Starting /dee2/code/volunteer_pipeline.sh SRR7170674 current disk space = 3088864980992 free memory = 1412008236 SRR7170674 SRAfilesize d39e8619db0542caf450f22e7748372a SRR7170674.sra SRR7170674.sra file validated SRR7170674 is paired end SRR7170674 is conventional basespace SRR7170674 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170674_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.49875 27.0 18.0 32.0 18.0 33.0 2 24.755 25.0 18.0 29.0 18.0 31.0 3 26.96475 29.0 25.0 31.0 18.0 33.0 4 30.0215 31.0 29.0 33.0 27.0 33.0 5 31.417 33.0 32.0 33.0 28.0 33.0 6 35.37425 37.0 35.0 38.0 29.0 38.0 7 36.194 38.0 37.0 38.0 33.0 38.0 8 36.947 38.0 38.0 38.0 35.0 38.0 9 37.155 38.0 38.0 38.0 36.0 38.0 10-14 37.130250000000004 38.0 38.0 38.0 36.2 38.0 15-19 37.2016 38.0 38.0 38.0 36.6 38.0 20-24 37.15 38.0 38.0 38.0 36.4 38.0 25-29 37.1479 38.0 38.0 38.0 36.6 38.0 30-34 37.1414 38.0 38.0 38.0 36.8 38.0 35-39 37.17725 38.0 38.0 38.0 36.4 38.0 40-44 37.0323 38.0 38.0 38.0 36.0 38.0 45-49 37.02975 38.0 38.0 38.0 36.0 38.0 50-54 36.85029999999999 38.0 38.0 38.0 35.4 38.0 55-59 36.72595 38.0 38.0 38.0 34.8 38.0 60-64 36.69905 38.0 38.0 38.0 34.4 38.0 65-69 36.768299999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.643550000000005 38.0 38.0 38.0 34.4 38.0 75-79 36.200450000000004 38.0 38.0 38.0 33.8 38.0 80-84 36.07045 38.0 37.6 38.0 33.4 38.0 85-89 35.9447 38.0 37.4 38.0 32.2 38.0 90-94 35.7268 38.0 37.0 38.0 31.4 38.0 95-99 35.68855 38.0 36.8 38.0 31.8 38.0 100-104 35.460100000000004 38.0 36.8 38.0 30.2 38.0 105-109 35.401799999999994 38.0 36.8 38.0 30.6 38.0 110-114 35.3356 38.0 36.4 38.0 29.8 38.0 115-119 35.066250000000004 38.0 36.0 38.0 28.4 38.0 120-124 34.737100000000005 38.0 35.2 38.0 27.2 38.0 125-129 34.3385 38.0 34.6 38.0 24.8 38.0 130-134 34.283699999999996 38.0 34.6 38.0 24.4 38.0 135-139 33.443149999999996 38.0 33.0 38.0 20.6 38.0 140-144 32.85585 38.0 33.0 38.0 18.0 38.0 145-149 31.832950000000004 38.0 32.2 38.0 10.6 38.0 150-151 25.650624999999998 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 5.0 17 5.0 18 9.0 19 21.0 20 5.0 21 9.0 22 14.0 23 8.0 24 9.0 25 25.0 26 16.0 27 21.0 28 46.0 29 50.0 30 51.0 31 97.0 32 114.0 33 165.0 34 246.0 35 418.0 36 1044.0 37 1608.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.46742502585315 15.305067218200621 12.771458117890383 27.45604963805584 2 20.674999999999997 22.6 37.824999999999996 18.9 3 16.25 28.975 30.099999999999998 24.675 4 19.650000000000002 35.5 25.424999999999997 19.425 5 20.65 37.425000000000004 24.175 17.75 6 16.8 36.675000000000004 26.724999999999998 19.8 7 13.575000000000001 21.175 45.2 20.05 8 17.5 24.099999999999998 28.425 29.975 9 18.4 22.05 30.95 28.599999999999998 10-14 18.935 31.025000000000002 26.095000000000002 23.945 15-19 19.405 29.880000000000003 27.310000000000002 23.405 20-24 19.275000000000002 30.264999999999997 27.1 23.36 25-29 19.675 29.455 27.275 23.595 30-34 19.46 29.794999999999998 27.415 23.330000000000002 35-39 20.23 29.115000000000002 27.644999999999996 23.01 40-44 19.68 29.49 26.91 23.919999999999998 45-49 20.03 28.93 27.505000000000003 23.535 50-54 19.455 29.15 27.63 23.765 55-59 19.145 28.845 28.060000000000002 23.95 60-64 19.475 29.415000000000003 27.46 23.65 65-69 19.545 29.685 26.915 23.855 70-74 19.455 29.74 26.805 24.0 75-79 19.725 29.775000000000002 26.575 23.925 80-84 19.73 29.195 27.169999999999998 23.905 85-89 20.064999999999998 29.24 27.115000000000002 23.580000000000002 90-94 20.315 28.735 27.305 23.645 95-99 20.24 28.305000000000003 27.58 23.875 100-104 20.02 28.325 27.315 24.34 105-109 20.244999999999997 28.46 26.855 24.44 110-114 20.495 29.270000000000003 26.99 23.244999999999997 115-119 20.11 28.955 26.51 24.425 120-124 21.01 28.439999999999998 26.995 23.555 125-129 20.395 28.28 26.72 24.605 130-134 21.125 28.125 26.575 24.175 135-139 20.84 28.055000000000003 26.900000000000002 24.205 140-144 20.62 28.405 26.700000000000003 24.275 145-149 20.74 28.605000000000004 26.479999999999997 24.175 150-151 20.837500000000002 27.187499999999996 27.625 24.349999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 1.5 19 1.5 20 1.0 21 1.0 22 1.0 23 2.5 24 4.5 25 6.5 26 9.0 27 13.0 28 19.5 29 32.0 30 38.5 31 45.0 32 59.0 33 84.0 34 104.0 35 118.0 36 133.0 37 138.0 38 149.5 39 165.5 40 174.0 41 186.0 42 188.0 43 200.0 44 225.5 45 221.0 46 213.0 47 205.0 48 185.5 49 173.5 50 158.0 51 125.0 52 113.5 53 116.0 54 97.5 55 73.0 56 51.0 57 37.0 58 29.5 59 28.0 60 24.0 61 15.5 62 11.0 63 7.0 64 4.5 65 2.5 66 1.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.58190327613104 93.825 2 1.8200728029121163 3.5000000000000004 3 0.4420176807072283 1.275 4 0.05200208008320333 0.2 5 0.05200208008320333 0.25 6 0.026001040041601666 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026001040041601666 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 32 0.8 TruSeq Adapter, Index 1 (97% over 36bp) GTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit GCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGT 5 0.125 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.7999999999999998 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.9000000000000004 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.6625 0.0 0.0 0.0 0.0 122-123 4.975 0.0 0.0 0.0 0.0 124-125 5.275 0.0 0.0 0.0 0.0 126-127 5.7875 0.0 0.0 0.0 0.0 128-129 6.199999999999999 0.0 0.0 0.0 0.0 130-131 6.75 0.0 0.0 0.0 0.0 132-133 7.0375 0.0 0.0 0.0 0.0 134-135 7.4375 0.0 0.0 0.0 0.0 136-137 7.8625 0.0 0.0 0.0 0.0 138-139 8.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTTA 10 0.0060887975 150.61038 1 GGAAAAA 10 0.0060887975 150.61038 1 >>END_MODULE SRR7170674 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170674_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37425 33.0 33.0 34.0 31.0 34.0 2 32.4295 33.0 33.0 34.0 31.0 34.0 3 32.378 33.0 33.0 34.0 31.0 34.0 4 32.372 33.0 33.0 34.0 31.0 34.0 5 32.35125 33.0 33.0 34.0 31.0 34.0 6 36.4885 38.0 38.0 38.0 34.0 38.0 7 36.57225 38.0 38.0 38.0 35.0 38.0 8 36.35525 38.0 38.0 38.0 34.0 38.0 9 36.4305 38.0 38.0 38.0 34.0 38.0 10-14 36.459 38.0 38.0 38.0 34.0 38.0 15-19 36.34755 38.0 38.0 38.0 34.0 38.0 20-24 36.380649999999996 38.0 38.0 38.0 34.0 38.0 25-29 36.2629 38.0 38.0 38.0 34.0 38.0 30-34 36.3378 38.0 38.0 38.0 33.8 38.0 35-39 36.1332 38.0 38.0 38.0 33.6 38.0 40-44 36.184749999999994 38.0 38.0 38.0 33.6 38.0 45-49 36.03195000000001 38.0 38.0 38.0 32.8 38.0 50-54 35.9764 38.0 38.0 38.0 33.0 38.0 55-59 36.03065 38.0 38.0 38.0 33.2 38.0 60-64 35.81325 38.0 37.8 38.0 32.0 38.0 65-69 35.85075 38.0 38.0 38.0 33.0 38.0 70-74 35.7676 38.0 37.8 38.0 31.8 38.0 75-79 35.6712 38.0 37.4 38.0 31.0 38.0 80-84 35.486149999999995 38.0 37.0 38.0 30.6 38.0 85-89 35.3721 38.0 37.0 38.0 29.8 38.0 90-94 35.2027 38.0 37.0 38.0 29.2 38.0 95-99 35.028600000000004 38.0 37.0 38.0 28.6 38.0 100-104 34.773199999999996 38.0 36.2 38.0 27.2 38.0 105-109 34.67245 38.0 36.0 38.0 26.6 38.0 110-114 34.4582 38.0 35.8 38.0 24.4 38.0 115-119 34.052800000000005 38.0 35.0 38.0 23.0 38.0 120-124 33.7188 38.0 34.2 38.0 21.8 38.0 125-129 33.3483 38.0 33.0 38.0 18.6 38.0 130-134 32.838100000000004 38.0 32.8 38.0 14.6 38.0 135-139 31.906599999999997 38.0 31.4 38.0 13.0 38.0 140-144 31.095500000000005 37.8 30.0 38.0 10.2 38.0 145-149 29.78315 36.0 28.0 38.0 2.0 38.0 150-151 23.897875 31.0 11.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 10.0 4 6.0 5 6.0 6 2.0 7 1.0 8 2.0 9 5.0 10 3.0 11 7.0 12 4.0 13 8.0 14 4.0 15 9.0 16 15.0 17 15.0 18 16.0 19 7.0 20 10.0 21 14.0 22 14.0 23 22.0 24 18.0 25 31.0 26 35.0 27 35.0 28 42.0 29 59.0 30 79.0 31 98.0 32 120.0 33 173.0 34 236.0 35 347.0 36 727.0 37 1802.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.35 17.325 13.5 24.825 2 24.275 24.425 32.9 18.4 3 22.55 26.775 30.95 19.725 4 24.275 34.35 20.724999999999998 20.65 5 24.099999999999998 35.55 22.1 18.25 6 19.05 36.025 24.0 20.925 7 19.475 17.1 41.05 22.375 8 21.075 22.475 26.224999999999998 30.225 9 22.375 24.4 27.1 26.125 10-14 23.585 28.28 26.085 22.05 15-19 24.015 27.73 27.450000000000003 20.805 20-24 24.035 27.985 27.195000000000004 20.785 25-29 24.68 28.88 25.81 20.630000000000003 30-34 23.385 27.925 27.865000000000002 20.825 35-39 24.195 27.46 27.275 21.07 40-44 24.035 27.575 27.455000000000002 20.935000000000002 45-49 23.71 27.63 27.66 21.0 50-54 24.075 27.16 27.839999999999996 20.925 55-59 24.355 27.52 27.310000000000002 20.815 60-64 23.895 27.755000000000003 27.855 20.495 65-69 23.825 27.295 27.96 20.919999999999998 70-74 23.615 28.435 27.18 20.77 75-79 23.31 28.115000000000002 27.834999999999997 20.74 80-84 23.825 28.384999999999998 27.51 20.28 85-89 24.47 28.285 27.139999999999997 20.105 90-94 23.865 28.475 27.939999999999998 19.72 95-99 24.0 28.79 27.195000000000004 20.015 100-104 24.62 28.18 27.605 19.595000000000002 105-109 24.625 28.044999999999998 27.315 20.015 110-114 24.285 28.52 27.555000000000003 19.64 115-119 24.94 28.255000000000003 27.445000000000004 19.36 120-124 25.45 28.365000000000002 26.950000000000003 19.235 125-129 25.165 27.794999999999998 27.195000000000004 19.845 130-134 25.264999999999997 27.405 27.725 19.605 135-139 24.94 27.49 27.455000000000002 20.115 140-144 25.745 27.625 27.205000000000002 19.425 145-149 25.285000000000004 27.73 27.43 19.555 150-151 26.7625 27.175 27.025 19.037499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.0 24 1.5 25 1.5 26 6.0 27 7.5 28 5.5 29 7.0 30 16.5 31 26.5 32 30.0 33 41.5 34 57.5 35 69.0 36 86.0 37 107.5 38 135.5 39 165.5 40 181.5 41 186.5 42 193.0 43 205.5 44 225.5 45 237.0 46 245.5 47 247.5 48 224.5 49 203.0 50 178.5 51 153.5 52 132.5 53 121.5 54 123.5 55 100.0 56 68.5 57 56.5 58 47.5 59 32.5 60 18.5 61 15.0 62 11.0 63 6.5 64 4.5 65 1.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.55970924195223 93.95 2 1.8951194184839044 3.65 3 0.25960539979231567 0.75 4 0.1557632398753894 0.6 5 0.10384215991692627 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02596053997923157 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 22 0.5499999999999999 Illumina Single End PCR Primer 1 (96% over 32bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit CTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.7999999999999998 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.5375 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.699999999999999 0.0 0.0 0.0 0.0 122-123 5.025 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.8125 0.0 0.0 0.0 0.0 128-129 6.237500000000001 0.0 0.0 0.0 0.0 130-131 6.775 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.425 0.0 0.0 0.0 0.0 136-137 7.8375 0.0 0.0 0.0 0.0 138-139 8.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTGG 10 0.006830828 145.0 145 GTCAAGG 10 0.006830828 145.0 1 >>END_MODULE Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838033 spots for SRR7170674.sra Written 838033 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra Read 838026 spots for SRR7170674.sra Written 838026 spots for SRR7170674.sra SRR ids: ['SRR7170674.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d7vplhrm SRR7170674.sra spots: 16760527 blocks: [[1, 838026], [838027, 1676052], [1676053, 2514078], [2514079, 3352104], [3352105, 4190130], [4190131, 5028156], [5028157, 5866182], [5866183, 6704208], [6704209, 7542234], [7542235, 8380260], [8380261, 9218286], [9218287, 10056312], [10056313, 10894338], [10894339, 11732364], [11732365, 12570390], [12570391, 13408416], [13408417, 14246442], [14246443, 15084468], [15084469, 15922494], [15922495, 16760527]] SRR7170674 file size 5657892 SRR7170674 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170674 SRR7170674_1.fastq SRR7170674_2.fastq Input file: SRR7170674_1.fastq Paired file: SRR7170674_2.fastq trimmed: SRR7170674-trimmed-pair1.fastq, SRR7170674-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:30:31 2025 >> started Thu Feb 13 15:31:00 2025 >> done (28.839s) 16760527 read pairs processed; of these: 43856 ( 0.26%) short read pairs filtered out after trimming by size control 171976 ( 1.03%) empty read pairs filtered out after trimming by size control 16544695 (98.71%) read pairs available; of these: 10473678 (63.31%) trimmed read pairs available after processing 6071017 (36.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 17 0.00% 20 17 0.00% 21 13 0.00% 22 24 0.00% 23 14 0.00% 24 18 0.00% 25 19 0.00% 26 21 0.00% 27 27 0.00% 28 20 0.00% 29 16 0.00% 30 24 0.00% 31 28 0.00% 32 27 0.00% 33 28 0.00% 34 36 0.00% 35 30 0.00% 36 32 0.00% 37 36 0.00% 38 51 0.00% 39 66 0.00% 40 72 0.00% 41 87 0.00% 42 75 0.00% 43 81 0.00% 44 83 0.00% 45 118 0.00% 46 149 0.00% 47 194 0.00% 48 206 0.00% 49 219 0.00% 50 241 0.00% 51 298 0.00% 52 300 0.00% 53 300 0.00% 54 375 0.00% 55 358 0.00% 56 416 0.00% 57 473 0.00% 58 498 0.00% 59 577 0.00% 60 685 0.00% 61 785 0.00% 62 857 0.01% 63 868 0.01% 64 921 0.01% 65 1063 0.01% 66 1064 0.01% 67 1175 0.01% 68 1317 0.01% 69 1525 0.01% 70 1656 0.01% 71 1949 0.01% 72 2415 0.01% 73 2699 0.02% 74 2831 0.02% 75 3529 0.02% 76 4742 0.03% 77 5867 0.04% 78 4521 0.03% 79 4792 0.03% 80 4819 0.03% 81 5453 0.03% 82 6286 0.04% 83 7289 0.04% 84 9608 0.06% 85 10782 0.07% 86 11175 0.07% 87 11246 0.07% 88 11982 0.07% 89 12027 0.07% 90 13015 0.08% 91 13696 0.08% 92 14992 0.09% 93 16121 0.10% 94 16777 0.10% 95 17851 0.11% 96 19276 0.12% 97 18708 0.11% 98 19361 0.12% 99 20672 0.12% 100 21023 0.13% 101 22341 0.14% 102 24903 0.15% 103 25977 0.16% 104 27186 0.16% 105 28745 0.17% 106 29171 0.18% 107 29438 0.18% 108 30376 0.18% 109 31226 0.19% 110 31834 0.19% 111 33574 0.20% 112 35579 0.22% 113 38871 0.23% 114 39069 0.24% 115 39742 0.24% 116 41005 0.25% 117 41252 0.25% 118 42461 0.26% 119 43107 0.26% 120 45614 0.28% 121 46808 0.28% 122 48533 0.29% 123 51506 0.31% 124 53781 0.33% 125 55418 0.33% 126 57828 0.35% 127 58955 0.36% 128 61320 0.37% 129 64653 0.39% 130 67152 0.41% 131 70021 0.42% 132 74316 0.45% 133 79860 0.48% 134 84713 0.51% 135 91352 0.55% 136 98513 0.60% 137 106416 0.64% 138 113384 0.69% 139 123842 0.75% 140 135390 0.82% 141 150098 0.91% 142 166929 1.01% 143 191469 1.16% 144 220578 1.33% 145 260647 1.58% 146 327910 1.98% 147 426703 2.58% 148 644155 3.89% 149 1211644 7.32% 150 4315200 26.08% 151 6071017 36.69% 16544695 reads passed initial QC criterion=sequence-density sequence-density=1.15 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=1.05 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=37.87 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCTACCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGCTTCGGGATCGTCAGCCAAGCCCAGTGGGTCGAAGCTTCCACCTGGGTAGATTGGGTCAGTTACCTCACCGAGTGGCCCGCCAGCAATTCTGTAACCCTCAACGGCACCCATCAAGACCACCTGTGTAGCCCAGATGGCCAAGATGCTTTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCTCGCTGAAGATCTGGGCTCCAGCCTT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=40.16 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=1.4 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7170674 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:32:06 Started mapping on | Feb 13 15:32:06 Finished on | Feb 13 15:38:26 Mapping speed, Million of reads per hour | 156.74 Number of input reads | 16544695 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14052026 Uniquely mapped reads % | 84.93% Average mapped length | 290.16 Number of splices: Total | 12049588 Number of splices: Annotated (sjdb) | 11796345 Number of splices: GT/AG | 11802139 Number of splices: GC/AG | 199163 Number of splices: AT/AC | 10075 Number of splices: Non-canonical | 38211 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376814 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 20790 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.58% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2144688 2144688 2144688 N_multimapping 376814 376814 376814 N_noFeature 381537 13652499 469948 N_ambiguous 421955 1310 110134 UnstrandedReadsAssigned:13248534 PositiveStrandReadsAssigned:398217 NegativeStrandReadsAssigned:13471944 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170674 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170674-trimmed-pair1.fastq SRR7170674-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,544,695 reads, 13,432,881 reads pseudoaligned [quant] estimated average fragment length: 233.917 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR7170674.ke.tsv 34699 SRR7170674.se.tsv 87100 total ==> SRR7170674.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.08 370 10.7362 Potri.005G024800.1.v4.1 1035 802.083 199 12.8511 Potri.004G059700.1.v4.1 961 728.098 10 0.711404 Potri.007G009000.2.v4.1 1416 1183.08 0 0 Potri.003G141000.2.v4.1 2943 2710.08 854 16.3223 Potri.016G087400.1.v4.1 270 83.5662 785 486.57 Potri.015G069301.1.v4.1 564 334.388 0 0 Potri.010G195200.1.v4.1 1773 1540.08 10 0.336327 Potri.012G127500.1.v4.1 977 744.098 109 7.58756 ==> SRR7170674.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 635 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 421 Potri.001G212900.v4.1 65 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170674 completed mapping pipeline successfully