Starting /dee2/code/volunteer_pipeline.sh SRR7170672 current disk space = 3088833261568 free memory = 1415544576 SRR7170672 SRAfilesize 4bb702d2769494577126a0aca6c0fb02 SRR7170672.sra SRR7170672.sra file validated SRR7170672 is paired end SRR7170672 is conventional basespace SRR7170672 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170672_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.819 18.0 18.0 31.0 18.0 33.0 2 31.02525 31.0 30.0 33.0 27.0 33.0 3 31.82875 33.0 31.0 33.0 29.0 33.0 4 32.22225 33.0 33.0 33.0 31.0 34.0 5 32.88375 33.0 33.0 34.0 32.0 34.0 6 37.166 38.0 38.0 38.0 36.0 38.0 7 37.3255 38.0 38.0 38.0 37.0 38.0 8 37.361 38.0 38.0 38.0 37.0 38.0 9 37.476 38.0 38.0 38.0 37.0 38.0 10-14 37.438900000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.43825 38.0 38.0 38.0 37.2 38.0 20-24 37.525150000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.516200000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.524899999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.49455 38.0 38.0 38.0 38.0 38.0 40-44 37.45315 38.0 38.0 38.0 37.6 38.0 45-49 37.43375 38.0 38.0 38.0 37.4 38.0 50-54 37.34225 38.0 38.0 38.0 37.0 38.0 55-59 37.2901 38.0 38.0 38.0 37.0 38.0 60-64 37.260200000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.2599 38.0 38.0 38.0 36.6 38.0 70-74 37.14635 38.0 38.0 38.0 36.0 38.0 75-79 37.09785 38.0 38.0 38.0 36.0 38.0 80-84 37.01325 38.0 38.0 38.0 36.0 38.0 85-89 37.00905 38.0 38.0 38.0 36.0 38.0 90-94 36.89065 38.0 38.0 38.0 35.2 38.0 95-99 36.748149999999995 38.0 38.0 38.0 34.8 38.0 100-104 36.60525 38.0 38.0 38.0 34.0 38.0 105-109 36.548300000000005 38.0 38.0 38.0 34.2 38.0 110-114 36.34755 38.0 37.8 38.0 34.0 38.0 115-119 36.105399999999996 38.0 37.0 38.0 33.4 38.0 120-124 36.0208 38.0 37.0 38.0 33.0 38.0 125-129 36.0149 38.0 37.0 38.0 33.2 38.0 130-134 35.746849999999995 38.0 36.4 38.0 31.6 38.0 135-139 35.5154 38.0 36.0 38.0 31.0 38.0 140-144 34.853699999999996 38.0 34.6 38.0 28.0 38.0 145-149 34.171049999999994 38.0 33.6 38.0 26.2 38.0 150-151 30.283375 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 1.0 18 3.0 19 1.0 20 0.0 21 2.0 22 7.0 23 7.0 24 4.0 25 7.0 26 8.0 27 18.0 28 22.0 29 30.0 30 32.0 31 48.0 32 56.0 33 84.0 34 157.0 35 261.0 36 731.0 37 2516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.8939393939394 17.12121212121212 15.429292929292929 30.555555555555557 2 19.5 26.474999999999998 34.675 19.35 3 16.400000000000002 31.1 29.275000000000002 23.225 4 21.425 37.7 22.725 18.15 5 20.62295905551369 37.226827430293895 23.687515699572973 18.462697814619442 6 16.6 34.150000000000006 24.925 24.325 7 12.2 19.650000000000002 47.05 21.099999999999998 8 17.424999999999997 20.599999999999998 29.225 32.75 9 17.4 21.925 29.925 30.75 10-14 18.93 30.39 26.63 24.05 15-19 19.580000000000002 28.515 28.13 23.775 20-24 19.845 29.125 27.195000000000004 23.835 25-29 19.93 28.765 27.805000000000003 23.5 30-34 19.34 28.68 27.779999999999998 24.2 35-39 19.915 28.754999999999995 28.005000000000003 23.325000000000003 40-44 19.71 28.544999999999998 27.905 23.84 45-49 19.895 28.175 27.73 24.2 50-54 19.865 28.51 27.675 23.95 55-59 20.044999999999998 28.645 27.744999999999997 23.565 60-64 19.71 28.835 27.125 24.33 65-69 20.25 28.499999999999996 27.134999999999998 24.115000000000002 70-74 20.244999999999997 28.88 27.794999999999998 23.080000000000002 75-79 19.595000000000002 29.060000000000002 27.3 24.044999999999998 80-84 20.265 28.689999999999998 27.005000000000003 24.04 85-89 20.45 28.595 27.35 23.605 90-94 20.5 28.63 27.584999999999997 23.285 95-99 20.31 28.59 27.6 23.5 100-104 19.950000000000003 28.22 27.750000000000004 24.08 105-109 20.830000000000002 28.215 27.355 23.599999999999998 110-114 20.215 28.355000000000004 27.415 24.015 115-119 20.91 28.804999999999996 27.034999999999997 23.25 120-124 20.695 28.804999999999996 27.169999999999998 23.330000000000002 125-129 21.085 28.075 26.834999999999997 24.005000000000003 130-134 20.515 28.365000000000002 26.985 24.135 135-139 20.945 27.779999999999998 27.51 23.765 140-144 20.815 27.88 27.084999999999997 24.22 145-149 21.15 27.615000000000002 27.855 23.380000000000003 150-151 20.913642052565706 27.847309136420527 26.80851063829787 24.430538172715895 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 3.0 23 2.0 24 3.5 25 5.0 26 5.5 27 8.5 28 12.0 29 15.5 30 28.5 31 40.0 32 51.0 33 54.0 34 61.5 35 83.5 36 103.5 37 127.0 38 144.5 39 159.0 40 184.5 41 206.0 42 222.0 43 242.5 44 235.0 45 236.0 46 257.5 47 245.0 48 230.0 49 215.5 50 178.5 51 140.0 52 115.0 53 94.0 54 70.0 55 56.0 56 50.5 57 36.0 58 22.5 59 16.5 60 10.0 61 7.0 62 4.0 63 3.0 64 2.0 65 1.5 66 2.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.475 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26860025220681 98.4 2 0.605296343001261 1.2 3 0.1008827238335435 0.3 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.775 0.0 0.0 0.0 0.0 132-133 3.95 0.0 0.0 0.0 0.0 134-135 4.300000000000001 0.0 0.0 0.0 0.0 136-137 4.65 0.0 0.0 0.0 0.0 138-139 5.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170672 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170672_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6075 33.0 33.0 34.0 32.0 34.0 2 32.72325 33.0 33.0 34.0 32.0 34.0 3 32.87925 34.0 33.0 34.0 32.0 34.0 4 32.6825 33.0 33.0 34.0 32.0 34.0 5 32.7025 33.0 33.0 34.0 32.0 34.0 6 36.85775 38.0 38.0 38.0 36.0 38.0 7 36.878 38.0 38.0 38.0 36.0 38.0 8 36.99875 38.0 38.0 38.0 36.0 38.0 9 36.88775 38.0 38.0 38.0 36.0 38.0 10-14 36.9052 38.0 38.0 38.0 36.2 38.0 15-19 36.814550000000004 38.0 38.0 38.0 36.2 38.0 20-24 36.8644 38.0 38.0 38.0 36.0 38.0 25-29 36.786649999999995 38.0 38.0 38.0 36.2 38.0 30-34 36.84655 38.0 38.0 38.0 36.2 38.0 35-39 36.8368 38.0 38.0 38.0 36.2 38.0 40-44 36.81275 38.0 38.0 38.0 36.2 38.0 45-49 36.7996 38.0 38.0 38.0 36.0 38.0 50-54 36.7451 38.0 38.0 38.0 36.0 38.0 55-59 36.71635 38.0 38.0 38.0 36.0 38.0 60-64 36.692949999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.6306 38.0 38.0 38.0 36.0 38.0 70-74 36.66995 38.0 38.0 38.0 36.0 38.0 75-79 36.56295 38.0 38.0 38.0 35.4 38.0 80-84 36.472899999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.41885 38.0 38.0 38.0 35.0 38.0 90-94 36.3505 38.0 38.0 38.0 34.4 38.0 95-99 36.259 38.0 38.0 38.0 34.0 38.0 100-104 36.1033 38.0 38.0 38.0 33.8 38.0 105-109 36.0977 38.0 38.0 38.0 34.0 38.0 110-114 35.854299999999995 38.0 37.8 38.0 32.8 38.0 115-119 35.7002 38.0 37.2 38.0 32.4 38.0 120-124 35.53775 38.0 37.2 38.0 31.6 38.0 125-129 35.210300000000004 38.0 36.2 38.0 29.4 38.0 130-134 34.8655 38.0 36.0 38.0 28.2 38.0 135-139 34.65989999999999 38.0 36.0 38.0 27.8 38.0 140-144 34.200900000000004 38.0 34.8 38.0 26.0 38.0 145-149 33.398849999999996 38.0 33.6 38.0 19.6 38.0 150-151 28.163625000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 8.0 4 6.0 5 5.0 6 1.0 7 3.0 8 3.0 9 0.0 10 3.0 11 2.0 12 4.0 13 1.0 14 0.0 15 9.0 16 4.0 17 4.0 18 9.0 19 1.0 20 5.0 21 7.0 22 8.0 23 8.0 24 14.0 25 15.0 26 19.0 27 16.0 28 23.0 29 33.0 30 49.0 31 54.0 32 56.0 33 78.0 34 134.0 35 227.0 36 582.0 37 2596.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.475 17.25 14.924999999999999 27.35 2 24.275 24.05 34.050000000000004 17.625 3 20.525 25.674999999999997 32.75 21.05 4 23.175 35.025 22.525000000000002 19.275000000000002 5 23.400000000000002 37.3 21.425 17.875 6 18.125 37.15 23.275000000000002 21.45 7 17.65 15.675 45.725 20.95 8 21.575 21.05 26.974999999999998 30.4 9 22.175 23.825 28.125 25.874999999999996 10-14 22.86 28.585 27.125 21.43 15-19 23.01 27.36 28.439999999999998 21.19 20-24 22.725 28.005000000000003 28.185 21.085 25-29 23.66 27.91 27.68 20.75 30-34 22.21 28.605000000000004 27.634999999999998 21.55 35-39 22.795 28.025 27.915 21.265 40-44 23.465 28.255000000000003 27.794999999999998 20.485 45-49 22.73 27.639999999999997 27.860000000000003 21.77 50-54 23.055 28.349999999999998 27.400000000000002 21.195 55-59 22.96 27.775 28.225 21.04 60-64 23.465 27.939999999999998 27.474999999999998 21.12 65-69 23.31 27.650000000000002 27.51 21.529999999999998 70-74 23.385 28.075 27.395000000000003 21.145 75-79 23.425 27.24 27.575 21.759999999999998 80-84 23.365 27.785 27.42 21.43 85-89 23.919999999999998 28.455000000000002 26.875 20.75 90-94 23.635 27.96 27.825 20.580000000000002 95-99 23.36 27.650000000000002 28.215 20.775 100-104 23.724999999999998 27.55 27.939999999999998 20.785 105-109 23.47 28.57 27.275 20.685000000000002 110-114 23.695 27.694999999999997 27.944999999999997 20.665 115-119 24.62 27.200000000000003 27.92 20.26 120-124 23.95 27.750000000000004 27.71 20.59 125-129 24.185000000000002 27.625 27.99 20.200000000000003 130-134 24.295 27.495000000000005 28.255000000000003 19.955000000000002 135-139 24.610000000000003 27.750000000000004 27.51 20.13 140-144 24.635 27.6 27.445000000000004 20.32 145-149 24.07 27.839999999999996 27.965 20.125 150-151 24.946855070651495 28.048018006752535 27.697886707515316 19.307240215080657 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 2.0 21 2.5 22 2.0 23 3.5 24 4.0 25 3.5 26 3.5 27 7.0 28 11.5 29 12.5 30 17.5 31 25.0 32 32.0 33 42.0 34 51.5 35 57.5 36 66.0 37 96.0 38 135.5 39 151.5 40 171.0 41 208.0 42 219.5 43 225.0 44 255.5 45 281.5 46 279.5 47 262.5 48 232.5 49 204.0 50 190.5 51 166.0 52 130.5 53 102.5 54 82.5 55 65.5 56 56.5 57 43.0 58 26.5 59 20.0 60 16.5 61 11.0 62 7.5 63 4.5 64 1.0 65 1.5 66 1.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93643960496328 97.675 2 0.9116231957457585 1.7999999999999998 3 0.10129146619397315 0.3 4 0.02532286654849329 0.1 5 0.02532286654849329 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.3375 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 3.975 0.0 0.0 0.0 0.0 134-135 4.324999999999999 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 5.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGCA 10 0.006830828 145.0 8 >>END_MODULE Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708512 spots for SRR7170672.sra Written 708512 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra Read 708506 spots for SRR7170672.sra Written 708506 spots for SRR7170672.sra SRR ids: ['SRR7170672.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h149fbli SRR7170672.sra spots: 14170126 blocks: [[1, 708506], [708507, 1417012], [1417013, 2125518], [2125519, 2834024], [2834025, 3542530], [3542531, 4251036], [4251037, 4959542], [4959543, 5668048], [5668049, 6376554], [6376555, 7085060], [7085061, 7793566], [7793567, 8502072], [8502073, 9210578], [9210579, 9919084], [9919085, 10627590], [10627591, 11336096], [11336097, 12044602], [12044603, 12753108], [12753109, 13461614], [13461615, 14170126]] SRR7170672 file size 4780090 SRR7170672 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170672 SRR7170672_1.fastq SRR7170672_2.fastq Input file: SRR7170672_1.fastq Paired file: SRR7170672_2.fastq trimmed: SRR7170672-trimmed-pair1.fastq, SRR7170672-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:38:22 2025 >> started Thu Feb 13 15:38:38 2025 >> done (16.275s) 14170126 read pairs processed; of these: 17386 ( 0.12%) short read pairs filtered out after trimming by size control 22377 ( 0.16%) empty read pairs filtered out after trimming by size control 14130363 (99.72%) read pairs available; of these: 6787442 (48.03%) trimmed read pairs available after processing 7342921 (51.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 6 0.00% 21 9 0.00% 22 7 0.00% 23 12 0.00% 24 10 0.00% 25 16 0.00% 26 10 0.00% 27 7 0.00% 28 8 0.00% 29 10 0.00% 30 6 0.00% 31 11 0.00% 32 18 0.00% 33 7 0.00% 34 9 0.00% 35 14 0.00% 36 18 0.00% 37 14 0.00% 38 20 0.00% 39 16 0.00% 40 13 0.00% 41 22 0.00% 42 18 0.00% 43 20 0.00% 44 21 0.00% 45 25 0.00% 46 18 0.00% 47 29 0.00% 48 31 0.00% 49 58 0.00% 50 43 0.00% 51 61 0.00% 52 72 0.00% 53 79 0.00% 54 69 0.00% 55 72 0.00% 56 86 0.00% 57 84 0.00% 58 113 0.00% 59 123 0.00% 60 145 0.00% 61 196 0.00% 62 221 0.00% 63 228 0.00% 64 287 0.00% 65 278 0.00% 66 316 0.00% 67 315 0.00% 68 391 0.00% 69 490 0.00% 70 549 0.00% 71 665 0.00% 72 761 0.01% 73 791 0.01% 74 927 0.01% 75 1040 0.01% 76 1251 0.01% 77 1420 0.01% 78 1435 0.01% 79 1615 0.01% 80 1823 0.01% 81 2070 0.01% 82 2365 0.02% 83 2771 0.02% 84 3871 0.03% 85 4472 0.03% 86 4789 0.03% 87 5362 0.04% 88 5616 0.04% 89 5746 0.04% 90 6058 0.04% 91 6510 0.05% 92 7012 0.05% 93 7549 0.05% 94 7908 0.06% 95 8385 0.06% 96 8800 0.06% 97 9105 0.06% 98 9538 0.07% 99 10017 0.07% 100 10657 0.08% 101 11323 0.08% 102 12059 0.09% 103 12633 0.09% 104 13283 0.09% 105 13820 0.10% 106 14406 0.10% 107 15308 0.11% 108 15230 0.11% 109 15994 0.11% 110 17154 0.12% 111 17433 0.12% 112 18461 0.13% 113 19294 0.14% 114 20114 0.14% 115 20538 0.15% 116 21243 0.15% 117 21803 0.15% 118 22600 0.16% 119 23019 0.16% 120 23950 0.17% 121 24860 0.18% 122 25588 0.18% 123 27069 0.19% 124 27917 0.20% 125 28765 0.20% 126 30067 0.21% 127 30881 0.22% 128 32352 0.23% 129 33345 0.24% 130 35210 0.25% 131 35712 0.25% 132 37992 0.27% 133 39943 0.28% 134 42380 0.30% 135 44236 0.31% 136 47183 0.33% 137 50245 0.36% 138 53712 0.38% 139 57966 0.41% 140 62877 0.44% 141 70378 0.50% 142 79453 0.56% 143 89925 0.64% 144 104889 0.74% 145 125901 0.89% 146 160623 1.14% 147 221857 1.57% 148 344735 2.44% 149 686530 4.86% 150 3640143 25.76% 151 7342921 51.97% 14130363 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=19 prefix-density=0.67 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=317.34 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=11 prefix-density=0.85 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=124.83 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTC SRR7170672 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:39:19 Started mapping on | Feb 13 15:39:20 Finished on | Feb 13 15:40:52 Mapping speed, Million of reads per hour | 552.93 Number of input reads | 14130363 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13366223 Uniquely mapped reads % | 94.59% Average mapped length | 294.60 Number of splices: Total | 13187203 Number of splices: Annotated (sjdb) | 12899339 Number of splices: GT/AG | 12931745 Number of splices: GC/AG | 211079 Number of splices: AT/AC | 8196 Number of splices: Non-canonical | 36183 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372632 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 35482 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 410951 410951 410951 N_multimapping 372632 372632 372632 N_noFeature 509211 13118356 582159 N_ambiguous 272438 846 97046 UnstrandedReadsAssigned:12584574 PositiveStrandReadsAssigned:247021 NegativeStrandReadsAssigned:12687018 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170672 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170672-trimmed-pair1.fastq SRR7170672-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,130,363 reads, 12,634,771 reads pseudoaligned [quant] estimated average fragment length: 263.245 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7170672.ke.tsv 34699 SRR7170672.se.tsv 87100 total ==> SRR7170672.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.76 667 25.9906 Potri.005G024800.1.v4.1 1035 772.755 114 10.0929 Potri.004G059700.1.v4.1 961 698.808 17 1.66435 Potri.007G009000.2.v4.1 1416 1153.76 0 0 Potri.003G141000.2.v4.1 2943 2680.76 646 16.4865 Potri.016G087400.1.v4.1 270 77.0263 652 579.112 Potri.015G069301.1.v4.1 564 310.318 0 0 Potri.010G195200.1.v4.1 1773 1510.76 17 0.769855 Potri.012G127500.1.v4.1 977 714.766 105 10.0503 ==> SRR7170672.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1277 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 7 SRR7170672 completed mapping pipeline successfully