Starting /dee2/code/volunteer_pipeline.sh SRR7170678 current disk space = 3088983601152 free memory = 1473486100 SRR7170678 SRAfilesize 040539c02a42b5e50f206516285fde06 SRR7170678.sra SRR7170678.sra file validated SRR7170678 is paired end SRR7170678 is conventional basespace SRR7170678 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170678_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.29725 30.0 18.0 32.0 18.0 33.0 2 30.179 31.0 29.0 33.0 27.0 33.0 3 30.6695 31.0 29.0 33.0 27.0 33.0 4 31.178 33.0 32.0 33.0 28.0 33.0 5 32.34775 33.0 33.0 33.0 32.0 33.0 6 36.70475 38.0 37.0 38.0 34.0 38.0 7 37.211 38.0 38.0 38.0 36.0 38.0 8 37.444 38.0 38.0 38.0 37.0 38.0 9 37.436 38.0 38.0 38.0 37.0 38.0 10-14 37.39955 38.0 38.0 38.0 37.0 38.0 15-19 37.44725 38.0 38.0 38.0 37.2 38.0 20-24 37.52735 38.0 38.0 38.0 37.8 38.0 25-29 37.57935 38.0 38.0 38.0 38.0 38.0 30-34 37.56265 38.0 38.0 38.0 38.0 38.0 35-39 37.513650000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.4505 38.0 38.0 38.0 37.2 38.0 45-49 37.448899999999995 38.0 38.0 38.0 37.4 38.0 50-54 37.3645 38.0 38.0 38.0 37.0 38.0 55-59 37.289849999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.2264 38.0 38.0 38.0 36.4 38.0 65-69 37.10785 38.0 38.0 38.0 36.0 38.0 70-74 37.111650000000004 38.0 38.0 38.0 36.2 38.0 75-79 37.07715 38.0 38.0 38.0 36.0 38.0 80-84 36.977549999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.90365 38.0 38.0 38.0 35.4 38.0 90-94 36.86035 38.0 38.0 38.0 35.2 38.0 95-99 36.7586 38.0 38.0 38.0 35.0 38.0 100-104 36.526050000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.4222 38.0 37.8 38.0 34.0 38.0 110-114 36.27645 38.0 37.6 38.0 33.8 38.0 115-119 35.93575 38.0 37.0 38.0 32.4 38.0 120-124 35.805550000000004 38.0 36.4 38.0 32.0 38.0 125-129 35.82045 38.0 36.0 38.0 32.6 38.0 130-134 35.5389 38.0 36.0 38.0 31.0 38.0 135-139 35.145900000000005 38.0 35.6 38.0 29.8 38.0 140-144 34.4246 38.0 33.8 38.0 26.4 38.0 145-149 33.9575 38.0 33.0 38.0 25.2 38.0 150-151 29.74425 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 4.0 20 4.0 21 6.0 22 2.0 23 5.0 24 7.0 25 6.0 26 10.0 27 16.0 28 20.0 29 26.0 30 34.0 31 37.0 32 74.0 33 90.0 34 154.0 35 342.0 36 827.0 37 2327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.51898734177215 16.0 10.075949367088608 28.405063291139243 2 20.349999999999998 23.0 34.825 21.825 3 18.75 29.299999999999997 26.8 25.15 4 22.400000000000002 36.125 21.625 19.85 5 21.7 36.05 22.125 20.125 6 17.275 34.175 24.375 24.175 7 14.399999999999999 19.425 44.85 21.325 8 17.95 20.125 29.075 32.85 9 18.025 22.5 29.125 30.349999999999998 10-14 20.505000000000003 28.16 25.595000000000002 25.740000000000002 15-19 20.895 27.305 26.905 24.895 20-24 20.715 28.16 27.034999999999997 24.09 25-29 21.18 27.905 26.695 24.22 30-34 20.97 27.29 26.455000000000002 25.285000000000004 35-39 20.865000000000002 28.144999999999996 26.565 24.425 40-44 21.545 27.860000000000003 26.745 23.849999999999998 45-49 21.8 28.044999999999998 25.724999999999998 24.43 50-54 21.029999999999998 27.51 26.775 24.685000000000002 55-59 21.515 27.67 26.72 24.095 60-64 21.075 28.17 26.150000000000002 24.605 65-69 21.165 27.295 26.235000000000003 25.305 70-74 21.73 27.834999999999997 26.290000000000003 24.145 75-79 21.97 27.02 25.935000000000002 25.074999999999996 80-84 21.605 27.05 26.5 24.845 85-89 21.34 27.51 26.06 25.09 90-94 21.45 27.42 26.619999999999997 24.51 95-99 21.23 27.834999999999997 26.314999999999998 24.62 100-104 21.67 27.495000000000005 26.450000000000003 24.385 105-109 21.935 27.62 25.61 24.834999999999997 110-114 21.765 27.339999999999996 26.369999999999997 24.525 115-119 22.235 27.18 26.185000000000002 24.4 120-124 21.565 27.82 26.479999999999997 24.135 125-129 22.439999999999998 26.8 26.015 24.745 130-134 21.935 27.08 26.185000000000002 24.8 135-139 22.134999999999998 27.139999999999997 25.935000000000002 24.79 140-144 22.564999999999998 26.915 26.235000000000003 24.285 145-149 22.015 27.310000000000002 25.89 24.785 150-151 21.912499999999998 28.075 25.3125 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 1.0 22 1.0 23 1.5 24 3.5 25 5.0 26 2.5 27 2.0 28 8.5 29 12.0 30 12.5 31 19.0 32 27.5 33 30.0 34 37.5 35 52.0 36 67.0 37 78.0 38 87.5 39 121.0 40 146.0 41 155.5 42 183.5 43 216.0 44 224.0 45 231.0 46 236.0 47 238.0 48 246.0 49 253.0 50 227.0 51 179.0 52 165.5 53 142.5 54 121.0 55 110.0 56 83.0 57 68.0 58 57.0 59 51.5 60 35.0 61 14.5 62 12.5 63 6.0 64 4.5 65 6.0 66 4.5 67 2.0 68 3.0 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 97.81883500128303 95.3 2 1.8219142930459329 3.55 3 0.25660764690787785 0.75 4 0.10264305876315115 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.4625000000000004 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.325 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.7875 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.3375 0.0 0.0 0.0 0.0 138-139 4.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170678 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170678_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64675 33.0 33.0 34.0 32.0 34.0 2 32.751 33.0 33.0 34.0 32.0 34.0 3 32.7405 33.0 33.0 34.0 32.0 34.0 4 32.57525 34.0 33.0 34.0 32.0 34.0 5 32.68 34.0 33.0 34.0 32.0 34.0 6 36.71125 38.0 38.0 38.0 36.0 38.0 7 36.86425 38.0 38.0 38.0 36.0 38.0 8 36.802 38.0 38.0 38.0 36.0 38.0 9 36.6845 38.0 38.0 38.0 36.0 38.0 10-14 36.6996 38.0 38.0 38.0 35.8 38.0 15-19 36.597899999999996 38.0 38.0 38.0 35.6 38.0 20-24 36.6113 38.0 38.0 38.0 35.4 38.0 25-29 36.55780000000001 38.0 38.0 38.0 35.2 38.0 30-34 36.528549999999996 38.0 38.0 38.0 35.4 38.0 35-39 36.53695 38.0 38.0 38.0 35.6 38.0 40-44 36.50625 38.0 38.0 38.0 35.8 38.0 45-49 36.45725 38.0 38.0 38.0 35.4 38.0 50-54 36.396249999999995 38.0 38.0 38.0 35.0 38.0 55-59 36.3408 38.0 38.0 38.0 34.8 38.0 60-64 36.275549999999996 38.0 38.0 38.0 34.2 38.0 65-69 36.1604 38.0 38.0 38.0 34.0 38.0 70-74 36.1048 38.0 38.0 38.0 34.0 38.0 75-79 36.0509 38.0 38.0 38.0 33.6 38.0 80-84 35.94505 38.0 38.0 38.0 33.4 38.0 85-89 35.826550000000005 38.0 38.0 38.0 33.2 38.0 90-94 35.7617 38.0 37.8 38.0 33.0 38.0 95-99 35.6452 38.0 38.0 38.0 32.0 38.0 100-104 35.41330000000001 38.0 37.2 38.0 31.0 38.0 105-109 35.272749999999995 38.0 37.0 38.0 30.2 38.0 110-114 35.082550000000005 38.0 36.8 38.0 29.6 38.0 115-119 34.80515 38.0 36.0 38.0 27.8 38.0 120-124 34.7222 38.0 36.0 38.0 27.4 38.0 125-129 34.43485 38.0 35.4 38.0 25.6 38.0 130-134 33.855149999999995 38.0 33.6 38.0 22.8 38.0 135-139 33.40035 38.0 33.0 38.0 18.6 38.0 140-144 32.73745 38.0 33.0 38.0 13.6 38.0 145-149 31.597199999999997 38.0 32.6 38.0 8.0 38.0 150-151 26.235375 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 16.0 4 5.0 5 6.0 6 5.0 7 5.0 8 3.0 9 12.0 10 3.0 11 6.0 12 3.0 13 2.0 14 3.0 15 13.0 16 12.0 17 6.0 18 6.0 19 6.0 20 9.0 21 10.0 22 7.0 23 7.0 24 20.0 25 19.0 26 21.0 27 30.0 28 35.0 29 44.0 30 51.0 31 61.0 32 67.0 33 103.0 34 159.0 35 302.0 36 689.0 37 2243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.725 16.525000000000002 13.950000000000001 25.8 2 22.225 22.55 33.475 21.75 3 21.25 25.6 32.1 21.05 4 24.4 33.425 21.224999999999998 20.95 5 21.65 37.3 22.400000000000002 18.65 6 19.475 35.75 23.575 21.2 7 18.0 16.975 40.675 24.349999999999998 8 19.425 22.475 26.200000000000003 31.900000000000002 9 21.55 24.2 27.0 27.250000000000004 10-14 22.84 27.54 26.07 23.549999999999997 15-19 23.494999999999997 26.87 27.07 22.564999999999998 20-24 22.965 27.229999999999997 27.52 22.285 25-29 22.645 27.47 27.065 22.82 30-34 23.165 26.345000000000002 27.965 22.525000000000002 35-39 23.7 26.75 27.01 22.54 40-44 23.89 26.369999999999997 27.11 22.63 45-49 23.62 26.005 28.015 22.36 50-54 23.445 26.905 26.56 23.09 55-59 23.810000000000002 26.19 27.355 22.645 60-64 23.575 26.645000000000003 26.729999999999997 23.05 65-69 24.16 26.445 26.240000000000002 23.155 70-74 23.485 27.284999999999997 25.415 23.815 75-79 24.33 26.69 26.279999999999998 22.7 80-84 24.11 26.090000000000003 27.22 22.58 85-89 24.54 26.179999999999996 26.82 22.46 90-94 24.285 26.484999999999996 27.16 22.07 95-99 23.5 26.77 26.529999999999998 23.200000000000003 100-104 24.505 26.6 27.200000000000003 21.695 105-109 24.46 26.71 26.86 21.97 110-114 24.335 27.045 26.345000000000002 22.275 115-119 24.705 26.745 26.985 21.565 120-124 24.465 26.71 26.369999999999997 22.455 125-129 24.535 26.715 27.375 21.375 130-134 24.985 26.21 26.66 22.145 135-139 24.779999999999998 26.529999999999998 27.195000000000004 21.495 140-144 24.8 27.265 25.874999999999996 22.06 145-149 24.9 26.584999999999997 26.405 22.11 150-151 26.137500000000003 25.75 25.874999999999996 22.237499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 1.5 24 1.5 25 3.0 26 3.5 27 3.0 28 4.0 29 7.5 30 11.5 31 15.0 32 18.5 33 25.5 34 34.0 35 46.5 36 62.5 37 70.5 38 84.5 39 111.5 40 125.5 41 147.5 42 177.0 43 206.5 44 248.5 45 272.0 46 262.5 47 237.5 48 230.0 49 222.0 50 193.5 51 167.5 52 153.5 53 149.0 54 140.0 55 117.5 56 104.5 57 86.0 58 59.0 59 50.5 60 38.0 61 29.5 62 27.0 63 19.0 64 11.5 65 3.5 66 1.5 67 2.5 68 2.5 69 2.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.59627810803825 94.39999999999999 2 1.757560093047299 3.4000000000000004 3 0.3876970793486689 1.125 4 0.18092530369604548 0.7000000000000001 5 0.07753941586973379 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit GCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCG 5 0.125 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.475 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 3.925 0.0 0.0 0.0 0.0 134-135 4.2 0.0 0.0 0.0 0.0 136-137 4.4875 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGCAT 10 0.006830828 145.0 1 TGTCGGG 10 0.006830828 145.0 3 GTCGGGA 10 0.006830828 145.0 4 >>END_MODULE Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra Read 431006 spots for SRR7170678.sra Written 431006 spots for SRR7170678.sra Read 430989 spots for SRR7170678.sra Written 430989 spots for SRR7170678.sra SRR ids: ['SRR7170678.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dju1jla7 SRR7170678.sra spots: 8619797 blocks: [[1, 430989], [430990, 861978], [861979, 1292967], [1292968, 1723956], [1723957, 2154945], [2154946, 2585934], [2585935, 3016923], [3016924, 3447912], [3447913, 3878901], [3878902, 4309890], [4309891, 4740879], [4740880, 5171868], [5171869, 5602857], [5602858, 6033846], [6033847, 6464835], [6464836, 6895824], [6895825, 7326813], [7326814, 7757802], [7757803, 8188791], [8188792, 8619797]] SRR7170678 file size 2901961 SRR7170678 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170678 SRR7170678_1.fastq SRR7170678_2.fastq Input file: SRR7170678_1.fastq Paired file: SRR7170678_2.fastq trimmed: SRR7170678-trimmed-pair1.fastq, SRR7170678-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:10:19 2025 >> started Thu Feb 13 16:10:28 2025 >> done (9.558s) 8619797 read pairs processed; of these: 17169 ( 0.20%) short read pairs filtered out after trimming by size control 18677 ( 0.22%) empty read pairs filtered out after trimming by size control 8583951 (99.58%) read pairs available; of these: 4646755 (54.13%) trimmed read pairs available after processing 3937196 (45.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 10 0.00% 21 4 0.00% 22 12 0.00% 23 9 0.00% 24 5 0.00% 25 7 0.00% 26 8 0.00% 27 4 0.00% 28 4 0.00% 29 8 0.00% 30 4 0.00% 31 11 0.00% 32 11 0.00% 33 7 0.00% 34 10 0.00% 35 9 0.00% 36 14 0.00% 37 17 0.00% 38 26 0.00% 39 9 0.00% 40 16 0.00% 41 19 0.00% 42 15 0.00% 43 16 0.00% 44 13 0.00% 45 19 0.00% 46 23 0.00% 47 32 0.00% 48 39 0.00% 49 42 0.00% 50 48 0.00% 51 63 0.00% 52 72 0.00% 53 73 0.00% 54 59 0.00% 55 79 0.00% 56 78 0.00% 57 86 0.00% 58 107 0.00% 59 124 0.00% 60 160 0.00% 61 196 0.00% 62 204 0.00% 63 230 0.00% 64 245 0.00% 65 276 0.00% 66 315 0.00% 67 304 0.00% 68 346 0.00% 69 423 0.00% 70 506 0.01% 71 533 0.01% 72 696 0.01% 73 752 0.01% 74 822 0.01% 75 963 0.01% 76 1269 0.01% 77 1256 0.01% 78 1218 0.01% 79 1412 0.02% 80 1485 0.02% 81 1711 0.02% 82 1979 0.02% 83 2287 0.03% 84 3187 0.04% 85 3774 0.04% 86 3866 0.05% 87 4095 0.05% 88 4159 0.05% 89 4370 0.05% 90 4614 0.05% 91 4757 0.06% 92 5118 0.06% 93 5458 0.06% 94 5779 0.07% 95 6017 0.07% 96 6350 0.07% 97 6335 0.07% 98 6668 0.08% 99 6688 0.08% 100 7038 0.08% 101 7496 0.09% 102 8167 0.10% 103 8537 0.10% 104 9012 0.10% 105 9531 0.11% 106 9600 0.11% 107 9508 0.11% 108 10020 0.12% 109 10373 0.12% 110 10892 0.13% 111 11197 0.13% 112 11764 0.14% 113 12888 0.15% 114 13236 0.15% 115 13160 0.15% 116 13513 0.16% 117 13914 0.16% 118 14497 0.17% 119 14693 0.17% 120 15405 0.18% 121 16037 0.19% 122 16537 0.19% 123 17665 0.21% 124 18210 0.21% 125 19209 0.22% 126 20027 0.23% 127 20657 0.24% 128 21671 0.25% 129 22515 0.26% 130 23838 0.28% 131 24581 0.29% 132 26759 0.31% 133 28142 0.33% 134 30113 0.35% 135 32853 0.38% 136 34797 0.41% 137 37533 0.44% 138 40622 0.47% 139 44320 0.52% 140 49194 0.57% 141 54922 0.64% 142 61531 0.72% 143 71488 0.83% 144 84005 0.98% 145 103971 1.21% 146 128829 1.50% 147 177086 2.06% 148 272011 3.17% 149 541893 6.31% 150 2269249 26.44% 151 3937196 45.87% 8583951 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=31 prefix-density=0.95 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=274.19 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=16 prefix-density=1.16 prefix-fanout=2.1 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.17 sequence-density-rank=22 fanout-score=21.36 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=9.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170678 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:11:13 Started mapping on | Feb 13 16:11:13 Finished on | Feb 13 16:12:25 Mapping speed, Million of reads per hour | 429.20 Number of input reads | 8583951 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 7666716 Uniquely mapped reads % | 89.31% Average mapped length | 293.88 Number of splices: Total | 7314027 Number of splices: Annotated (sjdb) | 7166038 Number of splices: GT/AG | 7173170 Number of splices: GC/AG | 116826 Number of splices: AT/AC | 3942 Number of splices: Non-canonical | 20089 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245887 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 168671 % of reads mapped to too many loci | 1.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.45% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 686851 686851 686851 N_multimapping 245887 245887 245887 N_noFeature 263357 7513798 306367 N_ambiguous 158521 1225 47628 UnstrandedReadsAssigned:7244838 PositiveStrandReadsAssigned:151693 NegativeStrandReadsAssigned:7312721 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170678 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170678-trimmed-pair1.fastq SRR7170678-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,583,951 reads, 7,389,455 reads pseudoaligned [quant] estimated average fragment length: 272.86 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR7170678.ke.tsv 34699 SRR7170678.se.tsv 87100 total ==> SRR7170678.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.14 202 11.8746 Potri.005G024800.1.v4.1 1035 763.14 62 8.33938 Potri.004G059700.1.v4.1 961 689.231 2 0.297859 Potri.007G009000.2.v4.1 1416 1144.14 0 0 Potri.003G141000.2.v4.1 2943 2671.14 360 13.8341 Potri.016G087400.1.v4.1 270 75.5454 401 544.857 Potri.015G069301.1.v4.1 564 302.736 0 0 Potri.010G195200.1.v4.1 1773 1501.14 18 1.23083 Potri.012G127500.1.v4.1 977 705.183 384 55.8953 ==> SRR7170678.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 114 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 133 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170678 completed mapping pipeline successfully