Starting /dee2/code/volunteer_pipeline.sh SRR7170677 current disk space = 3088799694848 free memory = 1412480956 SRR7170677 SRAfilesize 179731dd905eb533526741698781a8ba SRR7170677.sra SRR7170677.sra file validated SRR7170677 is paired end SRR7170677 is conventional basespace SRR7170677 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170677_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.027 18.0 18.0 31.0 18.0 33.0 2 27.157 29.0 25.0 31.0 18.0 33.0 3 29.7225 31.0 29.0 33.0 25.0 33.0 4 31.08175 33.0 31.0 33.0 28.0 33.0 5 31.75775 33.0 32.0 33.0 30.0 34.0 6 35.87875 38.0 36.0 38.0 31.0 38.0 7 36.526 38.0 37.0 38.0 34.0 38.0 8 37.01325 38.0 38.0 38.0 36.0 38.0 9 37.18425 38.0 38.0 38.0 36.0 38.0 10-14 37.2007 38.0 38.0 38.0 36.2 38.0 15-19 37.19525 38.0 38.0 38.0 36.6 38.0 20-24 37.1012 38.0 38.0 38.0 36.2 38.0 25-29 37.206100000000006 38.0 38.0 38.0 36.2 38.0 30-34 37.199650000000005 38.0 38.0 38.0 36.6 38.0 35-39 37.202099999999994 38.0 38.0 38.0 36.8 38.0 40-44 37.06485 38.0 38.0 38.0 36.0 38.0 45-49 37.054700000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.8839 38.0 38.0 38.0 35.2 38.0 55-59 36.7993 38.0 38.0 38.0 35.2 38.0 60-64 36.790150000000004 38.0 38.0 38.0 34.8 38.0 65-69 36.6221 38.0 38.0 38.0 34.4 38.0 70-74 36.54185 38.0 38.0 38.0 34.0 38.0 75-79 36.34785 38.0 37.8 38.0 33.8 38.0 80-84 36.2242 38.0 37.4 38.0 33.6 38.0 85-89 36.1187 38.0 37.0 38.0 33.2 38.0 90-94 35.78105000000001 38.0 37.0 38.0 31.2 38.0 95-99 35.6321 38.0 36.8 38.0 30.0 38.0 100-104 35.46385 38.0 36.4 38.0 29.0 38.0 105-109 35.320550000000004 38.0 36.0 38.0 28.8 38.0 110-114 35.28240000000001 38.0 36.0 38.0 28.8 38.0 115-119 35.083000000000006 38.0 35.6 38.0 28.2 38.0 120-124 34.701049999999995 38.0 35.2 38.0 27.0 38.0 125-129 34.24375 38.0 34.4 38.0 24.2 38.0 130-134 34.12405 38.0 34.6 38.0 23.6 38.0 135-139 33.2356 38.0 32.6 38.0 19.2 38.0 140-144 32.606700000000004 38.0 32.4 38.0 14.4 38.0 145-149 31.2577 37.4 30.8 38.0 8.4 38.0 150-151 24.936 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 0.0 12 0.0 13 3.0 14 1.0 15 1.0 16 2.0 17 2.0 18 6.0 19 8.0 20 7.0 21 7.0 22 9.0 23 8.0 24 19.0 25 25.0 26 30.0 27 28.0 28 58.0 29 44.0 30 74.0 31 88.0 32 110.0 33 157.0 34 263.0 35 492.0 36 1043.0 37 1509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.19760790431617 22.85491419656786 10.816432657306292 26.131045241809677 2 19.725 25.025 36.6 18.65 3 14.725 34.075 28.199999999999996 23.0 4 20.4 36.625 23.3 19.675 5 20.025000000000002 38.65 23.625 17.7 6 16.425 35.825 25.55 22.2 7 11.725 20.474999999999998 47.125 20.674999999999997 8 16.8 20.8 28.499999999999996 33.900000000000006 9 17.575 22.075 30.225 30.125 10-14 19.67 30.34 26.479999999999997 23.51 15-19 20.005 29.189999999999998 27.544999999999998 23.26 20-24 19.59 29.595 27.925 22.89 25-29 19.485 29.79 27.375 23.35 30-34 20.05 30.320000000000004 26.57 23.06 35-39 20.185 29.74 26.765 23.31 40-44 19.81 29.425 27.405 23.36 45-49 19.869999999999997 29.630000000000003 27.08 23.419999999999998 50-54 20.085 29.325000000000003 26.955000000000002 23.635 55-59 19.794999999999998 28.825 28.000000000000004 23.380000000000003 60-64 19.99 29.185 27.500000000000004 23.325000000000003 65-69 19.81 28.785 27.68 23.724999999999998 70-74 19.485 29.659999999999997 27.555000000000003 23.3 75-79 19.845 28.994999999999997 27.560000000000002 23.599999999999998 80-84 19.830000000000002 29.17 27.455000000000002 23.544999999999998 85-89 20.625 29.07 26.955000000000002 23.35 90-94 20.345 29.54 27.415 22.7 95-99 20.555 28.315 27.495000000000005 23.635 100-104 20.24 28.465 28.015 23.28 105-109 20.580000000000002 27.79 27.810000000000002 23.82 110-114 20.125 28.060000000000002 27.800000000000004 24.015 115-119 20.48 28.465 27.79 23.265 120-124 20.105 28.615000000000002 27.715 23.565 125-129 20.544999999999998 28.46 27.18 23.815 130-134 20.79 27.905 27.275 24.03 135-139 20.044999999999998 28.225 28.025 23.705000000000002 140-144 20.355 27.595 27.845 24.205 145-149 20.265 28.515 27.375 23.845 150-151 20.825 27.0125 27.875 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 2.5 19 4.0 20 2.0 21 2.5 22 2.0 23 2.0 24 2.5 25 6.0 26 8.5 27 11.0 28 17.5 29 24.5 30 28.5 31 36.0 32 49.5 33 58.0 34 69.0 35 87.0 36 111.0 37 134.0 38 148.5 39 170.0 40 197.5 41 220.0 42 244.0 43 241.0 44 254.5 45 257.0 46 223.0 47 213.0 48 208.0 49 201.5 50 178.5 51 130.5 52 103.0 53 92.5 54 74.5 55 55.5 56 40.0 57 28.0 58 17.5 59 13.0 60 9.5 61 6.5 62 5.0 63 3.5 64 1.0 65 0.5 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2936427850656 98.4 2 0.5802219979818365 1.15 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 4.0125 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 4.862500000000001 0.0 0.0 0.0 0.0 136-137 5.4 0.0 0.0 0.0 0.0 138-139 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170677 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170677_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34575 33.0 33.0 34.0 31.0 34.0 2 32.4165 33.0 33.0 34.0 31.0 34.0 3 32.37325 33.0 33.0 34.0 31.0 34.0 4 32.2715 33.0 33.0 34.0 31.0 34.0 5 32.19325 33.0 33.0 34.0 31.0 34.0 6 36.366 38.0 38.0 38.0 34.0 38.0 7 36.58425 38.0 38.0 38.0 35.0 38.0 8 36.3345 38.0 38.0 38.0 34.0 38.0 9 36.46175 38.0 38.0 38.0 34.0 38.0 10-14 36.345150000000004 38.0 38.0 38.0 34.0 38.0 15-19 36.23825 38.0 38.0 38.0 34.0 38.0 20-24 36.2572 38.0 38.0 38.0 34.0 38.0 25-29 36.2064 38.0 38.0 38.0 33.8 38.0 30-34 36.26605 38.0 38.0 38.0 34.0 38.0 35-39 36.0757 38.0 38.0 38.0 33.4 38.0 40-44 36.0953 38.0 38.0 38.0 33.4 38.0 45-49 35.89175 38.0 37.8 38.0 32.4 38.0 50-54 35.9448 38.0 38.0 38.0 32.8 38.0 55-59 35.88535 38.0 38.0 38.0 32.8 38.0 60-64 35.70890000000001 38.0 37.8 38.0 31.4 38.0 65-69 35.743849999999995 38.0 37.6 38.0 31.4 38.0 70-74 35.64055 38.0 37.6 38.0 31.0 38.0 75-79 35.61225 38.0 37.0 38.0 31.2 38.0 80-84 35.39475 38.0 37.0 38.0 30.0 38.0 85-89 35.227500000000006 38.0 37.0 38.0 29.2 38.0 90-94 35.012449999999994 38.0 37.0 38.0 28.6 38.0 95-99 34.928749999999994 38.0 36.2 38.0 28.2 38.0 100-104 34.69755 38.0 36.0 38.0 27.0 38.0 105-109 34.71275 38.0 36.0 38.0 26.8 38.0 110-114 34.41725 38.0 35.6 38.0 24.4 38.0 115-119 34.0295 38.0 34.8 38.0 21.8 38.0 120-124 33.6149 38.0 34.0 38.0 19.0 38.0 125-129 33.1545 38.0 33.0 38.0 15.0 38.0 130-134 32.663149999999995 38.0 32.6 38.0 15.8 38.0 135-139 31.899249999999995 38.0 31.4 38.0 13.0 38.0 140-144 30.78695 36.4 29.0 38.0 10.2 38.0 145-149 29.465300000000003 36.0 28.0 38.0 2.0 38.0 150-151 23.779625 31.0 11.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 10.0 4 6.0 5 3.0 6 2.0 7 5.0 8 7.0 9 4.0 10 6.0 11 4.0 12 7.0 13 4.0 14 4.0 15 5.0 16 9.0 17 7.0 18 9.0 19 10.0 20 19.0 21 19.0 22 17.0 23 24.0 24 23.0 25 35.0 26 29.0 27 35.0 28 46.0 29 51.0 30 85.0 31 94.0 32 127.0 33 154.0 34 234.0 35 390.0 36 800.0 37 1690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.675 17.45 14.825 22.05 2 25.4 22.075 32.725 19.8 3 20.0 27.35 31.900000000000002 20.75 4 24.4 34.875 21.6 19.125 5 23.799999999999997 36.35 22.325 17.525 6 17.8 37.95 24.65 19.6 7 17.224999999999998 18.0 44.55 20.225 8 19.950000000000003 22.375 28.425 29.25 9 21.8 23.75 27.900000000000002 26.55 10-14 23.1 27.805000000000003 27.165 21.93 15-19 23.064999999999998 27.284999999999997 28.775000000000002 20.875 20-24 22.795 28.48 27.705000000000002 21.02 25-29 23.14 27.735 28.53 20.595 30-34 23.1 28.115000000000002 28.43 20.355 35-39 23.64 28.349999999999998 27.825 20.185 40-44 23.24 27.63 28.46 20.669999999999998 45-49 23.275000000000002 28.01 28.000000000000004 20.715 50-54 22.939999999999998 27.755000000000003 28.4 20.905 55-59 23.095 27.965 28.04 20.9 60-64 23.115 27.765 28.1 21.02 65-69 22.84 28.065 27.525 21.57 70-74 23.18 27.889999999999997 28.21 20.72 75-79 23.055 28.294999999999998 27.634999999999998 21.015 80-84 22.919999999999998 28.26 27.93 20.89 85-89 23.685000000000002 27.860000000000003 27.72 20.735 90-94 23.315 27.66 28.315 20.71 95-99 23.53 27.650000000000002 28.189999999999998 20.630000000000003 100-104 23.745 27.46 28.310000000000002 20.485 105-109 23.830000000000002 28.044999999999998 28.01 20.115 110-114 23.555 28.125 28.199999999999996 20.119999999999997 115-119 23.985 27.655 27.715 20.645 120-124 24.205 27.884999999999998 27.785 20.125 125-129 24.205 27.91 28.060000000000002 19.825 130-134 24.104999999999997 27.889999999999997 27.725 20.28 135-139 24.43 28.035 27.935 19.6 140-144 24.98 27.084999999999997 27.665 20.27 145-149 24.63 27.615000000000002 28.105000000000004 19.650000000000002 150-151 24.4 27.3375 28.4125 19.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 2.5 19 2.5 20 2.0 21 2.0 22 0.5 23 2.5 24 4.0 25 4.0 26 6.0 27 7.5 28 11.0 29 17.5 30 18.5 31 22.0 32 31.0 33 41.5 34 50.0 35 61.0 36 78.5 37 104.0 38 135.0 39 166.5 40 188.5 41 214.0 42 228.0 43 244.0 44 270.0 45 293.0 46 276.5 47 230.0 48 225.0 49 210.5 50 176.5 51 141.0 52 111.5 53 98.0 54 77.0 55 63.5 56 52.5 57 32.0 58 29.5 59 24.0 60 15.0 61 12.0 62 6.5 63 2.5 64 0.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16561314791403 98.05 2 0.6826801517067004 1.35 3 0.07585335018963338 0.22499999999999998 4 0.025284450063211124 0.1 5 0.025284450063211124 0.125 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.11249999999999999 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.4625 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.4625 0.0 0.0 0.0 0.0 134-135 4.762499999999999 0.0 0.0 0.0 0.0 136-137 5.324999999999999 0.0 0.0 0.0 0.0 138-139 5.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGTG 10 0.006830828 145.0 7 GTTGCTG 10 0.006830828 145.0 1 >>END_MODULE Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra Read 852797 spots for SRR7170677.sra Written 852797 spots for SRR7170677.sra Read 852791 spots for SRR7170677.sra Written 852791 spots for SRR7170677.sra SRR ids: ['SRR7170677.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p1qsf9q1 SRR7170677.sra spots: 17055826 blocks: [[1, 852791], [852792, 1705582], [1705583, 2558373], [2558374, 3411164], [3411165, 4263955], [4263956, 5116746], [5116747, 5969537], [5969538, 6822328], [6822329, 7675119], [7675120, 8527910], [8527911, 9380701], [9380702, 10233492], [10233493, 11086283], [11086284, 11939074], [11939075, 12791865], [12791866, 13644656], [13644657, 14497447], [14497448, 15350238], [15350239, 16203029], [16203030, 17055826]] SRR7170677 file size 5757959 SRR7170677 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170677 SRR7170677_1.fastq SRR7170677_2.fastq Input file: SRR7170677_1.fastq Paired file: SRR7170677_2.fastq trimmed: SRR7170677-trimmed-pair1.fastq, SRR7170677-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:50:58 2025 >> started Thu Feb 13 15:51:27 2025 >> done (28.996s) 17055826 read pairs processed; of these: 41537 ( 0.24%) short read pairs filtered out after trimming by size control 56972 ( 0.33%) empty read pairs filtered out after trimming by size control 16957317 (99.42%) read pairs available; of these: 10817673 (63.79%) trimmed read pairs available after processing 6139644 (36.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 9 0.00% 21 5 0.00% 22 7 0.00% 23 3 0.00% 24 10 0.00% 25 17 0.00% 26 14 0.00% 27 17 0.00% 28 7 0.00% 29 11 0.00% 30 13 0.00% 31 10 0.00% 32 16 0.00% 33 13 0.00% 34 7 0.00% 35 14 0.00% 36 17 0.00% 37 22 0.00% 38 26 0.00% 39 25 0.00% 40 28 0.00% 41 23 0.00% 42 44 0.00% 43 37 0.00% 44 29 0.00% 45 58 0.00% 46 53 0.00% 47 75 0.00% 48 88 0.00% 49 99 0.00% 50 107 0.00% 51 121 0.00% 52 111 0.00% 53 146 0.00% 54 148 0.00% 55 163 0.00% 56 182 0.00% 57 235 0.00% 58 285 0.00% 59 265 0.00% 60 295 0.00% 61 363 0.00% 62 414 0.00% 63 449 0.00% 64 479 0.00% 65 481 0.00% 66 593 0.00% 67 644 0.00% 68 672 0.00% 69 837 0.00% 70 895 0.01% 71 1061 0.01% 72 1333 0.01% 73 1426 0.01% 74 1657 0.01% 75 2042 0.01% 76 2640 0.02% 77 2655 0.02% 78 2319 0.01% 79 2613 0.02% 80 2798 0.02% 81 3202 0.02% 82 3724 0.02% 83 4341 0.03% 84 6183 0.04% 85 7322 0.04% 86 7515 0.04% 87 7771 0.05% 88 8070 0.05% 89 8377 0.05% 90 8759 0.05% 91 9402 0.06% 92 9994 0.06% 93 10844 0.06% 94 11208 0.07% 95 11875 0.07% 96 12541 0.07% 97 12783 0.08% 98 13429 0.08% 99 14020 0.08% 100 14745 0.09% 101 15780 0.09% 102 16972 0.10% 103 17861 0.11% 104 18724 0.11% 105 19833 0.12% 106 20296 0.12% 107 20939 0.12% 108 21632 0.13% 109 22164 0.13% 110 23126 0.14% 111 24229 0.14% 112 25510 0.15% 113 26909 0.16% 114 28235 0.17% 115 29377 0.17% 116 30468 0.18% 117 31736 0.19% 118 32506 0.19% 119 33861 0.20% 120 35783 0.21% 121 37192 0.22% 122 39160 0.23% 123 41823 0.25% 124 43716 0.26% 125 46235 0.27% 126 49056 0.29% 127 51586 0.30% 128 53975 0.32% 129 57273 0.34% 130 60567 0.36% 131 64636 0.38% 132 69713 0.41% 133 75391 0.44% 134 82086 0.48% 135 89344 0.53% 136 97625 0.58% 137 107349 0.63% 138 117694 0.69% 139 129985 0.77% 140 144380 0.85% 141 163548 0.96% 142 184914 1.09% 143 213104 1.26% 144 249568 1.47% 145 296492 1.75% 146 377476 2.23% 147 494831 2.92% 148 747171 4.41% 149 1387937 8.18% 150 4532565 26.73% 151 6139644 36.21% 16957317 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=50.31 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAAT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=12 prefix-density=0.67 prefix-fanout=2.4 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=105.07 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA SRR7170677 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:52:23 Started mapping on | Feb 13 15:52:23 Finished on | Feb 13 15:54:51 Mapping speed, Million of reads per hour | 412.48 Number of input reads | 16957317 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15965602 Uniquely mapped reads % | 94.15% Average mapped length | 291.86 Number of splices: Total | 14729594 Number of splices: Annotated (sjdb) | 14362431 Number of splices: GT/AG | 14432642 Number of splices: GC/AG | 236960 Number of splices: AT/AC | 9417 Number of splices: Non-canonical | 50575 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438887 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 15216 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 589351 589351 589351 N_multimapping 438887 438887 438887 N_noFeature 679656 15658351 778097 N_ambiguous 332739 1187 123229 UnstrandedReadsAssigned:14953207 PositiveStrandReadsAssigned:306064 NegativeStrandReadsAssigned:15064276 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170677 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170677-trimmed-pair1.fastq SRR7170677-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,957,317 reads, 15,011,055 reads pseudoaligned [quant] estimated average fragment length: 261.049 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7170677.ke.tsv 34699 SRR7170677.se.tsv 87100 total ==> SRR7170677.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.95 642 21.8796 Potri.005G024800.1.v4.1 1035 774.951 225 17.3948 Potri.004G059700.1.v4.1 961 700.988 26 2.22215 Potri.007G009000.2.v4.1 1416 1155.95 0 0 Potri.003G141000.2.v4.1 2943 2682.95 785 17.5294 Potri.016G087400.1.v4.1 270 77.2199 852 661.029 Potri.015G069301.1.v4.1 564 311.437 0 0 Potri.010G195200.1.v4.1 1773 1512.95 53 2.09876 Potri.012G127500.1.v4.1 977 716.978 306 25.5697 ==> SRR7170677.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1444 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 356 Potri.001G212900.v4.1 30 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 330 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR7170677 completed mapping pipeline successfully