Starting /dee2/code/volunteer_pipeline.sh SRR7170670 current disk space = 3088875802624 free memory = 1434479584 SRR7170670 SRAfilesize 5ff1f6aca4fd5d1f61064dde51cb7fb7 SRR7170670.sra SRR7170670.sra file validated SRR7170670 is paired end SRR7170670 is conventional basespace SRR7170670 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170670_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.95225 25.0 18.0 32.0 18.0 33.0 2 24.034 25.0 18.0 29.0 18.0 33.0 3 28.20925 29.0 27.0 31.0 25.0 33.0 4 30.6105 31.0 29.0 33.0 27.0 33.0 5 31.52725 33.0 31.0 33.0 29.0 33.0 6 36.4665 38.0 37.0 38.0 34.0 38.0 7 36.87025 38.0 37.0 38.0 35.0 38.0 8 37.26425 38.0 38.0 38.0 36.0 38.0 9 37.32375 38.0 38.0 38.0 37.0 38.0 10-14 37.3155 38.0 38.0 38.0 36.8 38.0 15-19 37.34995 38.0 38.0 38.0 37.0 38.0 20-24 37.428700000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.4683 38.0 38.0 38.0 37.2 38.0 30-34 37.414649999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.4295 38.0 38.0 38.0 37.0 38.0 40-44 37.370850000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3094 38.0 38.0 38.0 37.0 38.0 50-54 37.261 38.0 38.0 38.0 36.6 38.0 55-59 37.187200000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.08729999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.0763 38.0 38.0 38.0 36.0 38.0 70-74 36.9481 38.0 38.0 38.0 35.6 38.0 75-79 36.86149999999999 38.0 38.0 38.0 35.2 38.0 80-84 36.79855 38.0 38.0 38.0 35.0 38.0 85-89 36.73005 38.0 38.0 38.0 34.6 38.0 90-94 36.59695000000001 38.0 38.0 38.0 34.4 38.0 95-99 36.38295 38.0 37.8 38.0 34.0 38.0 100-104 36.1846 38.0 37.0 38.0 33.4 38.0 105-109 36.0573 38.0 37.0 38.0 33.0 38.0 110-114 35.73565 38.0 36.8 38.0 31.4 38.0 115-119 35.51970000000001 38.0 36.0 38.0 30.4 38.0 120-124 35.431599999999996 38.0 36.0 38.0 29.8 38.0 125-129 35.263850000000005 38.0 35.8 38.0 29.2 38.0 130-134 35.0243 38.0 35.0 38.0 28.2 38.0 135-139 34.6613 38.0 35.0 38.0 26.8 38.0 140-144 34.0714 38.0 34.4 38.0 24.6 38.0 145-149 33.04065000000001 38.0 33.2 38.0 19.8 38.0 150-151 27.884999999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 3.0 18 2.0 19 6.0 20 2.0 21 5.0 22 7.0 23 2.0 24 7.0 25 5.0 26 18.0 27 25.0 28 35.0 29 27.0 30 42.0 31 62.0 32 86.0 33 127.0 34 223.0 35 415.0 36 1060.0 37 1836.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.09235914587085 16.130692050424493 11.165423205556985 29.61152559814767 2 22.525000000000002 23.625 37.7 16.150000000000002 3 17.9 30.225 27.474999999999998 24.4 4 21.75 35.3 23.0 19.950000000000003 5 20.530796194291437 36.079118678017025 24.536805207811717 18.85327991987982 6 16.650000000000002 35.575 25.674999999999997 22.1 7 12.975 18.9 46.25 21.875 8 17.7 19.45 28.925 33.925 9 17.424999999999997 21.45 31.55 29.575000000000003 10-14 19.52 29.244999999999997 27.125 24.11 15-19 20.46 28.09 27.35 24.099999999999998 20-24 19.470000000000002 28.655 28.065 23.810000000000002 25-29 19.689999999999998 29.160000000000004 27.555000000000003 23.595 30-34 19.725 28.895 28.025 23.355 35-39 20.28 28.249999999999996 27.534999999999997 23.935000000000002 40-44 19.825 28.34 28.24 23.595 45-49 19.794999999999998 28.98 27.355 23.87 50-54 20.145 28.24 28.415000000000003 23.200000000000003 55-59 20.0 28.044999999999998 28.025 23.93 60-64 19.845 28.58 28.349999999999998 23.225 65-69 19.53 27.57 28.775000000000002 24.125 70-74 20.46 28.08 27.634999999999998 23.825 75-79 19.85 28.53 27.644999999999996 23.974999999999998 80-84 19.785 28.29 27.439999999999998 24.485 85-89 20.97 28.43 27.355 23.244999999999997 90-94 20.044999999999998 28.854999999999997 27.500000000000004 23.599999999999998 95-99 20.325 28.125 27.85 23.7 100-104 20.34 28.355000000000004 27.644999999999996 23.66 105-109 20.4 27.71 28.189999999999998 23.7 110-114 20.77 27.845 27.950000000000003 23.435 115-119 20.544999999999998 28.349999999999998 27.48 23.625 120-124 20.43 28.610000000000003 27.51 23.45 125-129 20.515 28.13 27.805000000000003 23.549999999999997 130-134 20.865000000000002 28.560000000000002 27.355 23.22 135-139 20.7 27.715 27.935 23.65 140-144 20.28 28.050000000000004 27.42 24.25 145-149 20.549999999999997 28.265 27.689999999999998 23.494999999999997 150-151 20.940117514689334 28.028503562945367 26.703337917239654 24.32804100512564 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.5 22 2.5 23 4.0 24 4.0 25 8.0 26 10.5 27 6.5 28 8.5 29 13.0 30 19.5 31 27.5 32 34.0 33 48.0 34 66.0 35 71.0 36 82.0 37 117.5 38 146.0 39 153.0 40 178.0 41 226.5 42 241.0 43 247.5 44 273.0 45 260.0 46 241.0 47 246.5 48 233.0 49 213.5 50 194.0 51 156.5 52 108.5 53 77.5 54 64.0 55 47.5 56 46.5 57 42.0 58 20.5 59 14.0 60 13.0 61 8.5 62 6.0 63 4.5 64 3.5 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5542957923910304 1.0999999999999999 3 0.07558578987150416 0.22499999999999998 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6499999999999999 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.4625000000000004 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.175 0.0 0.0 0.0 0.0 132-133 3.35 0.0 0.0 0.0 0.0 134-135 3.575 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAAGC 10 0.0068343505 144.975 145 >>END_MODULE SRR7170670 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170670_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5465 33.0 33.0 34.0 32.0 34.0 2 32.761 33.0 33.0 34.0 32.0 34.0 3 32.82325 33.0 33.0 34.0 32.0 34.0 4 32.645 33.0 33.0 34.0 32.0 34.0 5 32.738 34.0 33.0 34.0 32.0 34.0 6 36.77225 38.0 38.0 38.0 35.0 38.0 7 36.915 38.0 38.0 38.0 36.0 38.0 8 36.816 38.0 38.0 38.0 36.0 38.0 9 36.85275 38.0 38.0 38.0 36.0 38.0 10-14 36.8751 38.0 38.0 38.0 35.8 38.0 15-19 36.88190000000001 38.0 38.0 38.0 36.0 38.0 20-24 36.82555 38.0 38.0 38.0 36.0 38.0 25-29 36.7946 38.0 38.0 38.0 35.6 38.0 30-34 36.73845 38.0 38.0 38.0 35.6 38.0 35-39 36.74185 38.0 38.0 38.0 35.8 38.0 40-44 36.70085 38.0 38.0 38.0 35.4 38.0 45-49 36.708999999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.55980000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.500099999999996 38.0 38.0 38.0 34.4 38.0 60-64 36.5411 38.0 38.0 38.0 34.4 38.0 65-69 36.5206 38.0 38.0 38.0 34.6 38.0 70-74 36.4092 38.0 38.0 38.0 34.2 38.0 75-79 36.3817 38.0 38.0 38.0 34.0 38.0 80-84 36.254549999999995 38.0 38.0 38.0 33.8 38.0 85-89 36.11345 38.0 38.0 38.0 33.4 38.0 90-94 36.00645 38.0 37.8 38.0 33.2 38.0 95-99 35.810700000000004 38.0 37.0 38.0 32.6 38.0 100-104 35.67065 38.0 37.0 38.0 31.0 38.0 105-109 35.5413 38.0 37.0 38.0 31.0 38.0 110-114 35.2173 38.0 36.2 38.0 29.0 38.0 115-119 34.9656 38.0 36.0 38.0 27.8 38.0 120-124 34.8405 38.0 35.8 38.0 27.2 38.0 125-129 34.49905 38.0 34.6 38.0 26.0 38.0 130-134 33.9917 38.0 33.6 38.0 23.6 38.0 135-139 33.68085000000001 38.0 33.2 38.0 21.8 38.0 140-144 32.90565 38.0 33.0 38.0 14.8 38.0 145-149 31.90145 38.0 32.6 38.0 10.4 38.0 150-151 26.349249999999998 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 1.0 5 0.0 6 3.0 7 5.0 8 2.0 9 0.0 10 0.0 11 3.0 12 3.0 13 4.0 14 4.0 15 4.0 16 7.0 17 9.0 18 7.0 19 6.0 20 10.0 21 13.0 22 17.0 23 16.0 24 15.0 25 22.0 26 13.0 27 28.0 28 29.0 29 45.0 30 64.0 31 58.0 32 103.0 33 136.0 34 190.0 35 327.0 36 709.0 37 2135.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.775 16.3 14.000000000000002 28.925 2 23.474999999999998 24.075 34.949999999999996 17.5 3 20.424999999999997 27.750000000000004 31.624999999999996 20.200000000000003 4 23.175 37.125 21.325 18.375 5 21.575 37.824999999999996 22.575 18.025 6 17.40110165247872 38.45768652979469 24.486730095142715 19.654481722583874 7 16.883441720860432 15.307653826913455 46.39819909954978 21.410705352676338 8 19.729594391587383 22.233350025037556 27.1407110665999 30.896344516775166 9 20.460230115057527 24.96248124062031 28.264132066033014 26.313156578289142 10-14 22.01040728509957 28.38486940858601 27.81947363154208 21.78524967477234 15-19 22.473989595838333 27.601040416166466 28.776510604241697 21.1484593837535 20-24 22.28225524038221 27.98539196558107 28.720796438040924 21.011556355995797 25-29 22.167191955575564 28.570713892640953 28.030416729201065 21.231677422582422 30-34 22.118847539015608 28.146258503401363 29.076630652260903 20.658263305322127 35-39 22.50913276284842 27.953760696592106 28.389130761146973 21.1479757794125 40-44 22.77688764269978 27.40837172040857 28.099339074704588 21.71540156218706 45-49 22.68747811296213 28.20551303216769 28.315573565461005 20.791435289409176 50-54 22.759103641456583 27.796118447378955 27.766106442577033 21.678671468587435 55-59 22.36901366161237 28.183956362908475 27.678526747735578 21.768503227743583 60-64 22.519637764546953 28.503527292740284 27.59293540801521 21.383899534697555 65-69 22.57790226579303 28.149852448356928 28.35992597409093 20.912319311759113 70-74 23.17347602140321 28.15422313347002 27.76916537480622 20.903135470320546 75-79 22.93146573286643 27.898949474737368 27.99399699849925 21.17558779389695 80-84 23.58089522380595 27.826956739184794 27.961990497624406 20.630157539384847 85-89 23.572071621486444 27.858357507252173 27.70331099329799 20.86625987796339 90-94 23.133470020503076 27.879181877281596 28.219232884932737 20.768115217282592 95-99 23.0 28.255000000000003 27.98 20.765 100-104 23.881194059702985 28.036401820091005 27.42137106855343 20.661033051652584 105-109 23.68592148037009 28.267066766691674 27.45686421605401 20.59014753688422 110-114 23.348017621145374 28.11373648378054 28.04365238285943 20.494593512214657 115-119 23.706853426713355 27.988994497248626 27.793896948474238 20.51025512756378 120-124 23.42234223422342 27.86278627862786 27.647764776477647 21.067106710671066 125-129 24.06481296259252 27.89057811562313 27.845569113822766 20.19903980796159 130-134 24.163624543681554 27.414112116817524 27.809171375706356 20.61309196379457 135-139 24.176923846692684 28.22475733013109 27.644351045732012 19.953967777444213 140-144 23.83264100895851 28.266853510835293 27.796406586256943 20.104098893949253 145-149 24.265 27.85 27.21 20.674999999999997 150-151 24.125 26.55 28.749999999999996 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.5 20 2.0 21 3.0 22 3.0 23 2.0 24 5.5 25 7.0 26 7.0 27 9.0 28 10.5 29 12.5 30 17.5 31 28.0 32 36.0 33 42.0 34 53.0 35 70.5 36 87.0 37 115.5 38 136.5 39 166.0 40 193.0 41 219.5 42 252.5 43 257.5 44 276.5 45 287.0 46 262.0 47 227.0 48 197.0 49 185.0 50 162.0 51 133.0 52 112.5 53 94.0 54 74.5 55 57.5 56 54.0 57 39.0 58 23.5 59 20.5 60 18.0 61 12.5 62 8.0 63 5.0 64 4.0 65 1.5 66 0.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.15 7 0.05 8 0.15 9 0.05 10-14 0.06999999999999999 15-19 0.04 20-24 0.055 25-29 0.055 30-34 0.04 35-39 0.08499999999999999 40-44 0.13999999999999999 45-49 0.055 50-54 0.04 55-59 0.08499999999999999 60-64 0.065 65-69 0.034999999999999996 70-74 0.015 75-79 0.05 80-84 0.025 85-89 0.03 90-94 0.015 95-99 0.0 100-104 0.005 105-109 0.025 110-114 0.12 115-119 0.05 120-124 0.01 125-129 0.02 130-134 0.015 135-139 0.06999999999999999 140-144 0.095 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03846153846155 97.85000000000001 2 0.8350202429149798 1.6500000000000001 3 0.05060728744939271 0.15 4 0.025303643724696356 0.1 5 0.05060728744939271 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit GCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.0250000000000004 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.975 0.0 0.0 0.0 0.0 138-139 4.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTAG 10 0.006830828 145.0 9 GTCTTTT 10 0.006830828 145.0 7 TCTTTTA 10 0.006830828 145.0 8 >>END_MODULE Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098195 spots for SRR7170670.sra Written 1098195 spots for SRR7170670.sra Read 1098214 spots for SRR7170670.sra Written 1098214 spots for SRR7170670.sra SRR ids: ['SRR7170670.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_akso8l0u SRR7170670.sra spots: 21963919 blocks: [[1, 1098195], [1098196, 2196390], [2196391, 3294585], [3294586, 4392780], [4392781, 5490975], [5490976, 6589170], [6589171, 7687365], [7687366, 8785560], [8785561, 9883755], [9883756, 10981950], [10981951, 12080145], [12080146, 13178340], [13178341, 14276535], [14276536, 15374730], [15374731, 16472925], [16472926, 17571120], [17571121, 18669315], [18669316, 19767510], [19767511, 20865705], [20865706, 21963919]] SRR7170670 file size 7421151 SRR7170670 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170670 SRR7170670_1.fastq SRR7170670_2.fastq Input file: SRR7170670_1.fastq Paired file: SRR7170670_2.fastq trimmed: SRR7170670-trimmed-pair1.fastq, SRR7170670-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:38:33 2025 >> started Thu Feb 13 15:38:59 2025 >> done (25.804s) 21963919 read pairs processed; of these: 20680 ( 0.09%) short read pairs filtered out after trimming by size control 33543 ( 0.15%) empty read pairs filtered out after trimming by size control 21909696 (99.75%) read pairs available; of these: 11529131 (52.62%) trimmed read pairs available after processing 10380565 (47.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 14 0.00% 21 7 0.00% 22 14 0.00% 23 19 0.00% 24 10 0.00% 25 20 0.00% 26 20 0.00% 27 13 0.00% 28 11 0.00% 29 17 0.00% 30 13 0.00% 31 16 0.00% 32 16 0.00% 33 20 0.00% 34 17 0.00% 35 18 0.00% 36 28 0.00% 37 27 0.00% 38 39 0.00% 39 29 0.00% 40 41 0.00% 41 39 0.00% 42 31 0.00% 43 47 0.00% 44 59 0.00% 45 60 0.00% 46 64 0.00% 47 80 0.00% 48 103 0.00% 49 107 0.00% 50 111 0.00% 51 148 0.00% 52 144 0.00% 53 165 0.00% 54 154 0.00% 55 205 0.00% 56 199 0.00% 57 222 0.00% 58 308 0.00% 59 291 0.00% 60 318 0.00% 61 412 0.00% 62 448 0.00% 63 474 0.00% 64 506 0.00% 65 617 0.00% 66 594 0.00% 67 667 0.00% 68 734 0.00% 69 821 0.00% 70 981 0.00% 71 1137 0.01% 72 1312 0.01% 73 1525 0.01% 74 1659 0.01% 75 1819 0.01% 76 2035 0.01% 77 2310 0.01% 78 2349 0.01% 79 2600 0.01% 80 2830 0.01% 81 3080 0.01% 82 3761 0.02% 83 4331 0.02% 84 5403 0.02% 85 6092 0.03% 86 6501 0.03% 87 6859 0.03% 88 7125 0.03% 89 7762 0.04% 90 7997 0.04% 91 8812 0.04% 92 9535 0.04% 93 10034 0.05% 94 10797 0.05% 95 11392 0.05% 96 11794 0.05% 97 11968 0.05% 98 12517 0.06% 99 13120 0.06% 100 13849 0.06% 101 14902 0.07% 102 15847 0.07% 103 16560 0.08% 104 17101 0.08% 105 18343 0.08% 106 19057 0.09% 107 19430 0.09% 108 20188 0.09% 109 20364 0.09% 110 21676 0.10% 111 22591 0.10% 112 23741 0.11% 113 25148 0.11% 114 26272 0.12% 115 27336 0.12% 116 28261 0.13% 117 29321 0.13% 118 29979 0.14% 119 30874 0.14% 120 32036 0.15% 121 33326 0.15% 122 34775 0.16% 123 38068 0.17% 124 39870 0.18% 125 41389 0.19% 126 43668 0.20% 127 45214 0.21% 128 47085 0.21% 129 49095 0.22% 130 52267 0.24% 131 55144 0.25% 132 59381 0.27% 133 62914 0.29% 134 68711 0.31% 135 73430 0.34% 136 81141 0.37% 137 87957 0.40% 138 96046 0.44% 139 107201 0.49% 140 118807 0.54% 141 136005 0.62% 142 158997 0.73% 143 183310 0.84% 144 213099 0.97% 145 265339 1.21% 146 341831 1.56% 147 481212 2.20% 148 716124 3.27% 149 1357939 6.20% 150 5778915 26.38% 151 10380565 47.38% 21909696 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=455.40 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=11 prefix-density=0.81 prefix-fanout=2.3 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATC criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=23.65 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=6.3 sequence=GAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACAATTGCATCTCC SRR7170670 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:39:42 Started mapping on | Feb 13 15:39:42 Finished on | Feb 13 15:42:57 Mapping speed, Million of reads per hour | 404.49 Number of input reads | 21909696 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20184029 Uniquely mapped reads % | 92.12% Average mapped length | 294.57 Number of splices: Total | 20281099 Number of splices: Annotated (sjdb) | 19849664 Number of splices: GT/AG | 19898180 Number of splices: GC/AG | 309865 Number of splices: AT/AC | 11084 Number of splices: Non-canonical | 61970 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 647307 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 33067 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.72% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1099968 1099968 1099968 N_multimapping 647307 647307 647307 N_noFeature 726521 19834307 843830 N_ambiguous 372465 1305 139274 UnstrandedReadsAssigned:19085043 PositiveStrandReadsAssigned:348417 NegativeStrandReadsAssigned:19200925 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170670 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170670-trimmed-pair1.fastq SRR7170670-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,909,696 reads, 19,095,945 reads pseudoaligned [quant] estimated average fragment length: 285.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52401 SRR7170670.ke.tsv 34699 SRR7170670.se.tsv 87100 total ==> SRR7170670.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.71 941 25.6999 Potri.005G024800.1.v4.1 1035 750.715 383 24.157 Potri.004G059700.1.v4.1 961 676.848 3 0.209869 Potri.007G009000.2.v4.1 1416 1131.71 0 0 Potri.003G141000.2.v4.1 2943 2658.71 1392.93 24.8072 Potri.016G087400.1.v4.1 270 72.3024 763 499.678 Potri.015G069301.1.v4.1 564 291.664 0 0 Potri.010G195200.1.v4.1 1773 1488.71 386 12.2771 Potri.012G127500.1.v4.1 977 692.804 185 12.6439 ==> SRR7170670.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1176 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 375 Potri.001G212900.v4.1 481 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 32 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR7170670 completed mapping pipeline successfully