Starting /dee2/code/volunteer_pipeline.sh SRR7170676 current disk space = 3088833040384 free memory = 1492751588 SRR7170676 SRAfilesize 72782ab5d8e591b32d17227aae474557 SRR7170676.sra SRR7170676.sra file validated SRR7170676 is paired end SRR7170676 is conventional basespace SRR7170676 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170676_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.221 18.0 18.0 30.0 18.0 33.0 2 28.7525 29.0 27.0 31.0 25.0 33.0 3 30.73275 31.0 29.0 33.0 27.0 33.0 4 32.32225 33.0 32.0 33.0 32.0 33.0 5 32.52775 33.0 33.0 33.0 32.0 34.0 6 36.694 38.0 37.0 38.0 34.0 38.0 7 37.028 38.0 38.0 38.0 35.0 38.0 8 37.34425 38.0 38.0 38.0 37.0 38.0 9 37.41 38.0 38.0 38.0 37.0 38.0 10-14 37.4452 38.0 38.0 38.0 37.0 38.0 15-19 37.42285 38.0 38.0 38.0 37.2 38.0 20-24 37.5164 38.0 38.0 38.0 37.8 38.0 25-29 37.54559999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.528800000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.49385 38.0 38.0 38.0 37.6 38.0 40-44 37.382450000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.37949999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.2487 38.0 38.0 38.0 36.8 38.0 55-59 37.129 38.0 38.0 38.0 36.0 38.0 60-64 37.1137 38.0 38.0 38.0 36.0 38.0 65-69 37.017399999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.980399999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.7171 38.0 38.0 38.0 35.0 38.0 80-84 36.54875 38.0 38.0 38.0 34.8 38.0 85-89 36.383449999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.33540000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.16635 38.0 38.0 38.0 34.0 38.0 100-104 36.05225 38.0 37.6 38.0 33.6 38.0 105-109 35.899899999999995 38.0 37.0 38.0 32.8 38.0 110-114 35.6498 38.0 37.0 38.0 31.2 38.0 115-119 35.35045 38.0 36.2 38.0 30.2 38.0 120-124 35.2664 38.0 36.0 38.0 29.8 38.0 125-129 35.21595 38.0 36.0 38.0 29.6 38.0 130-134 34.89605 38.0 35.4 38.0 28.2 38.0 135-139 34.45525 38.0 34.4 38.0 26.8 38.0 140-144 33.56569999999999 38.0 33.4 38.0 21.4 38.0 145-149 33.15005000000001 38.0 33.0 38.0 19.0 38.0 150-151 28.627875000000003 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 4.0 16 2.0 17 5.0 18 9.0 19 22.0 20 3.0 21 5.0 22 6.0 23 7.0 24 9.0 25 13.0 26 17.0 27 20.0 28 18.0 29 25.0 30 38.0 31 54.0 32 76.0 33 107.0 34 214.0 35 302.0 36 989.0 37 2050.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.1160600661746 23.237465003817764 13.820310511580555 26.82616441842708 2 21.15 23.974999999999998 35.3 19.575 3 16.675 32.175 29.375 21.775 4 20.625 35.5 23.525 20.349999999999998 5 19.914936202151615 36.87765824368276 23.892919689767325 19.314485864398296 6 16.900000000000002 34.625 25.825 22.650000000000002 7 12.875 21.725 45.324999999999996 20.075000000000003 8 17.150000000000002 22.225 28.375 32.25 9 17.849999999999998 23.849999999999998 30.0 28.299999999999997 10-14 19.36 30.725 26.009999999999998 23.905 15-19 19.8 29.439999999999998 27.310000000000002 23.45 20-24 18.884999999999998 29.425 28.349999999999998 23.34 25-29 19.725 29.189999999999998 27.755000000000003 23.330000000000002 30-34 19.29 29.93 27.450000000000003 23.330000000000002 35-39 20.155 29.160000000000004 27.0 23.685000000000002 40-44 19.93 30.245 26.695 23.13 45-49 20.294999999999998 29.09 27.21 23.405 50-54 19.765 28.515 28.12 23.599999999999998 55-59 19.515 28.775000000000002 27.975 23.735 60-64 19.759999999999998 28.689999999999998 27.655 23.895 65-69 20.150000000000002 28.89 27.134999999999998 23.825 70-74 20.200000000000003 29.825000000000003 26.790000000000003 23.185 75-79 19.84 29.220000000000002 26.979999999999997 23.96 80-84 19.985 28.895 26.995 24.125 85-89 20.294999999999998 28.42 27.055 24.23 90-94 19.869999999999997 28.660000000000004 27.32 24.15 95-99 20.205000000000002 28.605000000000004 27.375 23.815 100-104 20.095 27.944999999999997 27.810000000000002 24.15 105-109 20.424999999999997 27.875 27.345000000000002 24.355 110-114 20.97 28.694999999999997 26.87 23.465 115-119 20.435 28.389999999999997 27.060000000000002 24.115000000000002 120-124 20.435 28.299999999999997 27.029999999999998 24.235 125-129 20.395 28.03 27.605 23.97 130-134 21.205 28.415000000000003 26.855 23.525 135-139 20.599999999999998 27.68 27.474999999999998 24.245 140-144 20.73 28.205000000000002 26.75 24.315 145-149 20.75 28.025 26.76 24.465 150-151 21.625 27.6625 27.0625 23.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 2.5 17 2.0 18 1.0 19 0.5 20 1.0 21 2.0 22 3.0 23 4.5 24 2.5 25 3.0 26 7.5 27 13.0 28 22.0 29 27.0 30 28.5 31 34.0 32 45.5 33 63.0 34 84.5 35 117.0 36 136.0 37 135.5 38 150.0 39 169.0 40 178.0 41 184.0 42 200.0 43 209.5 44 214.5 45 221.5 46 219.5 47 231.0 48 227.5 49 193.0 50 155.5 51 133.5 52 117.0 53 110.0 54 96.0 55 64.0 56 45.5 57 39.5 58 35.5 59 23.0 60 11.5 61 10.0 62 9.5 63 4.5 64 2.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 97.85585120123999 94.69999999999999 2 1.62748643761302 3.15 3 0.41332988891759237 1.2 4 0.07749935417204858 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025833118057349523 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 26 0.65 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 4.8 0.0 0.0 0.0 0.0 136-137 5.137499999999999 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAGAT 10 0.006577216 146.82278 1 >>END_MODULE SRR7170676 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170676_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.807 33.0 33.0 34.0 32.0 34.0 2 32.8695 34.0 33.0 34.0 32.0 34.0 3 32.8385 34.0 33.0 34.0 32.0 34.0 4 32.757 34.0 33.0 34.0 32.0 34.0 5 32.84225 34.0 33.0 34.0 32.0 34.0 6 36.93175 38.0 38.0 38.0 37.0 38.0 7 37.013 38.0 38.0 38.0 37.0 38.0 8 37.089 38.0 38.0 38.0 37.0 38.0 9 36.9635 38.0 38.0 38.0 37.0 38.0 10-14 36.9337 38.0 38.0 38.0 36.6 38.0 15-19 36.918600000000005 38.0 38.0 38.0 36.8 38.0 20-24 36.89145 38.0 38.0 38.0 37.0 38.0 25-29 36.845 38.0 38.0 38.0 36.4 38.0 30-34 36.79185 38.0 38.0 38.0 36.0 38.0 35-39 36.785999999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.82045 38.0 38.0 38.0 36.4 38.0 45-49 36.7452 38.0 38.0 38.0 36.0 38.0 50-54 36.677200000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.58565 38.0 38.0 38.0 36.0 38.0 60-64 36.49175 38.0 38.0 38.0 35.4 38.0 65-69 36.54155 38.0 38.0 38.0 35.6 38.0 70-74 36.47109999999999 38.0 38.0 38.0 35.0 38.0 75-79 36.3601 38.0 38.0 38.0 34.6 38.0 80-84 36.08284999999999 38.0 38.0 38.0 34.2 38.0 85-89 36.04175 38.0 38.0 38.0 34.2 38.0 90-94 35.93820000000001 38.0 38.0 38.0 34.0 38.0 95-99 35.7555 38.0 38.0 38.0 33.2 38.0 100-104 35.57325 38.0 37.8 38.0 32.2 38.0 105-109 35.47324999999999 38.0 37.4 38.0 31.4 38.0 110-114 35.29985 38.0 37.2 38.0 30.6 38.0 115-119 35.0139 38.0 36.2 38.0 28.6 38.0 120-124 34.97565 38.0 36.2 38.0 29.0 38.0 125-129 34.690599999999996 38.0 36.0 38.0 27.6 38.0 130-134 34.102399999999996 38.0 34.6 38.0 24.4 38.0 135-139 33.60105 38.0 33.2 38.0 21.8 38.0 140-144 33.05815 38.0 33.0 38.0 16.8 38.0 145-149 32.084649999999996 38.0 33.0 38.0 10.4 38.0 150-151 26.703625000000002 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 7.0 4 9.0 5 1.0 6 2.0 7 3.0 8 4.0 9 2.0 10 4.0 11 3.0 12 3.0 13 4.0 14 3.0 15 3.0 16 4.0 17 6.0 18 13.0 19 17.0 20 21.0 21 9.0 22 8.0 23 9.0 24 16.0 25 12.0 26 23.0 27 19.0 28 33.0 29 25.0 30 37.0 31 59.0 32 54.0 33 87.0 34 151.0 35 260.0 36 694.0 37 2376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.025000000000006 17.175 16.400000000000002 23.400000000000002 2 26.85 22.35 31.35 19.45 3 22.175 26.35 31.175000000000004 20.3 4 25.124999999999996 34.325 20.775 19.775000000000002 5 24.05 35.375 20.849999999999998 19.725 6 19.15 36.075 24.625 20.150000000000002 7 19.85 16.725 42.175000000000004 21.25 8 21.025 22.75 26.8 29.425 9 22.080520130032507 24.756189047261813 27.506876719179797 25.656414103525883 10-14 23.225 28.565 25.96 22.25 15-19 23.985 27.515 27.465 21.035 20-24 23.995 27.529999999999998 27.339999999999996 21.135 25-29 23.515 28.215 27.33 20.94 30-34 23.73 27.33 27.694999999999997 21.245 35-39 23.537353735373536 27.847784778477845 27.082708270827084 21.532153215321532 40-44 23.893584037605642 27.729159373906086 27.319097864679705 21.05815872380857 45-49 23.3 27.845 27.36 21.495 50-54 23.56 27.375 27.905 21.16 55-59 24.235 27.839999999999996 27.145000000000003 20.78 60-64 23.72 27.305 27.655 21.32 65-69 22.645 27.96 27.92 21.475 70-74 23.35 28.1 27.065 21.485000000000003 75-79 23.77618880944047 28.576428821441073 27.11635581779089 20.531026551327567 80-84 23.275000000000002 28.035 27.51 21.18 85-89 23.555 28.375 26.965 21.105 90-94 23.935000000000002 27.975 27.51 20.580000000000002 95-99 24.0 27.92 27.005000000000003 21.075 100-104 23.62 28.299999999999997 27.150000000000002 20.93 105-109 23.96 28.21 27.42 20.41 110-114 24.295 28.035 27.345000000000002 20.325 115-119 24.195 28.155 27.18 20.47 120-124 24.055 28.134999999999998 27.134999999999998 20.674999999999997 125-129 23.78 28.005000000000003 27.735 20.48 130-134 24.385 27.66 27.845 20.11 135-139 24.08 28.12 27.365000000000002 20.435 140-144 24.41 27.66 27.400000000000002 20.53 145-149 25.145 27.87 26.8 20.185 150-151 25.1875 27.224999999999998 27.775 19.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 2.5 24 1.5 25 3.5 26 5.5 27 5.0 28 6.5 29 12.0 30 15.5 31 16.5 32 26.0 33 30.5 34 41.5 35 64.5 36 80.5 37 99.0 38 130.5 39 160.5 40 172.5 41 184.0 42 201.0 43 230.0 44 252.5 45 246.5 46 239.5 47 242.5 48 236.0 49 224.5 50 195.0 51 150.5 52 139.0 53 121.0 54 95.5 55 82.5 56 68.5 57 55.0 58 41.5 59 34.0 60 24.5 61 17.5 62 12.0 63 6.5 64 4.0 65 2.5 66 2.0 67 2.5 68 1.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.98293250581847 94.72500000000001 2 1.5257305404706492 2.9499999999999997 3 0.3361779156969227 0.975 4 0.07757951900698215 0.3 5 0.0 0.0 6 0.02585983966899405 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02585983966899405 0.22499999999999998 >10 0.02585983966899405 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 27 0.675 Illumina Single End PCR Primer 1 (96% over 32bp) GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 9 0.22499999999999998 No Hit TCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.525 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.0250000000000004 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.7125000000000004 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.637499999999999 0.0 0.0 0.0 0.0 134-135 4.8625 0.0 0.0 0.0 0.0 136-137 5.2 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597425 spots for SRR7170676.sra Written 597425 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra Read 597424 spots for SRR7170676.sra Written 597424 spots for SRR7170676.sra SRR ids: ['SRR7170676.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vpkjt0bw SRR7170676.sra spots: 11948481 blocks: [[1, 597424], [597425, 1194848], [1194849, 1792272], [1792273, 2389696], [2389697, 2987120], [2987121, 3584544], [3584545, 4181968], [4181969, 4779392], [4779393, 5376816], [5376817, 5974240], [5974241, 6571664], [6571665, 7169088], [7169089, 7766512], [7766513, 8363936], [8363937, 8961360], [8961361, 9558784], [9558785, 10156208], [10156209, 10753632], [10753633, 11351056], [11351057, 11948481]] SRR7170676 file size 4027247 SRR7170676 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170676 SRR7170676_1.fastq SRR7170676_2.fastq Input file: SRR7170676_1.fastq Paired file: SRR7170676_2.fastq trimmed: SRR7170676-trimmed-pair1.fastq, SRR7170676-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:03:28 2025 >> started Thu Feb 13 16:03:42 2025 >> done (14.399s) 11948481 read pairs processed; of these: 25669 ( 0.21%) short read pairs filtered out after trimming by size control 110984 ( 0.93%) empty read pairs filtered out after trimming by size control 11811828 (98.86%) read pairs available; of these: 6426462 (54.41%) trimmed read pairs available after processing 5385366 (45.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 12 0.00% 20 18 0.00% 21 14 0.00% 22 12 0.00% 23 14 0.00% 24 15 0.00% 25 17 0.00% 26 17 0.00% 27 20 0.00% 28 9 0.00% 29 10 0.00% 30 20 0.00% 31 12 0.00% 32 16 0.00% 33 12 0.00% 34 17 0.00% 35 17 0.00% 36 11 0.00% 37 19 0.00% 38 20 0.00% 39 21 0.00% 40 36 0.00% 41 23 0.00% 42 36 0.00% 43 44 0.00% 44 38 0.00% 45 57 0.00% 46 85 0.00% 47 86 0.00% 48 105 0.00% 49 102 0.00% 50 137 0.00% 51 148 0.00% 52 147 0.00% 53 166 0.00% 54 169 0.00% 55 183 0.00% 56 223 0.00% 57 200 0.00% 58 241 0.00% 59 272 0.00% 60 304 0.00% 61 329 0.00% 62 411 0.00% 63 401 0.00% 64 449 0.00% 65 545 0.00% 66 523 0.00% 67 499 0.00% 68 654 0.01% 69 747 0.01% 70 803 0.01% 71 941 0.01% 72 1237 0.01% 73 1350 0.01% 74 1739 0.01% 75 2895 0.02% 76 5988 0.05% 77 5289 0.04% 78 2438 0.02% 79 2285 0.02% 80 2322 0.02% 81 2741 0.02% 82 2901 0.02% 83 3282 0.03% 84 4897 0.04% 85 5453 0.05% 86 5921 0.05% 87 5986 0.05% 88 6211 0.05% 89 6456 0.05% 90 6764 0.06% 91 6808 0.06% 92 7431 0.06% 93 7664 0.06% 94 7979 0.07% 95 8373 0.07% 96 8990 0.08% 97 9250 0.08% 98 9536 0.08% 99 9896 0.08% 100 10083 0.09% 101 10957 0.09% 102 11846 0.10% 103 12201 0.10% 104 12794 0.11% 105 13458 0.11% 106 13775 0.12% 107 14358 0.12% 108 14823 0.13% 109 15491 0.13% 110 15799 0.13% 111 16669 0.14% 112 17642 0.15% 113 18698 0.16% 114 19211 0.16% 115 19242 0.16% 116 19505 0.17% 117 20157 0.17% 118 20947 0.18% 119 21353 0.18% 120 22055 0.19% 121 22944 0.19% 122 23552 0.20% 123 25116 0.21% 124 26098 0.22% 125 26853 0.23% 126 27942 0.24% 127 28733 0.24% 128 29677 0.25% 129 31052 0.26% 130 32245 0.27% 131 34072 0.29% 132 36258 0.31% 133 37938 0.32% 134 40351 0.34% 135 43166 0.37% 136 45903 0.39% 137 49786 0.42% 138 53541 0.45% 139 58138 0.49% 140 64864 0.55% 141 71925 0.61% 142 80533 0.68% 143 93462 0.79% 144 110091 0.93% 145 136816 1.16% 146 172558 1.46% 147 240796 2.04% 148 376022 3.18% 149 761549 6.45% 150 3141904 26.60% 151 5385366 45.59% 11811828 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=14 prefix-density=0.92 prefix-fanout=2.3 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=57.93 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=21 prefix-density=0.64 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=72.50 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170676 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:04:36 Started mapping on | Feb 13 16:04:36 Finished on | Feb 13 16:07:34 Mapping speed, Million of reads per hour | 238.89 Number of input reads | 11811828 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10233136 Uniquely mapped reads % | 86.63% Average mapped length | 293.46 Number of splices: Total | 9245194 Number of splices: Annotated (sjdb) | 9048275 Number of splices: GT/AG | 9061743 Number of splices: GC/AG | 148039 Number of splices: AT/AC | 7960 Number of splices: Non-canonical | 27452 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336600 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 27319 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.20% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1262332 1262332 1262332 N_multimapping 336600 336600 336600 N_noFeature 270048 10034040 312822 N_ambiguous 249710 601 93159 UnstrandedReadsAssigned:9713378 PositiveStrandReadsAssigned:198495 NegativeStrandReadsAssigned:9827155 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170676 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170676-trimmed-pair1.fastq SRR7170676-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,811,828 reads, 9,821,200 reads pseudoaligned [quant] estimated average fragment length: 257.18 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7170676.ke.tsv 34699 SRR7170676.se.tsv 87100 total ==> SRR7170676.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.82 326 13.8187 Potri.005G024800.1.v4.1 1035 778.82 135 12.9452 Potri.004G059700.1.v4.1 961 704.835 11 1.16551 Potri.007G009000.2.v4.1 1416 1159.82 0 0 Potri.003G141000.2.v4.1 2943 2686.82 354 9.83956 Potri.016G087400.1.v4.1 270 76.35 660 645.574 Potri.015G069301.1.v4.1 564 313.67 0 0 Potri.010G195200.1.v4.1 1773 1516.82 12 0.590824 Potri.012G127500.1.v4.1 977 720.82 60 6.21635 ==> SRR7170676.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 337 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 447 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR7170676 completed mapping pipeline successfully