Starting /dee2/code/volunteer_pipeline.sh SRR7170675 current disk space = 3088843862016 free memory = 1433079724 SRR7170675 SRAfilesize e98531921c171d5baf756b0ba1c33360 SRR7170675.sra SRR7170675.sra file validated SRR7170675 is paired end SRR7170675 is conventional basespace SRR7170675 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170675_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.2385 25.0 18.0 32.0 18.0 33.0 2 24.24475 25.0 18.0 29.0 18.0 33.0 3 27.54125 29.0 25.0 31.0 18.0 33.0 4 30.5635 31.0 29.0 33.0 27.0 33.0 5 31.97575 33.0 32.0 33.0 31.0 33.0 6 36.2985 38.0 36.0 38.0 34.0 38.0 7 36.888 38.0 37.0 38.0 35.0 38.0 8 37.3445 38.0 38.0 38.0 36.0 38.0 9 37.33075 38.0 38.0 38.0 36.0 38.0 10-14 37.3686 38.0 38.0 38.0 37.0 38.0 15-19 37.40925 38.0 38.0 38.0 37.0 38.0 20-24 37.483 38.0 38.0 38.0 37.0 38.0 25-29 37.4784 38.0 38.0 38.0 37.4 38.0 30-34 37.429649999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.44455 38.0 38.0 38.0 37.0 38.0 40-44 37.327299999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.34195 38.0 38.0 38.0 37.0 38.0 50-54 37.164699999999996 38.0 38.0 38.0 36.2 38.0 55-59 37.1048 38.0 38.0 38.0 36.0 38.0 60-64 37.156150000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.00665 38.0 38.0 38.0 36.0 38.0 70-74 36.8184 38.0 38.0 38.0 34.8 38.0 75-79 36.7118 38.0 38.0 38.0 34.4 38.0 80-84 36.732150000000004 38.0 38.0 38.0 34.8 38.0 85-89 36.576550000000005 38.0 38.0 38.0 34.2 38.0 90-94 36.4259 38.0 38.0 38.0 34.0 38.0 95-99 36.324850000000005 38.0 37.2 38.0 33.8 38.0 100-104 36.0717 38.0 37.0 38.0 33.0 38.0 105-109 35.9902 38.0 37.0 38.0 33.0 38.0 110-114 35.83370000000001 38.0 36.8 38.0 32.2 38.0 115-119 35.6534 38.0 36.4 38.0 31.0 38.0 120-124 35.55875 38.0 36.0 38.0 31.0 38.0 125-129 35.2568 38.0 35.8 38.0 28.8 38.0 130-134 34.65945 38.0 35.0 38.0 27.0 38.0 135-139 34.0748 38.0 34.0 38.0 23.6 38.0 140-144 33.373400000000004 38.0 33.2 38.0 20.8 38.0 145-149 32.5373 38.0 32.4 38.0 15.2 38.0 150-151 28.526249999999997 35.5 23.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 1.0 17 2.0 18 4.0 19 5.0 20 1.0 21 5.0 22 2.0 23 7.0 24 6.0 25 11.0 26 21.0 27 20.0 28 30.0 29 36.0 30 56.0 31 80.0 32 90.0 33 136.0 34 212.0 35 410.0 36 1059.0 37 1801.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.42113362400616 16.517055655296232 11.05411644011285 30.00769428058477 2 21.75 22.6 36.85 18.8 3 17.849999999999998 29.799999999999997 28.65 23.7 4 21.275 36.625 21.925 20.175 5 20.375469336670836 36.32040050062578 24.28035043804756 19.02377972465582 6 16.400000000000002 36.35 25.624999999999996 21.625 7 13.900000000000002 19.625 44.224999999999994 22.25 8 17.75 20.474999999999998 28.449999999999996 33.324999999999996 9 16.575 22.675 30.599999999999998 30.15 10-14 19.36 28.99 26.8 24.85 15-19 19.55 28.825 27.750000000000004 23.875 20-24 19.895 28.470000000000002 27.955000000000002 23.68 25-29 20.03 27.92 27.935 24.115000000000002 30-34 19.685 27.87 28.105000000000004 24.34 35-39 19.794999999999998 28.749999999999996 27.27 24.185000000000002 40-44 19.8 28.76 27.439999999999998 24.0 45-49 19.81 28.29 27.525 24.375 50-54 19.509999999999998 28.555000000000003 27.339999999999996 24.595 55-59 20.4 28.110000000000003 27.794999999999998 23.695 60-64 20.015 28.384999999999998 27.665 23.935000000000002 65-69 19.875 28.904999999999998 27.375 23.845 70-74 20.325 28.84 27.73 23.105 75-79 20.195 28.16 27.325 24.32 80-84 19.775000000000002 28.07 28.12 24.035 85-89 20.495 28.505000000000003 27.045 23.955000000000002 90-94 20.09 28.04 28.125 23.745 95-99 20.474999999999998 28.365000000000002 26.965 24.195 100-104 20.474999999999998 27.894999999999996 27.955000000000002 23.674999999999997 105-109 20.455000000000002 27.975 27.665 23.905 110-114 20.255000000000003 28.215 28.1 23.43 115-119 20.345 28.470000000000002 27.16 24.025 120-124 21.12 28.025 27.255000000000003 23.599999999999998 125-129 20.54 28.244999999999997 27.275 23.94 130-134 21.065 28.065 27.29 23.580000000000002 135-139 20.330000000000002 28.050000000000004 27.435 24.185000000000002 140-144 20.95 28.565 26.815 23.669999999999998 145-149 20.53 28.134999999999998 27.415 23.919999999999998 150-151 21.762500000000003 28.625 26.125 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 2.0 23 2.0 24 5.0 25 4.5 26 5.0 27 10.0 28 9.0 29 13.5 30 21.0 31 25.0 32 37.0 33 53.0 34 60.5 35 76.0 36 100.0 37 111.0 38 129.5 39 159.0 40 178.5 41 207.0 42 231.5 43 248.5 44 256.0 45 253.5 46 250.0 47 245.0 48 238.0 49 213.5 50 182.0 51 147.0 52 111.5 53 86.0 54 79.0 55 66.5 56 46.0 57 38.0 58 27.5 59 20.0 60 17.5 61 8.5 62 5.5 63 6.5 64 4.5 65 2.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57542610022895 96.875 2 1.1956245230221318 2.35 3 0.15263291783261257 0.44999999999999996 4 0.05087763927753752 0.2 5 0.02543881963876876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.6375000000000002 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.8875 0.0 0.0 0.0 0.0 122-123 2.0374999999999996 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.5999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATTCA 10 0.0068343505 144.975 6 AAAAAAA 35 0.003540148 20.710714 140-144 >>END_MODULE SRR7170675 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170675_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.645 33.0 33.0 34.0 32.0 34.0 2 32.6665 33.0 33.0 34.0 32.0 34.0 3 32.7435 33.0 33.0 34.0 32.0 34.0 4 32.654 33.0 33.0 34.0 32.0 34.0 5 32.72975 33.0 33.0 34.0 32.0 34.0 6 36.89775 38.0 38.0 38.0 36.0 38.0 7 36.844 38.0 38.0 38.0 36.0 38.0 8 36.825 38.0 38.0 38.0 36.0 38.0 9 36.85725 38.0 38.0 38.0 36.0 38.0 10-14 36.7402 38.0 38.0 38.0 36.0 38.0 15-19 36.754400000000004 38.0 38.0 38.0 35.8 38.0 20-24 36.698699999999995 38.0 38.0 38.0 35.8 38.0 25-29 36.6392 38.0 38.0 38.0 35.6 38.0 30-34 36.5864 38.0 38.0 38.0 35.2 38.0 35-39 36.638 38.0 38.0 38.0 35.4 38.0 40-44 36.56795 38.0 38.0 38.0 35.2 38.0 45-49 36.4796 38.0 38.0 38.0 34.8 38.0 50-54 36.46875 38.0 38.0 38.0 34.6 38.0 55-59 36.37985 38.0 38.0 38.0 34.0 38.0 60-64 36.33669999999999 38.0 38.0 38.0 34.0 38.0 65-69 36.269450000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.32665 38.0 38.0 38.0 34.0 38.0 75-79 36.1681 38.0 38.0 38.0 33.8 38.0 80-84 35.9813 38.0 38.0 38.0 32.8 38.0 85-89 35.8309 38.0 37.8 38.0 32.6 38.0 90-94 35.6957 38.0 37.6 38.0 32.2 38.0 95-99 35.494550000000004 38.0 37.0 38.0 31.0 38.0 100-104 35.216049999999996 38.0 36.6 38.0 29.0 38.0 105-109 35.24165 38.0 37.0 38.0 29.0 38.0 110-114 35.041250000000005 38.0 36.0 38.0 28.2 38.0 115-119 34.81365 38.0 35.8 38.0 27.2 38.0 120-124 34.49255000000001 38.0 35.6 38.0 24.6 38.0 125-129 33.9005 38.0 34.2 38.0 20.8 38.0 130-134 33.536550000000005 38.0 33.0 38.0 21.0 38.0 135-139 33.327 38.0 33.0 38.0 19.8 38.0 140-144 32.6562 38.0 33.0 38.0 15.6 38.0 145-149 31.3564 38.0 31.6 38.0 8.0 38.0 150-151 25.99975 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 3.0 5 5.0 6 7.0 7 3.0 8 2.0 9 0.0 10 1.0 11 6.0 12 3.0 13 5.0 14 5.0 15 10.0 16 5.0 17 7.0 18 4.0 19 9.0 20 4.0 21 5.0 22 16.0 23 23.0 24 17.0 25 28.0 26 29.0 27 28.0 28 41.0 29 53.0 30 50.0 31 93.0 32 103.0 33 121.0 34 175.0 35 296.0 36 737.0 37 2088.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.775 16.775000000000002 14.374999999999998 28.075 2 23.225 24.099999999999998 35.25 17.424999999999997 3 20.225 27.325 31.525 20.925 4 23.5 35.65 21.675 19.175 5 23.75 36.625 22.0 17.625 6 18.33875406554916 36.10207655741806 25.444083062296723 20.115086314736054 7 17.68384192096048 15.732866433216607 43.77188594297149 22.811405702851424 8 19.41456092069052 22.191643732799598 27.72079059294471 30.673004753565174 9 21.641230923192396 22.641981486114584 28.621466099574683 27.09532149111834 10-14 22.702026519889916 28.29622216662497 26.975231423567674 22.026519889917438 15-19 22.033219931959174 27.721632979787874 28.352011206724036 21.893135881528917 20-24 22.627919771920173 27.654679137698196 28.12484369529335 21.59255739508828 25-29 23.130408683907756 27.707468360762345 27.472362563153418 21.68976039217648 30-34 22.704758092760294 28.11327362785811 28.18832240956622 20.99364586981538 35-39 22.381786339754818 27.820865649236925 28.19614711033275 21.601200900675508 40-44 22.60695521641231 27.51063297473105 28.441330998248688 21.441080810607957 45-49 22.92490118577075 27.64797118126782 28.2883874518437 21.138740181117726 50-54 22.968038813584755 27.199519831941178 28.004801680588205 21.82763967388586 55-59 23.273964378627177 28.151891134680806 27.666599959975986 20.90754452671603 60-64 23.519111466880126 27.10626375825495 27.501500900540325 21.873123874324595 65-69 22.37671301390417 27.143142942882864 27.74332299689907 22.736821046313892 70-74 23.02960592118424 27.795559111822364 26.945389077815562 22.229445889177835 75-79 23.116935080524158 27.323196959087724 28.14344303290987 21.416424927478246 80-84 23.43468693738748 27.645529105821165 27.545509101820365 21.374274854970995 85-89 23.457345734573458 27.96279627962796 27.42774277427743 21.152115211521153 90-94 23.476173808690433 27.876393819690986 27.68638431921596 20.96104805240262 95-99 23.57 28.03 27.305 21.095 100-104 23.87238723872387 28.06280628062806 27.34773477347735 20.717071707170717 105-109 23.291987596278886 27.793338001400418 28.16845053516055 20.74622386716015 110-114 23.73805593076192 28.145480014007706 28.015408474661065 20.101055580569312 115-119 23.55059776899605 28.05762593166925 27.817517883047373 20.574258416287332 120-124 24.75495099019804 27.160432086417284 27.30546109221844 20.779155831166232 125-129 24.57 27.13 27.935 20.365 130-134 23.614722944588916 27.250450090018003 27.845569113822766 21.289257851570316 135-139 23.9967977584309 27.239067347143 28.194736315420794 20.569398579005306 140-144 24.33203242269589 28.229760832582805 27.138997298108674 20.29920944661263 145-149 25.016250812540626 27.51137556877844 27.091354567728388 20.38101905095255 150-151 24.887500000000003 27.950000000000003 26.787499999999998 20.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.0 24 2.5 25 5.5 26 6.5 27 5.5 28 10.5 29 11.5 30 14.0 31 24.0 32 29.5 33 38.0 34 57.0 35 69.5 36 79.0 37 96.0 38 113.5 39 151.5 40 185.5 41 199.5 42 242.5 43 262.5 44 252.5 45 253.0 46 243.5 47 235.0 48 229.0 49 210.5 50 180.0 51 150.0 52 121.0 53 108.5 54 96.0 55 75.5 56 56.5 57 42.5 58 39.5 59 34.5 60 25.0 61 14.0 62 8.5 63 4.5 64 2.5 65 3.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.05 8 0.075 9 0.075 10-14 0.075 15-19 0.06 20-24 0.034999999999999996 25-29 0.045 30-34 0.065 35-39 0.075 40-44 0.075 45-49 0.065 50-54 0.034999999999999996 55-59 0.06 60-64 0.06 65-69 0.03 70-74 0.02 75-79 0.03 80-84 0.02 85-89 0.01 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.03 110-114 0.055 115-119 0.045 120-124 0.02 125-129 0.0 130-134 0.02 135-139 0.06999999999999999 140-144 0.06999999999999999 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82951653944019 97.1 2 0.7633587786259541 1.5 3 0.2544529262086514 0.75 4 0.10178117048346055 0.4 5 0.05089058524173028 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGAC 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.6375000000000002 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.8875 0.0 0.0 0.0 0.0 122-123 2.0374999999999996 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.3499999999999996 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.4625 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918172 spots for SRR7170675.sra Written 918172 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra Read 918160 spots for SRR7170675.sra Written 918160 spots for SRR7170675.sra SRR ids: ['SRR7170675.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6lbr2t_s SRR7170675.sra spots: 18363212 blocks: [[1, 918160], [918161, 1836320], [1836321, 2754480], [2754481, 3672640], [3672641, 4590800], [4590801, 5508960], [5508961, 6427120], [6427121, 7345280], [7345281, 8263440], [8263441, 9181600], [9181601, 10099760], [10099761, 11017920], [11017921, 11936080], [11936081, 12854240], [12854241, 13772400], [13772401, 14690560], [14690561, 15608720], [15608721, 16526880], [16526881, 17445040], [17445041, 18363212]] SRR7170675 file size 6200989 SRR7170675 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170675 SRR7170675_1.fastq SRR7170675_2.fastq Input file: SRR7170675_1.fastq Paired file: SRR7170675_2.fastq trimmed: SRR7170675-trimmed-pair1.fastq, SRR7170675-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:39:20 2025 >> started Thu Feb 13 15:39:41 2025 >> done (20.749s) 18363212 read pairs processed; of these: 24031 ( 0.13%) short read pairs filtered out after trimming by size control 26276 ( 0.14%) empty read pairs filtered out after trimming by size control 18312905 (99.73%) read pairs available; of these: 9587446 (52.35%) trimmed read pairs available after processing 8725459 (47.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 10 0.00% 21 11 0.00% 22 9 0.00% 23 6 0.00% 24 15 0.00% 25 13 0.00% 26 16 0.00% 27 18 0.00% 28 26 0.00% 29 26 0.00% 30 41 0.00% 31 34 0.00% 32 49 0.00% 33 44 0.00% 34 52 0.00% 35 46 0.00% 36 73 0.00% 37 72 0.00% 38 89 0.00% 39 91 0.00% 40 83 0.00% 41 83 0.00% 42 96 0.00% 43 111 0.00% 44 93 0.00% 45 104 0.00% 46 98 0.00% 47 132 0.00% 48 141 0.00% 49 192 0.00% 50 218 0.00% 51 242 0.00% 52 203 0.00% 53 217 0.00% 54 148 0.00% 55 187 0.00% 56 174 0.00% 57 202 0.00% 58 248 0.00% 59 301 0.00% 60 335 0.00% 61 390 0.00% 62 400 0.00% 63 385 0.00% 64 449 0.00% 65 489 0.00% 66 527 0.00% 67 546 0.00% 68 637 0.00% 69 743 0.00% 70 900 0.00% 71 927 0.01% 72 1109 0.01% 73 1170 0.01% 74 1390 0.01% 75 1490 0.01% 76 1914 0.01% 77 2121 0.01% 78 2144 0.01% 79 2283 0.01% 80 2343 0.01% 81 2734 0.01% 82 3202 0.02% 83 3635 0.02% 84 4737 0.03% 85 5533 0.03% 86 5955 0.03% 87 6712 0.04% 88 6503 0.04% 89 6839 0.04% 90 7108 0.04% 91 7601 0.04% 92 8025 0.04% 93 8840 0.05% 94 9451 0.05% 95 10239 0.06% 96 10202 0.06% 97 10740 0.06% 98 11122 0.06% 99 11582 0.06% 100 12090 0.07% 101 12933 0.07% 102 13566 0.07% 103 14710 0.08% 104 15153 0.08% 105 15850 0.09% 106 16390 0.09% 107 16924 0.09% 108 17517 0.10% 109 18170 0.10% 110 18980 0.10% 111 19525 0.11% 112 20849 0.11% 113 22096 0.12% 114 22673 0.12% 115 23521 0.13% 116 24731 0.14% 117 25087 0.14% 118 25795 0.14% 119 26453 0.14% 120 28225 0.15% 121 29312 0.16% 122 30414 0.17% 123 32564 0.18% 124 33973 0.19% 125 35645 0.19% 126 37442 0.20% 127 39123 0.21% 128 41036 0.22% 129 42406 0.23% 130 44195 0.24% 131 46783 0.26% 132 49927 0.27% 133 52736 0.29% 134 56908 0.31% 135 60796 0.33% 136 66158 0.36% 137 71334 0.39% 138 78897 0.43% 139 86376 0.47% 140 95777 0.52% 141 109225 0.60% 142 124519 0.68% 143 145353 0.79% 144 172998 0.94% 145 211457 1.15% 146 268852 1.47% 147 378094 2.06% 148 575188 3.14% 149 1140128 6.23% 150 4851108 26.49% 151 8725459 47.65% 18312905 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=12 prefix-density=0.79 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=16.74 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=TTTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCT criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=8 prefix-density=0.97 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=13.98 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.9 sequence=TGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7170675 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:40:26 Started mapping on | Feb 13 15:40:27 Finished on | Feb 13 15:43:01 Mapping speed, Million of reads per hour | 428.09 Number of input reads | 18312905 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16912714 Uniquely mapped reads % | 92.35% Average mapped length | 294.55 Number of splices: Total | 17544727 Number of splices: Annotated (sjdb) | 17185953 Number of splices: GT/AG | 17210591 Number of splices: GC/AG | 277273 Number of splices: AT/AC | 10916 Number of splices: Non-canonical | 45947 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468972 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 136689 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.19% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 951673 951673 951673 N_multimapping 468972 468972 468972 N_noFeature 601090 16622514 675854 N_ambiguous 334480 1012 118564 UnstrandedReadsAssigned:15977144 PositiveStrandReadsAssigned:289188 NegativeStrandReadsAssigned:16118296 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170675 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170675-trimmed-pair1.fastq SRR7170675-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,312,905 reads, 16,025,281 reads pseudoaligned [quant] estimated average fragment length: 276.506 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR7170675.ke.tsv 34699 SRR7170675.se.tsv 87100 total ==> SRR7170675.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.49 1078 29.741 Potri.005G024800.1.v4.1 1035 759.494 304 19.2423 Potri.004G059700.1.v4.1 961 685.584 8 0.560967 Potri.007G009000.2.v4.1 1416 1140.49 0 0 Potri.003G141000.2.v4.1 2943 2667.49 962.464 17.3456 Potri.016G087400.1.v4.1 270 72.86 1119 738.327 Potri.015G069301.1.v4.1 564 298.1 0 0 Potri.010G195200.1.v4.1 1773 1497.49 183 5.87481 Potri.012G127500.1.v4.1 977 701.537 245 16.7889 ==> SRR7170675.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 746 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 145 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 76 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 30 SRR7170675 completed mapping pipeline successfully