Starting /dee2/code/volunteer_pipeline.sh SRR7170673 current disk space = 3088771207168 free memory = 1491177872 SRR7170673 SRAfilesize 0910cf29faf06a56017905966683323a SRR7170673.sra SRR7170673.sra file validated SRR7170673 is paired end SRR7170673 is conventional basespace SRR7170673 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170673_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.50525 30.0 18.0 32.0 18.0 33.0 2 24.32175 25.0 18.0 29.0 18.0 33.0 3 27.27125 29.0 25.0 31.0 18.0 33.0 4 31.41475 32.0 32.0 33.0 27.0 33.0 5 31.88925 33.0 32.0 33.0 31.0 33.0 6 36.49075 38.0 37.0 38.0 34.0 38.0 7 36.77825 38.0 37.0 38.0 35.0 38.0 8 37.19525 38.0 38.0 38.0 36.0 38.0 9 37.079 38.0 38.0 38.0 36.0 38.0 10-14 37.3466 38.0 38.0 38.0 36.8 38.0 15-19 37.37865 38.0 38.0 38.0 37.2 38.0 20-24 37.5103 38.0 38.0 38.0 37.4 38.0 25-29 37.48775 38.0 38.0 38.0 38.0 38.0 30-34 37.43695 38.0 38.0 38.0 37.4 38.0 35-39 37.39209999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.355850000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3246 38.0 38.0 38.0 37.0 38.0 50-54 37.2661 38.0 38.0 38.0 37.0 38.0 55-59 37.199 38.0 38.0 38.0 36.2 38.0 60-64 37.152750000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.08480000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.04155 38.0 38.0 38.0 36.0 38.0 75-79 36.93715 38.0 38.0 38.0 36.0 38.0 80-84 36.879650000000005 38.0 38.0 38.0 35.4 38.0 85-89 36.77895 38.0 38.0 38.0 35.0 38.0 90-94 36.5961 38.0 38.0 38.0 34.4 38.0 95-99 36.4815 38.0 38.0 38.0 34.0 38.0 100-104 36.31385 38.0 37.6 38.0 33.8 38.0 105-109 36.17475 38.0 37.0 38.0 33.4 38.0 110-114 35.971700000000006 38.0 37.0 38.0 32.6 38.0 115-119 35.59305 38.0 36.2 38.0 30.6 38.0 120-124 35.5737 38.0 36.0 38.0 31.0 38.0 125-129 35.50505 38.0 36.0 38.0 31.0 38.0 130-134 35.237700000000004 38.0 35.8 38.0 29.6 38.0 135-139 34.68705 38.0 34.4 38.0 27.6 38.0 140-144 34.0086 38.0 33.8 38.0 24.0 38.0 145-149 33.3892 38.0 33.0 38.0 22.0 38.0 150-151 29.152874999999998 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 0.0 17 1.0 18 2.0 19 3.0 20 2.0 21 4.0 22 5.0 23 5.0 24 9.0 25 11.0 26 11.0 27 20.0 28 23.0 29 32.0 30 40.0 31 55.0 32 75.0 33 104.0 34 218.0 35 354.0 36 1019.0 37 1997.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.51026694045174 18.198151950718685 8.521560574948666 25.770020533880906 2 22.95 21.2 35.775 20.075000000000003 3 15.6 31.225 29.549999999999997 23.625 4 20.65 34.625 25.224999999999998 19.5 5 20.555833750625936 35.60340510766149 22.684026039058587 21.156735102653982 6 16.775000000000002 35.05 24.725 23.45 7 12.325 21.075 45.574999999999996 21.025 8 18.25 21.3 26.8 33.650000000000006 9 15.950000000000001 21.55 30.375000000000004 32.125 10-14 19.794999999999998 29.01 26.77 24.425 15-19 20.07 28.425 27.815 23.69 20-24 19.105 28.84 27.67 24.385 25-29 19.735 29.244999999999997 27.685 23.335 30-34 19.57 28.645 28.03 23.755000000000003 35-39 20.195 28.815 27.495000000000005 23.494999999999997 40-44 19.475 28.4 28.060000000000002 24.065 45-49 19.585 28.895 27.66 23.86 50-54 20.085 28.560000000000002 27.79 23.565 55-59 19.77 28.945 27.77 23.515 60-64 20.035 28.235 27.99 23.74 65-69 19.84 28.560000000000002 27.955000000000002 23.645 70-74 19.715 28.244999999999997 27.939999999999998 24.099999999999998 75-79 19.900000000000002 28.244999999999997 28.015 23.84 80-84 19.900000000000002 28.315 27.97 23.815 85-89 19.580000000000002 28.634999999999998 27.965 23.82 90-94 20.169999999999998 28.575 27.284999999999997 23.97 95-99 20.075000000000003 28.305000000000003 28.365000000000002 23.255 100-104 20.165 28.1 27.935 23.799999999999997 105-109 20.205000000000002 28.360000000000003 27.425 24.01 110-114 20.64 27.860000000000003 27.91 23.59 115-119 20.445 28.015 27.955000000000002 23.585 120-124 20.3 28.57 27.810000000000002 23.32 125-129 20.205000000000002 28.52 27.465 23.810000000000002 130-134 20.794999999999998 28.48 26.995 23.73 135-139 20.645 28.165000000000003 27.765 23.425 140-144 21.265 27.384999999999998 27.560000000000002 23.79 145-149 20.46 28.505000000000003 27.089999999999996 23.945 150-151 20.349999999999998 28.3125 27.950000000000003 23.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 3.0 22 2.0 23 0.0 24 1.5 25 4.0 26 5.5 27 6.5 28 7.0 29 12.5 30 21.0 31 29.0 32 45.0 33 53.5 34 65.0 35 76.0 36 86.5 37 123.0 38 143.0 39 161.0 40 177.0 41 210.0 42 256.5 43 270.0 44 262.5 45 250.5 46 260.5 47 254.5 48 229.5 49 195.5 50 154.0 51 143.5 52 126.0 53 89.0 54 73.5 55 61.5 56 41.5 57 29.5 58 19.5 59 11.0 60 10.0 61 7.5 62 6.0 63 4.5 64 3.0 65 1.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.0374999999999996 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 2.95 0.0 0.0 0.0 0.0 138-139 3.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGTTC 10 0.0068343505 144.975 5 >>END_MODULE SRR7170673 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170673_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5585 33.0 33.0 34.0 32.0 34.0 2 32.604 33.0 33.0 34.0 32.0 34.0 3 32.6115 33.0 33.0 34.0 32.0 34.0 4 32.57425 33.0 33.0 34.0 32.0 34.0 5 32.59575 33.0 33.0 34.0 32.0 34.0 6 36.73175 38.0 38.0 38.0 35.0 38.0 7 36.73 38.0 38.0 38.0 36.0 38.0 8 36.6545 38.0 38.0 38.0 36.0 38.0 9 36.63575 38.0 38.0 38.0 36.0 38.0 10-14 36.68300000000001 38.0 38.0 38.0 35.8 38.0 15-19 36.62405 38.0 38.0 38.0 35.2 38.0 20-24 36.6511 38.0 38.0 38.0 35.2 38.0 25-29 36.51135000000001 38.0 38.0 38.0 35.2 38.0 30-34 36.438900000000004 38.0 38.0 38.0 34.8 38.0 35-39 36.5162 38.0 38.0 38.0 35.0 38.0 40-44 36.495349999999995 38.0 38.0 38.0 35.0 38.0 45-49 36.39 38.0 38.0 38.0 34.4 38.0 50-54 36.27135 38.0 38.0 38.0 34.0 38.0 55-59 36.2655 38.0 38.0 38.0 34.2 38.0 60-64 36.21455 38.0 38.0 38.0 34.0 38.0 65-69 36.11265 38.0 38.0 38.0 33.6 38.0 70-74 36.14125 38.0 38.0 38.0 33.8 38.0 75-79 36.03065 38.0 38.0 38.0 33.4 38.0 80-84 36.02055 38.0 38.0 38.0 33.8 38.0 85-89 35.841950000000004 38.0 38.0 38.0 33.0 38.0 90-94 35.687250000000006 38.0 37.4 38.0 32.2 38.0 95-99 35.4911 38.0 37.0 38.0 30.6 38.0 100-104 35.40965 38.0 37.0 38.0 30.2 38.0 105-109 35.323750000000004 38.0 37.0 38.0 30.2 38.0 110-114 34.8637 38.0 36.2 38.0 27.4 38.0 115-119 34.76855 38.0 36.0 38.0 27.4 38.0 120-124 34.658 38.0 36.0 38.0 27.0 38.0 125-129 34.212199999999996 38.0 35.0 38.0 24.6 38.0 130-134 33.468599999999995 38.0 33.0 38.0 21.0 38.0 135-139 33.18775 38.0 33.0 38.0 17.4 38.0 140-144 32.3147 38.0 33.0 38.0 13.0 38.0 145-149 31.177249999999997 38.0 31.4 38.0 6.2 38.0 150-151 25.792625 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 14.0 4 0.0 5 4.0 6 2.0 7 2.0 8 5.0 9 4.0 10 7.0 11 6.0 12 5.0 13 5.0 14 9.0 15 6.0 16 7.0 17 4.0 18 6.0 19 13.0 20 8.0 21 16.0 22 13.0 23 17.0 24 21.0 25 21.0 26 32.0 27 30.0 28 41.0 29 38.0 30 53.0 31 57.0 32 76.0 33 136.0 34 169.0 35 324.0 36 709.0 37 2127.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.65 16.950000000000003 12.975 22.425 2 23.575 22.1 34.0 20.325 3 20.25 25.35 35.175 19.225 4 25.95 33.125 21.45 19.475 5 21.7 38.875 22.2 17.224999999999998 6 19.2 36.35 24.05 20.4 7 17.275 16.900000000000002 44.824999999999996 21.0 8 20.599999999999998 21.349999999999998 27.200000000000003 30.85 9 20.325 24.4 28.95 26.325 10-14 22.085 28.470000000000002 27.43 22.015 15-19 22.145 27.634999999999998 28.555000000000003 21.665 20-24 22.36 27.534999999999997 28.535 21.57 25-29 22.615 28.59 27.584999999999997 21.21 30-34 22.79 27.675 28.365000000000002 21.17 35-39 23.05 28.235 27.73 20.985 40-44 22.84 27.815 28.115000000000002 21.23 45-49 22.665 27.51 28.71 21.115000000000002 50-54 22.85 27.925 27.900000000000002 21.325 55-59 22.615 27.685 27.950000000000003 21.75 60-64 23.215 28.494999999999997 27.46 20.830000000000002 65-69 22.919999999999998 28.000000000000004 27.595 21.485000000000003 70-74 23.255 28.38 27.37 20.995 75-79 22.96 28.025 28.33 20.685000000000002 80-84 22.86 27.73 28.42 20.990000000000002 85-89 23.474999999999998 27.52 27.71 21.295 90-94 23.585 28.075 27.67 20.669999999999998 95-99 22.91 28.015 28.375 20.7 100-104 23.14 28.415000000000003 27.82 20.625 105-109 23.305 27.915 27.925 20.855 110-114 23.435 27.889999999999997 28.025 20.65 115-119 23.52 27.855 27.834999999999997 20.79 120-124 23.65 28.410000000000004 27.400000000000002 20.54 125-129 24.035 28.000000000000004 27.76 20.205000000000002 130-134 23.74 28.294999999999998 27.87 20.095 135-139 24.165 27.58 27.785 20.47 140-144 24.055 28.255000000000003 27.525 20.165 145-149 23.965 27.72 27.994999999999997 20.32 150-151 23.825 27.875 28.012500000000003 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 1.0 18 2.5 19 1.5 20 0.0 21 0.0 22 1.5 23 3.5 24 3.5 25 3.5 26 5.5 27 7.0 28 6.0 29 8.5 30 16.5 31 26.0 32 27.5 33 29.5 34 46.0 35 68.5 36 86.0 37 102.0 38 122.0 39 153.0 40 185.5 41 211.5 42 236.5 43 273.0 44 295.0 45 286.0 46 277.0 47 259.0 48 240.0 49 201.0 50 156.0 51 127.0 52 108.0 53 101.0 54 87.0 55 66.0 56 48.0 57 37.5 58 28.0 59 21.5 60 12.5 61 6.0 62 4.5 63 2.0 64 3.5 65 3.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01290812452544 97.8 2 0.759301442672741 1.5 3 0.20248038471273097 0.6 4 0.02531004808909137 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016320 spots for SRR7170673.sra Written 1016320 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra Read 1016318 spots for SRR7170673.sra Written 1016318 spots for SRR7170673.sra SRR ids: ['SRR7170673.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z183yqpc SRR7170673.sra spots: 20326362 blocks: [[1, 1016318], [1016319, 2032636], [2032637, 3048954], [3048955, 4065272], [4065273, 5081590], [5081591, 6097908], [6097909, 7114226], [7114227, 8130544], [8130545, 9146862], [9146863, 10163180], [10163181, 11179498], [11179499, 12195816], [12195817, 13212134], [13212135, 14228452], [14228453, 15244770], [15244771, 16261088], [16261089, 17277406], [17277407, 18293724], [18293725, 19310042], [19310043, 20326362]] SRR7170673 file size 6866236 SRR7170673 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170673 SRR7170673_1.fastq SRR7170673_2.fastq Input file: SRR7170673_1.fastq Paired file: SRR7170673_2.fastq trimmed: SRR7170673-trimmed-pair1.fastq, SRR7170673-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:51:16 2025 >> started Thu Feb 13 15:51:38 2025 >> done (22.673s) 20326362 read pairs processed; of these: 32409 ( 0.16%) short read pairs filtered out after trimming by size control 33687 ( 0.17%) empty read pairs filtered out after trimming by size control 20260266 (99.67%) read pairs available; of these: 11079578 (54.69%) trimmed read pairs available after processing 9180688 (45.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 17 0.00% 20 10 0.00% 21 10 0.00% 22 12 0.00% 23 8 0.00% 24 17 0.00% 25 13 0.00% 26 14 0.00% 27 15 0.00% 28 12 0.00% 29 18 0.00% 30 14 0.00% 31 20 0.00% 32 12 0.00% 33 17 0.00% 34 22 0.00% 35 16 0.00% 36 18 0.00% 37 23 0.00% 38 30 0.00% 39 26 0.00% 40 40 0.00% 41 48 0.00% 42 41 0.00% 43 48 0.00% 44 42 0.00% 45 52 0.00% 46 77 0.00% 47 43 0.00% 48 69 0.00% 49 94 0.00% 50 97 0.00% 51 98 0.00% 52 109 0.00% 53 111 0.00% 54 113 0.00% 55 140 0.00% 56 146 0.00% 57 179 0.00% 58 203 0.00% 59 210 0.00% 60 244 0.00% 61 331 0.00% 62 301 0.00% 63 375 0.00% 64 419 0.00% 65 422 0.00% 66 504 0.00% 67 542 0.00% 68 542 0.00% 69 663 0.00% 70 688 0.00% 71 896 0.00% 72 1010 0.00% 73 1153 0.01% 74 1211 0.01% 75 1377 0.01% 76 1690 0.01% 77 1871 0.01% 78 1867 0.01% 79 2005 0.01% 80 2211 0.01% 81 2599 0.01% 82 2950 0.01% 83 3501 0.02% 84 5087 0.03% 85 5917 0.03% 86 6221 0.03% 87 6499 0.03% 88 6764 0.03% 89 6958 0.03% 90 7545 0.04% 91 7915 0.04% 92 8589 0.04% 93 8961 0.04% 94 9558 0.05% 95 9905 0.05% 96 10487 0.05% 97 10883 0.05% 98 11120 0.05% 99 11909 0.06% 100 12232 0.06% 101 13037 0.06% 102 14083 0.07% 103 14766 0.07% 104 15566 0.08% 105 16434 0.08% 106 16995 0.08% 107 17562 0.09% 108 18349 0.09% 109 18935 0.09% 110 19800 0.10% 111 20786 0.10% 112 21751 0.11% 113 22871 0.11% 114 24019 0.12% 115 24764 0.12% 116 25890 0.13% 117 27153 0.13% 118 27642 0.14% 119 28731 0.14% 120 30037 0.15% 121 31457 0.16% 122 33769 0.17% 123 35423 0.17% 124 37295 0.18% 125 38772 0.19% 126 40937 0.20% 127 43393 0.21% 128 45245 0.22% 129 48043 0.24% 130 50096 0.25% 131 53575 0.26% 132 58100 0.29% 133 62163 0.31% 134 68222 0.34% 135 72871 0.36% 136 79337 0.39% 137 87027 0.43% 138 95157 0.47% 139 106507 0.53% 140 119910 0.59% 141 135568 0.67% 142 153769 0.76% 143 179136 0.88% 144 214085 1.06% 145 267465 1.32% 146 335552 1.66% 147 459292 2.27% 148 707878 3.49% 149 1385231 6.84% 150 5436893 26.84% 151 9180688 45.31% 20260266 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=36.63 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=11.2 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=25 prefix-density=1.01 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=101.21 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170673 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:52:19 Started mapping on | Feb 13 15:52:19 Finished on | Feb 13 15:54:32 Mapping speed, Million of reads per hour | 548.40 Number of input reads | 20260266 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18955433 Uniquely mapped reads % | 93.56% Average mapped length | 294.34 Number of splices: Total | 19082301 Number of splices: Annotated (sjdb) | 18665837 Number of splices: GT/AG | 18731797 Number of splices: GC/AG | 291390 Number of splices: AT/AC | 10928 Number of splices: Non-canonical | 48186 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 503103 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 30001 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 833137 833137 833137 N_multimapping 503103 503103 503103 N_noFeature 740647 18639689 865409 N_ambiguous 318115 1255 126425 UnstrandedReadsAssigned:17896671 PositiveStrandReadsAssigned:314489 NegativeStrandReadsAssigned:17963599 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170673 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170673-trimmed-pair1.fastq SRR7170673-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,260,266 reads, 17,862,901 reads pseudoaligned [quant] estimated average fragment length: 286.172 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7170673.ke.tsv 34699 SRR7170673.se.tsv 87100 total ==> SRR7170673.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.83 856 26.8888 Potri.005G024800.1.v4.1 1035 749.828 140 10.1629 Potri.004G059700.1.v4.1 961 675.943 7 0.56369 Potri.007G009000.2.v4.1 1416 1130.83 0 0 Potri.003G141000.2.v4.1 2943 2657.83 1226 25.1082 Potri.016G087400.1.v4.1 270 71.8344 1021 773.652 Potri.015G069301.1.v4.1 564 291.631 0 0 Potri.010G195200.1.v4.1 1773 1487.83 93 3.40238 Potri.012G127500.1.v4.1 977 691.9 63 4.95621 ==> SRR7170673.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1029 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 79 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 4 SRR7170673 completed mapping pipeline successfully