.0 38.0 30.4 38.0 135-139 35.1749 38.0 36.0 38.0 30.6 38.0 140-144 34.4799 38.0 34.2 38.0 26.4 38.0 145-149 33.80225 38.0 33.4 38.0 24.0 38.0 150-151 29.950249999999997 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 4.0 19 5.0 20 1.0 21 7.0 22 6.0 23 7.0 24 7.0 25 6.0 26 18.0 27 17.0 28 27.0 29 30.0 30 46.0 31 48.0 32 63.0 33 91.0 34 146.0 35 313.0 36 790.0 37 2360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.843552863991924 18.748422911935403 14.660610648498611 26.747413575574058 2 18.525 23.175 37.375 20.925 3 16.0 29.799999999999997 30.725 23.474999999999998 4 19.725 35.925000000000004 24.975 19.375 5 20.24108488196886 36.43897538925163 23.505775991963837 19.814163736815672 6 15.45 35.949999999999996 25.650000000000002 22.95 7 12.65 19.85 46.175 21.325 8 16.0 21.875 29.275000000000002 32.85 9 16.650000000000002 23.05 31.424999999999997 28.875 10-14 19.185 29.970000000000002 26.650000000000002 24.195 15-19 18.905 28.785 27.860000000000003 24.45 20-24 19.88 29.085 27.72 23.315 25-29 19.955000000000002 28.599999999999998 27.744999999999997 23.7 30-34 19.435 29.535 27.47 23.56 35-39 19.509999999999998 29.45 27.224999999999998 23.815 40-44 19.62 29.07 27.534999999999997 23.775 45-49 19.5 28.96 27.145000000000003 24.395 50-54 19.06 29.24 27.389999999999997 24.310000000000002 55-59 19.7 29.049999999999997 27.67 23.580000000000002 60-64 19.46 28.439999999999998 28.125 23.974999999999998 65-69 19.689999999999998 28.720000000000002 27.515 24.075 70-74 19.42 29.049999999999997 27.295 24.235 75-79 19.36 29.044999999999998 27.644999999999996 23.95 80-84 19.72 28.21 27.395000000000003 24.675 85-89 20.044999999999998 28.775000000000002 27.025 24.154999999999998 90-94 20.02 28.26 27.33 24.39 95-99 19.825 28.439999999999998 28.005000000000003 23.73 100-104 19.91 27.994999999999997 28.285 23.810000000000002 105-109 20.585 28.155 27.515 23.745 110-114 20.64 28.139999999999997 27.955000000000002 23.265 115-119 20.28 27.894999999999996 27.595 24.23 120-124 20.655 28.49 26.965 23.89 125-129 20.385 27.900000000000002 27.375 24.34 130-134 20.655 27.900000000000002 27.169999999999998 24.275 135-139 20.865000000000002 28.365000000000002 26.525 24.245 140-144 20.94 27.32 27.715 24.025 145-149 20.735 27.85 26.705000000000002 24.709999999999997 150-151 21.314142678347935 28.735919899874844 26.395494367959948 23.554443053817273 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 1.5 25 4.0 26 7.5 27 13.0 28 17.0 29 22.0 30 32.0 31 39.0 32 39.0 33 57.0 34 74.5 35 96.5 36 121.5 37 127.5 38 134.5 39 150.5 40 177.0 41 204.5 42 215.0 43 234.0 44 264.0 45 243.0 46 226.0 47 234.0 48 229.5 49 204.0 50 173.5 51 140.0 52 105.0 53 91.5 54 80.5 55 65.0 56 50.0 57 33.0 58 23.5 59 22.0 60 15.0 61 7.5 62 5.0 63 3.5 64 1.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.44999999999999996 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.30812612150731 95.875 2 1.3329915406306074 2.6 3 0.17944116893104334 0.525 4 0.02563445270443476 0.1 5 0.05126890540886952 0.25 6 0.05126890540886952 0.3 7 0.05126890540886952 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 7 0.17500000000000002 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 7 0.17500000000000002 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 6 0.15 No Hit GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 6 0.15 No Hit GGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCA 5 0.125 No Hit GTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.4000000000000004 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.75 0.0 0.0 0.0 0.0 132-133 4.0 0.0 0.0 0.0 0.0 134-135 4.300000000000001 0.0 0.0 0.0 0.0 136-137 4.612500000000001 0.0 0.0 0.0 0.0 138-139 4.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170669 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170669_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69 33.0 33.0 34.0 32.0 34.0 2 32.78125 33.0 33.0 34.0 32.0 34.0 3 32.815 34.0 33.0 34.0 32.0 34.0 4 32.6755 34.0 33.0 34.0 32.0 34.0 5 32.7 34.0 33.0 34.0 32.0 34.0 6 36.906 38.0 38.0 38.0 36.0 38.0 7 36.79725 38.0 38.0 38.0 36.0 38.0 8 36.8195 38.0 38.0 38.0 36.0 38.0 9 36.71325 38.0 38.0 38.0 36.0 38.0 10-14 36.75520000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.72405 38.0 38.0 38.0 36.0 38.0 20-24 36.6905 38.0 38.0 38.0 36.0 38.0 25-29 36.73035 38.0 38.0 38.0 36.0 38.0 30-34 36.6888 38.0 38.0 38.0 36.0 38.0 35-39 36.74985 38.0 38.0 38.0 36.0 38.0 40-44 36.72855 38.0 38.0 38.0 36.0 38.0 45-49 36.6493 38.0 38.0 38.0 36.0 38.0 50-54 36.63535 38.0 38.0 38.0 36.0 38.0 55-59 36.611450000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.529849999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.52835 38.0 38.0 38.0 36.0 38.0 70-74 36.4408 38.0 38.0 38.0 35.4 38.0 75-79 36.391200000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.29260000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.237049999999996 38.0 38.0 38.0 34.6 38.0 90-94 36.17515 38.0 38.0 38.0 34.6 38.0 95-99 36.10549999999999 38.0 38.0 38.0 34.2 38.0 100-104 35.793099999999995 38.0 38.0 38.0 33.6 38.0 105-109 35.80975 38.0 38.0 38.0 33.6 38.0 110-114 35.6466 38.0 38.0 38.0 33.2 38.0 115-119 35.50430000000001 38.0 37.6 38.0 31.8 38.0 120-124 35.3658 38.0 37.0 38.0 31.8 38.0 125-129 34.970000000000006 38.0 36.2 38.0 28.8 38.0 130-134 34.646550000000005 38.0 36.0 38.0 28.0 38.0 135-139 34.36245000000001 38.0 36.0 38.0 26.6 38.0 140-144 34.022999999999996 38.0 35.0 38.0 24.6 38.0 145-149 33.260400000000004 38.0 33.8 38.0 18.4 38.0 150-151 28.390625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 8.0 4 8.0 5 3.0 6 7.0 7 6.0 8 2.0 9 4.0 10 3.0 11 5.0 12 9.0 13 6.0 14 6.0 15 3.0 16 8.0 17 8.0 18 4.0 19 12.0 20 7.0 21 7.0 22 4.0 23 10.0 24 8.0 25 12.0 26 20.0 27 22.0 28 27.0 29 24.0 30 29.0 31 47.0 32 62.0 33 73.0 34 115.0 35 219.0 36 535.0 37 2662.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.574999999999996 17.0 14.75 22.675 2 25.474999999999998 22.625 32.975 18.925 3 21.825 26.700000000000003 32.574999999999996 18.9 4 24.099999999999998 34.1 21.224999999999998 20.575 5 22.25 38.3 21.9 17.549999999999997 6 18.275 36.075 24.5 21.15 7 19.025 16.825000000000003 41.425 22.725 8 19.5 23.974999999999998 26.525 30.0 9 21.925 24.775 27.375 25.924999999999997 10-14 23.325000000000003 27.785 26.97 21.92 15-19 23.275000000000002 27.900000000000002 27.365000000000002 21.46 20-24 23.630000000000003 28.09 27.305 20.974999999999998 25-29 22.89 28.34 27.455000000000002 21.315 30-34 23.365 27.865000000000002 27.68 21.09 35-39 23.03 27.639999999999997 27.735 21.595 40-44 23.365 27.805000000000003 27.775 21.055 45-49 23.51 27.145000000000003 27.575 21.77 50-54 23.145 27.250000000000004 28.375 21.23 55-59 23.41 27.245 27.810000000000002 21.535 60-64 23.630000000000003 27.889999999999997 27.250000000000004 21.23 65-69 23.23 28.055000000000003 27.11 21.605 70-74 23.345 27.6 27.500000000000004 21.555 75-79 23.22 27.985 27.655 21.14 80-84 23.515 27.634999999999998 27.71 21.14 85-89 23.805 28.410000000000004 26.76 21.025 90-94 23.54 28.000000000000004 27.255000000000003 21.205 95-99 24.035 27.389999999999997 27.88 20.695 100-104 24.02 27.894999999999996 27.500000000000004 20.585 105-109 23.78 27.935 27.925 20.36 110-114 24.16 28.485 27.47 19.885 115-119 24.715 27.925 27.200000000000003 20.16 120-124 24.709999999999997 27.595 27.584999999999997 20.11 125-129 24.205 27.96 27.694999999999997 20.14 130-134 24.8 27.54 27.61 20.05 135-139 24.93 27.49 27.685 19.895 140-144 24.955 27.76 27.27 20.015 145-149 25.27 28.355000000000004 26.700000000000003 19.675 150-151 25.497061398024258 28.823308740777794 27.11016631236714 18.56946354883081 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 3.0 24 3.0 25 2.5 26 5.5 27 5.0 28 7.5 29 14.0 30 17.5 31 23.0 32 23.0 33 27.5 34 52.5 35 56.0 36 58.5 37 83.0 38 97.5 39 127.5 40 175.5 41 214.0 42 248.0 43 260.5 44 266.0 45 269.0 46 257.0 47 239.5 48 235.5 49 220.0 50 180.5 51 149.5 52 126.5 53 109.5 54 110.5 55 109.5 56 79.5 57 45.5 58 23.5 59 22.5 60 18.0 61 8.5 62 5.5 63 3.5 64 2.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.20328542094457 95.65 2 1.3347022587268993 2.6 3 0.20533880903490762 0.6 4 0.1540041067761807 0.6 5 0.051334702258726904 0.25 6 0.051334702258726904 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit GCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.75 0.0 0.0 0.0 0.0 132-133 4.012499999999999 0.0 0.0 0.0 0.0 134-135 4.300000000000001 0.0 0.0 0.0 0.0 136-137 4.637499999999999 0.0 0.0 0.0 0.0 138-139 4.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559251 spots for SRR7170669.sra Written 559251 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra Read 559239 spots for SRR7170669.sra Written 559239 spots for SRR7170669.sra SRR ids: ['SRR7170669.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f1qoaxp7 SRR7170669.sra spots: 11184792 blocks: [[1, 559239], [559240, 1118478], [1118479, 1677717], [1677718, 2236956], [2236957, 2796195], [2796196, 3355434], [3355435, 3914673], [3914674, 4473912], [4473913, 5033151], [5033152, 5592390], [5592391, 6151629], [6151630, 6710868], [6710869, 7270107], [7270108, 7829346], [7829347, 8388585], [8388586, 8947824], [8947825, 9507063], [9507064, 10066302], [10066303, 10625541], [10625542, 11184792]] SRR7170669 file size 3768458 SRR7170669 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170669 SRR7170669_1.fastq SRR7170669_2.fastq Input file: SRR7170669_1.fastq Paired file: SRR7170669_2.fastq trimmed: SRR7170669-trimmed-pair1.fastq, SRR7170669-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:19:05 2025 >> started Thu Feb 13 15:19:18 2025 >> done (12.587s) 11184792 read pairs processed; of these: 25717 ( 0.23%) short read pairs filtered out after trimming by size control 25799 ( 0.23%) empty read pairs filtered out after trimming by size control 11133276 (99.54%) read pairs available; of these: 5291525 (47.53%) trimmed read pairs available after processing 5841751 (52.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 8 0.00% 23 9 0.00% 24 7 0.00% 25 11 0.00% 26 13 0.00% 27 8 0.00% 28 6 0.00% 29 9 0.00% 30 6 0.00% 31 9 0.00% 32 8 0.00% 33 7 0.00% 34 10 0.00% 35 7 0.00% 36 14 0.00% 37 15 0.00% 38 20 0.00% 39 9 0.00% 40 21 0.00% 41 13 0.00% 42 16 0.00% 43 16 0.00% 44 20 0.00% 45 32 0.00% 46 29 0.00% 47 37 0.00% 48 36 0.00% 49 50 0.00% 50 50 0.00% 51 54 0.00% 52 66 0.00% 53 66 0.00% 54 77 0.00% 55 80 0.00% 56 87 0.00% 57 84 0.00% 58 136 0.00% 59 142 0.00% 60 160 0.00% 61 188 0.00% 62 207 0.00% 63 256 0.00% 64 269 0.00% 65 305 0.00% 66 324 0.00% 67 394 0.00% 68 407 0.00% 69 462 0.00% 70 514 0.00% 71 594 0.01% 72 758 0.01% 73 842 0.01% 74 921 0.01% 75 1039 0.01% 76 1315 0.01% 77 1420 0.01% 78 1369 0.01% 79 1563 0.01% 80 1828 0.02% 81 2034 0.02% 82 2341 0.02% 83 2531 0.02% 84 4123 0.04% 85 5044 0.05% 86 5365 0.05% 87 5749 0.05% 88 5858 0.05% 89 5863 0.05% 90 6132 0.06% 91 6329 0.06% 92 6811 0.06% 93 7254 0.07% 94 7430 0.07% 95 8091 0.07% 96 8347 0.07% 97 8293 0.07% 98 8782 0.08% 99 9164 0.08% 100 9599 0.09% 101 10192 0.09% 102 11038 0.10% 103 11354 0.10% 104 12010 0.11% 105 12541 0.11% 106 13021 0.12% 107 13077 0.12% 108 13569 0.12% 109 13775 0.12% 110 14541 0.13% 111 15175 0.14% 112 15832 0.14% 113 16792 0.15% 114 17272 0.16% 115 17476 0.16% 116 17998 0.16% 117 18509 0.17% 118 18829 0.17% 119 18910 0.17% 120 20064 0.18% 121 20044 0.18% 122 20851 0.19% 123 21984 0.20% 124 22815 0.20% 125 23481 0.21% 126 24384 0.22% 127 24787 0.22% 128 25721 0.23% 129 26900 0.24% 130 27538 0.25% 131 28248 0.25% 132 30297 0.27% 133 31210 0.28% 134 32501 0.29% 135 34798 0.31% 136 36245 0.33% 137 38796 0.35% 138 41122 0.37% 139 44395 0.40% 140 47569 0.43% 141 53150 0.48% 142 59309 0.53% 143 67432 0.61% 144 77237 0.69% 145 93339 0.84% 146 118816 1.07% 147 164914 1.48% 148 258614 2.32% 149 520600 4.68% 150 2830874 25.43% 151 5841751 52.47% 11133276 reads passed initial QC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=16 prefix-density=1.01 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=21.73 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.8 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTG criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=10 prefix-density=1.11 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=62.77 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.6 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT SRR7170669 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:20:05 Started mapping on | Feb 13 15:20:05 Finished on | Feb 13 15:21:27 Mapping speed, Million of reads per hour | 488.78 Number of input reads | 11133276 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10398735 Uniquely mapped reads % | 93.40% Average mapped length | 294.17 Number of splices: Total | 10500700 Number of splices: Annotated (sjdb) | 10288756 Number of splices: GT/AG | 10298140 Number of splices: GC/AG | 167461 Number of splices: AT/AC | 6717 Number of splices: Non-canonical | 28382 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287695 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 20675 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 472491 472491 472491 N_multimapping 287695 287695 287695 N_noFeature 280858 10125663 331819 N_ambiguous 306202 573 83897 UnstrandedReadsAssigned:9811675 PositiveStrandReadsAssigned:272499 NegativeStrandReadsAssigned:9983019 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170669 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170669-trimmed-pair1.fastq SRR7170669-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,133,276 reads, 9,895,671 reads pseudoaligned [quant] estimated average fragment length: 262.02 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7170669.ke.tsv 34699 SRR7170669.se.tsv 87100 total ==> SRR7170669.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.98 588 23.0811 Potri.005G024800.1.v4.1 1035 773.98 186 16.5741 Potri.004G059700.1.v4.1 961 700.014 16 1.57637 Potri.007G009000.2.v4.1 1416 1154.98 0 0 Potri.003G141000.2.v4.1 2943 2681.98 373 9.59178 Potri.016G087400.1.v4.1 270 76.9398 561 502.873 Potri.015G069301.1.v4.1 564 310.788 0 0 Potri.010G195200.1.v4.1 1773 1511.98 5 0.228071 Potri.012G127500.1.v4.1 977 715.995 30 2.88973 ==> SRR7170669.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 359 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR7170669 completed mapping pipeline successfully