Starting /dee2/code/volunteer_pipeline.sh SRR7170671 current disk space = 3088860598272 free memory = 1413141580 SRR7170671 SRAfilesize 4d73deb0b86082aa92fb9d0e928d7f1d SRR7170671.sra SRR7170671.sra file validated SRR7170671 is paired end SRR7170671 is conventional basespace SRR7170671 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170671_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.7475 27.0 18.0 33.0 18.0 33.0 2 25.98 27.0 18.0 31.0 18.0 33.0 3 29.215 30.0 27.0 31.0 25.0 33.0 4 31.25475 33.0 31.0 33.0 29.0 33.0 5 32.2555 33.0 32.0 33.0 32.0 33.0 6 36.7065 38.0 37.0 38.0 34.0 38.0 7 36.93575 38.0 37.0 38.0 35.0 38.0 8 37.404 38.0 38.0 38.0 37.0 38.0 9 37.463 38.0 38.0 38.0 37.0 38.0 10-14 37.464299999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.5047 38.0 38.0 38.0 37.0 38.0 20-24 37.56615000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.52085 38.0 38.0 38.0 37.8 38.0 30-34 37.49255 38.0 38.0 38.0 38.0 38.0 35-39 37.4624 38.0 38.0 38.0 37.4 38.0 40-44 37.44519999999999 38.0 38.0 38.0 37.2 38.0 45-49 37.4019 38.0 38.0 38.0 37.0 38.0 50-54 37.304500000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.157349999999994 38.0 38.0 38.0 36.0 38.0 60-64 37.1408 38.0 38.0 38.0 36.0 38.0 65-69 37.10615 38.0 38.0 38.0 36.0 38.0 70-74 37.0015 38.0 38.0 38.0 36.0 38.0 75-79 36.80195 38.0 38.0 38.0 35.4 38.0 80-84 36.80555 38.0 38.0 38.0 35.6 38.0 85-89 36.64885 38.0 38.0 38.0 34.6 38.0 90-94 36.50945 38.0 38.0 38.0 34.4 38.0 95-99 36.34375 38.0 38.0 38.0 34.0 38.0 100-104 36.2498 38.0 37.6 38.0 33.8 38.0 105-109 36.16395 38.0 37.0 38.0 33.8 38.0 110-114 35.977349999999994 38.0 37.0 38.0 33.2 38.0 115-119 35.705999999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.536649999999995 38.0 36.4 38.0 31.4 38.0 125-129 35.3782 38.0 36.0 38.0 30.4 38.0 130-134 35.1744 38.0 35.6 38.0 28.6 38.0 135-139 34.8352 38.0 35.0 38.0 28.0 38.0 140-144 34.42305 38.0 34.6 38.0 25.8 38.0 145-149 33.59845 38.0 33.0 38.0 22.8 38.0 150-151 29.098125000000003 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 4.0 14 2.0 15 3.0 16 4.0 17 1.0 18 3.0 19 7.0 20 3.0 21 1.0 22 3.0 23 6.0 24 6.0 25 11.0 26 6.0 27 23.0 28 14.0 29 25.0 30 50.0 31 53.0 32 89.0 33 107.0 34 169.0 35 320.0 36 971.0 37 2115.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.349101947887675 18.745256767012393 12.370351631672149 28.535289653427775 2 21.25 22.75 37.5 18.5 3 16.125 30.875000000000004 30.099999999999998 22.900000000000002 4 19.6 34.975 24.675 20.75 5 20.135236664162285 36.83946907087403 23.516153268219384 19.509140996744303 6 15.9 36.925000000000004 25.650000000000002 21.525 7 12.049999999999999 20.7 46.625 20.625 8 17.175 21.875 27.425 33.525 9 17.075000000000003 23.275000000000002 29.9 29.75 10-14 19.1 30.049999999999997 26.945000000000004 23.905 15-19 19.12 29.475 27.905 23.5 20-24 19.535 29.865000000000002 27.495000000000005 23.105 25-29 19.52 29.455 27.095000000000002 23.93 30-34 19.29 29.830000000000002 27.405 23.474999999999998 35-39 19.189999999999998 29.875 27.389999999999997 23.544999999999998 40-44 19.535 30.2 27.07 23.195 45-49 19.525000000000002 29.125 27.6 23.75 50-54 19.88 29.185 27.42 23.515 55-59 19.615 28.754999999999995 27.785 23.845 60-64 19.915 29.445 27.42 23.22 65-69 19.650000000000002 29.060000000000002 27.529999999999998 23.76 70-74 19.235 28.96 27.355 24.45 75-79 19.375 29.294999999999998 27.1 24.23 80-84 19.759999999999998 28.865000000000002 27.155 24.22 85-89 19.855 28.910000000000004 27.02 24.215 90-94 19.63 29.220000000000002 27.395000000000003 23.755000000000003 95-99 19.509999999999998 28.895 27.73 23.865 100-104 19.705000000000002 28.560000000000002 27.49 24.245 105-109 19.75 28.705000000000002 27.33 24.215 110-114 20.22 28.015 27.095000000000002 24.67 115-119 20.73 28.025 27.76 23.485 120-124 20.47 28.389999999999997 27.229999999999997 23.91 125-129 19.85 28.435 27.284999999999997 24.43 130-134 20.349999999999998 28.46 26.365 24.825 135-139 20.395 28.035 27.025 24.545 140-144 20.349999999999998 27.500000000000004 27.155 24.995 145-149 20.315 28.405 27.02 24.26 150-151 20.27753469183648 28.30353794224278 27.815976997124643 23.6029503687961 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 1.5 12 1.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 1.0 21 1.5 22 1.5 23 4.5 24 7.0 25 7.5 26 9.0 27 12.0 28 18.0 29 28.5 30 37.0 31 43.0 32 56.5 33 62.0 34 71.5 35 105.5 36 121.5 37 128.5 38 154.5 39 169.0 40 187.5 41 203.5 42 207.5 43 214.5 44 227.5 45 232.5 46 227.5 47 207.5 48 199.0 49 188.0 50 167.5 51 146.0 52 109.5 53 93.0 54 83.5 55 72.5 56 57.5 57 40.0 58 28.0 59 20.5 60 12.5 61 8.0 62 6.5 63 4.0 64 1.0 65 1.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54628921193573 96.6 2 1.1476664116296864 2.25 3 0.22953328232593728 0.675 4 0.0 0.0 5 0.02550369803621525 0.125 6 0.0 0.0 7 0.0510073960724305 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 13 (97% over 38bp) GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.475 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.2375 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATA 10 0.0065840036 146.77216 2 CTGATAT 10 0.0065840036 146.77216 3 TTTTTTT 55 2.6763283E-4 53.371693 1 >>END_MODULE SRR7170671 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170671_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75075 33.0 33.0 34.0 32.0 34.0 2 32.84725 33.0 33.0 34.0 32.0 34.0 3 32.859 34.0 33.0 34.0 32.0 34.0 4 32.8635 34.0 33.0 34.0 32.0 34.0 5 32.828 34.0 33.0 34.0 32.0 34.0 6 36.889 38.0 38.0 38.0 36.0 38.0 7 37.029 38.0 38.0 38.0 37.0 38.0 8 37.043 38.0 38.0 38.0 37.0 38.0 9 37.0215 38.0 38.0 38.0 36.0 38.0 10-14 37.0126 38.0 38.0 38.0 36.6 38.0 15-19 36.98055 38.0 38.0 38.0 36.6 38.0 20-24 36.985200000000006 38.0 38.0 38.0 36.2 38.0 25-29 36.8985 38.0 38.0 38.0 36.2 38.0 30-34 36.881150000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.93795 38.0 38.0 38.0 36.0 38.0 40-44 36.93485 38.0 38.0 38.0 36.2 38.0 45-49 36.8815 38.0 38.0 38.0 36.0 38.0 50-54 36.82515 38.0 38.0 38.0 36.0 38.0 55-59 36.7337 38.0 38.0 38.0 35.8 38.0 60-64 36.734249999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.638549999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.6194 38.0 38.0 38.0 35.2 38.0 75-79 36.57015 38.0 38.0 38.0 35.0 38.0 80-84 36.5047 38.0 38.0 38.0 34.8 38.0 85-89 36.38805000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.294900000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.179449999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.02965 38.0 38.0 38.0 34.0 38.0 105-109 35.93615 38.0 38.0 38.0 33.2 38.0 110-114 35.71595000000001 38.0 37.6 38.0 32.0 38.0 115-119 35.423 38.0 37.0 38.0 31.0 38.0 120-124 35.46165 38.0 37.0 38.0 31.0 38.0 125-129 35.147800000000004 38.0 36.0 38.0 29.6 38.0 130-134 34.67685 38.0 36.0 38.0 27.6 38.0 135-139 34.2166 38.0 33.8 38.0 25.2 38.0 140-144 33.749199999999995 38.0 33.2 38.0 22.4 38.0 145-149 32.8999 38.0 33.0 38.0 15.8 38.0 150-151 27.811 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 2.0 5 2.0 6 3.0 7 6.0 8 0.0 9 3.0 10 2.0 11 4.0 12 2.0 13 1.0 14 3.0 15 6.0 16 7.0 17 8.0 18 2.0 19 10.0 20 4.0 21 5.0 22 7.0 23 10.0 24 10.0 25 19.0 26 20.0 27 27.0 28 20.0 29 34.0 30 55.0 31 57.0 32 70.0 33 82.0 34 151.0 35 253.0 36 635.0 37 2467.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.8 16.125 13.875000000000002 27.200000000000003 2 25.6 22.05 34.449999999999996 17.9 3 20.849999999999998 26.075 33.900000000000006 19.175 4 25.275 35.175 21.3 18.25 5 24.975 37.275000000000006 19.85 17.9 6 18.5 38.75 22.95 19.8 7 18.575 16.375 43.824999999999996 21.224999999999998 8 21.875 21.875 27.450000000000003 28.799999999999997 9 22.375 22.95 27.1 27.575 10-14 23.915 27.860000000000003 26.765 21.46 15-19 23.799999999999997 27.92 27.72 20.560000000000002 20-24 24.455 27.400000000000002 27.250000000000004 20.895 25-29 23.62 27.93 27.435 21.015 30-34 23.23 27.605 28.189999999999998 20.974999999999998 35-39 24.285 27.029999999999998 27.735 20.95 40-44 24.425 27.534999999999997 27.560000000000002 20.48 45-49 23.905 27.389999999999997 27.665 21.04 50-54 23.855 27.465 27.85 20.830000000000002 55-59 24.81 27.029999999999998 27.74 20.419999999999998 60-64 23.89 27.694999999999997 27.639999999999997 20.775 65-69 23.794999999999998 27.615000000000002 27.794999999999998 20.794999999999998 70-74 24.015 27.555000000000003 27.694999999999997 20.735 75-79 23.865 27.665 27.565 20.905 80-84 24.16 27.325 27.68 20.835 85-89 24.349999999999998 27.455000000000002 27.534999999999997 20.66 90-94 23.82 27.505000000000003 27.860000000000003 20.815 95-99 24.13 27.55 27.97 20.349999999999998 100-104 24.82 27.13 27.915 20.135 105-109 24.785 28.060000000000002 27.55 19.605 110-114 24.145 27.834999999999997 27.855 20.165 115-119 24.535 28.235 27.195000000000004 20.035 120-124 24.335 27.29 28.125 20.25 125-129 24.335 28.26 27.334999999999997 20.07 130-134 25.52 26.77 27.955000000000002 19.755 135-139 24.54 27.47 28.38 19.61 140-144 25.069999999999997 28.084999999999997 27.134999999999998 19.71 145-149 25.385 27.279999999999998 27.150000000000002 20.185 150-151 24.85310663832979 27.728466058257283 26.540817602200274 20.877609701212652 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.5 25 1.5 26 1.0 27 2.5 28 6.0 29 9.5 30 12.5 31 12.5 32 17.0 33 32.5 34 46.0 35 61.0 36 71.0 37 91.0 38 115.5 39 142.0 40 181.5 41 208.5 42 239.0 43 241.5 44 236.5 45 257.5 46 271.5 47 260.0 48 243.5 49 222.0 50 192.0 51 176.0 52 147.5 53 112.0 54 97.0 55 87.0 56 60.5 57 39.0 58 31.5 59 21.0 60 16.0 61 12.0 62 5.0 63 4.0 64 3.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.59765425803162 96.675 2 1.1218765935747066 2.1999999999999997 3 0.12748597654258031 0.375 4 0.10198878123406425 0.4 5 0.0 0.0 6 0.0 0.0 7 0.05099439061703213 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.4875 0.0 0.0 0.0 0.0 130-131 4.8125 0.0 0.0 0.0 0.0 132-133 5.175 0.0 0.0 0.0 0.0 134-135 5.4875 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGCA 10 0.006830828 145.0 4 >>END_MODULE Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559577 spots for SRR7170671.sra Written 559577 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra Read 559572 spots for SRR7170671.sra Written 559572 spots for SRR7170671.sra SRR ids: ['SRR7170671.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ma_q9r3 SRR7170671.sra spots: 11191445 blocks: [[1, 559572], [559573, 1119144], [1119145, 1678716], [1678717, 2238288], [2238289, 2797860], [2797861, 3357432], [3357433, 3917004], [3917005, 4476576], [4476577, 5036148], [5036149, 5595720], [5595721, 6155292], [6155293, 6714864], [6714865, 7274436], [7274437, 7834008], [7834009, 8393580], [8393581, 8953152], [8953153, 9512724], [9512725, 10072296], [10072297, 10631868], [10631869, 11191445]] SRR7170671 file size 3770713 SRR7170671 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170671 SRR7170671_1.fastq SRR7170671_2.fastq Input file: SRR7170671_1.fastq Paired file: SRR7170671_2.fastq trimmed: SRR7170671-trimmed-pair1.fastq, SRR7170671-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:36:07 2025 >> started Thu Feb 13 15:36:19 2025 >> done (12.881s) 11191445 read pairs processed; of these: 10768 ( 0.10%) short read pairs filtered out after trimming by size control 48414 ( 0.43%) empty read pairs filtered out after trimming by size control 11132263 (99.47%) read pairs available; of these: 5721156 (51.39%) trimmed read pairs available after processing 5411107 (48.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 6 0.00% 21 8 0.00% 22 12 0.00% 23 9 0.00% 24 11 0.00% 25 16 0.00% 26 10 0.00% 27 12 0.00% 28 13 0.00% 29 20 0.00% 30 11 0.00% 31 72 0.00% 32 12 0.00% 33 18 0.00% 34 10 0.00% 35 10 0.00% 36 25 0.00% 37 26 0.00% 38 28 0.00% 39 26 0.00% 40 30 0.00% 41 28 0.00% 42 36 0.00% 43 34 0.00% 44 47 0.00% 45 36 0.00% 46 62 0.00% 47 66 0.00% 48 81 0.00% 49 96 0.00% 50 108 0.00% 51 110 0.00% 52 128 0.00% 53 157 0.00% 54 142 0.00% 55 171 0.00% 56 145 0.00% 57 172 0.00% 58 238 0.00% 59 240 0.00% 60 274 0.00% 61 314 0.00% 62 331 0.00% 63 407 0.00% 64 421 0.00% 65 456 0.00% 66 480 0.00% 67 537 0.00% 68 563 0.01% 69 635 0.01% 70 779 0.01% 71 876 0.01% 72 1007 0.01% 73 1217 0.01% 74 1378 0.01% 75 1579 0.01% 76 2045 0.02% 77 2556 0.02% 78 2188 0.02% 79 2264 0.02% 80 2381 0.02% 81 2622 0.02% 82 3020 0.03% 83 3386 0.03% 84 4310 0.04% 85 4684 0.04% 86 5139 0.05% 87 5201 0.05% 88 5580 0.05% 89 5793 0.05% 90 6194 0.06% 91 6524 0.06% 92 7005 0.06% 93 7523 0.07% 94 7830 0.07% 95 8434 0.08% 96 8881 0.08% 97 8996 0.08% 98 9375 0.08% 99 9773 0.09% 100 10359 0.09% 101 10648 0.10% 102 11646 0.10% 103 12215 0.11% 104 13158 0.12% 105 13673 0.12% 106 13830 0.12% 107 14234 0.13% 108 14314 0.13% 109 15476 0.14% 110 15602 0.14% 111 16290 0.15% 112 17186 0.15% 113 18092 0.16% 114 18886 0.17% 115 19105 0.17% 116 19629 0.18% 117 20046 0.18% 118 20435 0.18% 119 20878 0.19% 120 21492 0.19% 121 22037 0.20% 122 22614 0.20% 123 24075 0.22% 124 24863 0.22% 125 26019 0.23% 126 26982 0.24% 127 27247 0.24% 128 28507 0.26% 129 29969 0.27% 130 30503 0.27% 131 31913 0.29% 132 33538 0.30% 133 35177 0.32% 134 37399 0.34% 135 39600 0.36% 136 42372 0.38% 137 45497 0.41% 138 48555 0.44% 139 52282 0.47% 140 57110 0.51% 141 63320 0.57% 142 70101 0.63% 143 82091 0.74% 144 96016 0.86% 145 115584 1.04% 146 145384 1.31% 147 200147 1.80% 148 309814 2.78% 149 619190 5.56% 150 2850612 25.61% 151 5411107 48.61% 11132263 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=18 prefix-density=0.67 prefix-fanout=2.4 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=44.76 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=6.6 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=13 prefix-density=0.53 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=70.39 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170671 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:37:05 Started mapping on | Feb 13 15:37:05 Finished on | Feb 13 15:38:27 Mapping speed, Million of reads per hour | 488.73 Number of input reads | 11132263 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10286131 Uniquely mapped reads % | 92.40% Average mapped length | 293.47 Number of splices: Total | 9316816 Number of splices: Annotated (sjdb) | 9128114 Number of splices: GT/AG | 9129716 Number of splices: GC/AG | 152139 Number of splices: AT/AC | 5295 Number of splices: Non-canonical | 29666 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294297 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 14278 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.77% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 563538 563538 563538 N_multimapping 294297 294297 294297 N_noFeature 255875 10039976 308723 N_ambiguous 271982 713 78500 UnstrandedReadsAssigned:9758274 PositiveStrandReadsAssigned:245442 NegativeStrandReadsAssigned:9898908 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170671 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170671-trimmed-pair1.fastq SRR7170671-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,132,263 reads, 9,832,593 reads pseudoaligned [quant] estimated average fragment length: 251.937 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52401 SRR7170671.ke.tsv 34699 SRR7170671.se.tsv 87100 total ==> SRR7170671.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.06 370 16.2225 Potri.005G024800.1.v4.1 1035 784.063 281 27.7666 Potri.004G059700.1.v4.1 961 710.078 2 0.218219 Potri.007G009000.2.v4.1 1416 1165.06 0 0 Potri.003G141000.2.v4.1 2943 2692.06 714 20.5485 Potri.016G087400.1.v4.1 270 77.6745 625 623.404 Potri.015G069301.1.v4.1 564 317.976 0 0 Potri.010G195200.1.v4.1 1773 1522.06 124.902 6.35779 Potri.012G127500.1.v4.1 977 726.068 85 9.07005 ==> SRR7170671.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 339 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 34 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170671 completed mapping pipeline successfully