Starting /dee2/code/volunteer_pipeline.sh SRR7170679 current disk space = 3088932167680 free memory = 1458123572 SRR7170679 SRAfilesize ccb8a604887a664087d8de8ccfae3a0e SRR7170679.sra SRR7170679.sra file validated SRR7170679 is paired end SRR7170679 is conventional basespace SRR7170679 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170679_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.26875 30.0 18.0 33.0 18.0 33.0 2 29.30475 31.0 28.0 33.0 25.0 33.0 3 31.8645 33.0 31.0 33.0 29.0 33.0 4 32.3445 33.0 33.0 33.0 31.0 34.0 5 32.76425 33.0 33.0 34.0 32.0 34.0 6 37.14475 38.0 37.0 38.0 36.0 38.0 7 37.4405 38.0 38.0 38.0 37.0 38.0 8 37.51275 38.0 38.0 38.0 37.0 38.0 9 37.489 38.0 38.0 38.0 37.0 38.0 10-14 37.496399999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.5296 38.0 38.0 38.0 38.0 38.0 20-24 37.524 38.0 38.0 38.0 37.8 38.0 25-29 37.51685 38.0 38.0 38.0 38.0 38.0 30-34 37.53045000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.50275 38.0 38.0 38.0 38.0 38.0 40-44 37.470749999999995 38.0 38.0 38.0 37.8 38.0 45-49 37.416050000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.32875 38.0 38.0 38.0 37.0 38.0 55-59 37.24495 38.0 38.0 38.0 36.6 38.0 60-64 37.208949999999994 38.0 38.0 38.0 36.2 38.0 65-69 37.15745 38.0 38.0 38.0 36.0 38.0 70-74 37.0455 38.0 38.0 38.0 36.0 38.0 75-79 36.9879 38.0 38.0 38.0 36.0 38.0 80-84 36.873450000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.79375 38.0 38.0 38.0 35.0 38.0 90-94 36.674350000000004 38.0 38.0 38.0 34.6 38.0 95-99 36.5392 38.0 38.0 38.0 34.0 38.0 100-104 36.45335 38.0 37.8 38.0 34.0 38.0 105-109 36.35845 38.0 37.6 38.0 33.8 38.0 110-114 35.97065 38.0 37.0 38.0 32.8 38.0 115-119 35.794149999999995 38.0 36.8 38.0 31.8 38.0 120-124 35.7207 38.0 36.4 38.0 31.6 38.0 125-129 35.376250000000006 38.0 36.0 38.0 30.2 38.0 130-134 35.084050000000005 38.0 35.2 38.0 28.2 38.0 135-139 34.90185 38.0 34.6 38.0 28.2 38.0 140-144 34.411199999999994 38.0 34.0 38.0 27.2 38.0 145-149 33.57435 38.0 33.0 38.0 22.4 38.0 150-151 29.3995 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 6.0 18 2.0 19 6.0 20 1.0 21 3.0 22 4.0 23 7.0 24 2.0 25 10.0 26 8.0 27 16.0 28 14.0 29 29.0 30 40.0 31 55.0 32 67.0 33 113.0 34 178.0 35 316.0 36 866.0 37 2249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.164002062919025 18.076328004125838 12.403300670448685 31.356369262506444 2 20.375 23.925 38.45 17.25 3 17.150000000000002 30.875000000000004 29.325000000000003 22.650000000000002 4 20.3 35.625 23.599999999999998 20.474999999999998 5 20.705176294073517 37.88447111777945 23.43085771442861 17.97949487371843 6 16.6 37.225 24.175 22.0 7 12.3 19.650000000000002 46.7 21.349999999999998 8 17.025000000000002 21.025 28.375 33.575 9 18.05 21.525 30.45 29.975 10-14 19.31 30.2 26.39 24.099999999999998 15-19 20.095 28.794999999999998 27.88 23.23 20-24 19.445 29.45 27.49 23.615 25-29 19.75 29.48 27.66 23.11 30-34 19.955000000000002 28.945 28.02 23.080000000000002 35-39 19.67 29.465000000000003 26.974999999999998 23.89 40-44 19.595000000000002 29.49 27.450000000000003 23.465 45-49 20.055 28.93 27.07 23.945 50-54 19.78 28.965000000000003 27.71 23.544999999999998 55-59 19.735 28.665000000000003 27.975 23.625 60-64 19.845 28.715000000000003 27.425 24.015 65-69 19.535 29.310000000000002 27.665 23.49 70-74 20.25 28.804999999999996 27.500000000000004 23.445 75-79 20.585 28.27 27.24 23.905 80-84 20.225 28.48 27.63 23.665 85-89 20.845 28.57 27.0 23.585 90-94 20.31 28.575 27.82 23.294999999999998 95-99 20.57 28.89 27.42 23.119999999999997 100-104 20.235 28.235 27.43 24.099999999999998 105-109 20.724999999999998 27.975 27.525 23.775 110-114 20.669999999999998 28.475 27.235 23.62 115-119 20.765 27.76 27.455000000000002 24.02 120-124 20.8 28.09 27.060000000000002 24.05 125-129 21.060000000000002 28.060000000000002 27.365000000000002 23.515 130-134 20.75 27.944999999999997 27.13 24.175 135-139 21.154999999999998 28.599999999999998 26.400000000000002 23.845 140-144 21.09 27.800000000000004 27.045 24.065 145-149 20.66 28.305000000000003 26.605 24.43 150-151 20.5375 28.025 27.5125 23.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.5 23 2.0 24 2.5 25 4.5 26 8.0 27 8.5 28 11.0 29 18.0 30 31.0 31 44.5 32 42.5 33 49.5 34 67.0 35 92.0 36 114.0 37 130.0 38 150.0 39 172.0 40 185.0 41 191.0 42 211.5 43 220.0 44 253.0 45 269.0 46 243.0 47 243.0 48 233.0 49 209.0 50 161.5 51 118.0 52 110.0 53 100.0 54 84.0 55 61.5 56 38.5 57 32.0 58 26.5 59 17.5 60 15.0 61 10.0 62 4.5 63 2.5 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08998988877654 98.0 2 0.7330637007077857 1.4500000000000002 3 0.15166835187057634 0.44999999999999996 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.7999999999999998 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 3.9625000000000004 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.2375 0.0 0.0 0.0 0.0 138-139 5.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGCA 10 0.0068343505 144.975 7 GCATGAC 10 0.0068343505 144.975 2 >>END_MODULE SRR7170679 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170679_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.624 33.0 33.0 34.0 32.0 34.0 2 32.71675 33.0 33.0 34.0 32.0 34.0 3 32.7995 33.0 33.0 34.0 32.0 34.0 4 32.7555 33.0 33.0 34.0 32.0 34.0 5 32.6885 33.0 33.0 34.0 32.0 34.0 6 36.80775 38.0 38.0 38.0 36.0 38.0 7 36.9015 38.0 38.0 38.0 36.0 38.0 8 36.8825 38.0 38.0 38.0 36.0 38.0 9 36.9185 38.0 38.0 38.0 36.0 38.0 10-14 36.87745 38.0 38.0 38.0 36.0 38.0 15-19 36.85045 38.0 38.0 38.0 36.0 38.0 20-24 36.829449999999994 38.0 38.0 38.0 36.0 38.0 25-29 36.81 38.0 38.0 38.0 36.0 38.0 30-34 36.77725 38.0 38.0 38.0 35.8 38.0 35-39 36.8283 38.0 38.0 38.0 36.0 38.0 40-44 36.77915 38.0 38.0 38.0 36.0 38.0 45-49 36.733399999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.5531 38.0 38.0 38.0 34.8 38.0 55-59 36.53315 38.0 38.0 38.0 34.8 38.0 60-64 36.5851 38.0 38.0 38.0 35.0 38.0 65-69 36.460750000000004 38.0 38.0 38.0 34.2 38.0 70-74 36.47245 38.0 38.0 38.0 34.4 38.0 75-79 36.449 38.0 38.0 38.0 34.4 38.0 80-84 36.28665 38.0 38.0 38.0 34.0 38.0 85-89 36.15335 38.0 38.0 38.0 33.8 38.0 90-94 36.041 38.0 37.8 38.0 33.2 38.0 95-99 35.96015 38.0 37.6 38.0 33.0 38.0 100-104 35.6399 38.0 37.0 38.0 31.0 38.0 105-109 35.65385 38.0 37.0 38.0 31.6 38.0 110-114 35.3585 38.0 36.8 38.0 29.6 38.0 115-119 35.11540000000001 38.0 36.0 38.0 28.2 38.0 120-124 34.957550000000005 38.0 35.8 38.0 28.6 38.0 125-129 34.5218 38.0 35.0 38.0 25.8 38.0 130-134 33.939049999999995 38.0 33.2 38.0 23.2 38.0 135-139 33.441649999999996 38.0 33.0 38.0 20.8 38.0 140-144 32.896 38.0 33.0 38.0 15.2 38.0 145-149 31.829700000000003 38.0 32.4 38.0 10.8 38.0 150-151 26.3595 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 0.0 5 3.0 6 1.0 7 1.0 8 2.0 9 0.0 10 3.0 11 2.0 12 2.0 13 0.0 14 6.0 15 3.0 16 1.0 17 6.0 18 7.0 19 12.0 20 10.0 21 13.0 22 9.0 23 17.0 24 12.0 25 15.0 26 31.0 27 27.0 28 33.0 29 38.0 30 60.0 31 75.0 32 89.0 33 133.0 34 198.0 35 294.0 36 705.0 37 2172.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.300000000000004 15.65 15.425 28.625 2 24.224999999999998 22.85 34.1 18.825 3 20.625 25.624999999999996 31.674999999999997 22.075 4 22.45 35.875 22.1 19.575 5 22.5 37.5 21.525 18.475 6 17.376064096144216 38.38257386079118 23.86079118678017 20.38057085628443 7 17.64264264264264 15.39039039039039 44.394394394394396 22.57257257257257 8 19.61961961961962 22.722722722722725 26.55155155155155 31.106106106106107 9 21.046046046046047 24.0990990990991 28.678678678678676 26.176176176176174 10-14 22.619881870057064 27.500250275302836 27.295024526979677 22.584843327660426 15-19 22.960664598138326 27.404664197778 28.28045240716645 21.354218796917227 20-24 22.913330664531625 27.677141713370695 27.792233787029623 21.617293835068054 25-29 22.685880116081254 27.7944561192835 27.68938256779746 21.830281196837788 30-34 22.452962369895918 28.0724579663731 27.867293835068054 21.60728582866293 35-39 23.693693693693692 27.562562562562565 27.762762762762762 20.98098098098098 40-44 23.157051282051285 27.989783653846157 27.24859775641026 21.604567307692307 45-49 23.23823823823824 27.47747747747748 27.652652652652655 21.63163163163163 50-54 23.2494118824766 27.12848490915461 27.814204915160918 21.807898293207867 55-59 23.120432475723295 27.470217238962856 28.020822905195715 21.38852738011813 60-64 23.52087296025628 27.129842827109822 27.700470517569325 21.648813695064568 65-69 23.10001500975634 27.547906138990342 28.118276879971983 21.233801971281334 70-74 23.439923935345046 27.94875644297653 27.41830555972577 21.19301406195266 75-79 24.29457674604763 27.13127876726036 27.751650990594356 20.822493496097657 80-84 23.72898318654924 26.63130504403523 28.14251401120897 21.497197758206564 85-89 23.741367230507457 27.474727254529075 27.5397858072265 21.244119707736964 90-94 23.800230195666316 27.788620327278185 27.813641595356053 20.597507881699446 95-99 23.398718975180145 28.34767814251401 27.036629303442755 21.21697357886309 100-104 23.33750312734551 27.50562922191644 27.875906930197647 21.280960720540406 105-109 23.388065678814577 28.40408490188226 27.6431718061674 20.564677613135764 110-114 24.375344249161284 27.890441139652495 27.004156026238046 20.730058584948175 115-119 23.897482104420085 28.152375231516242 27.872052860789907 20.078089803273766 120-124 24.220431453025675 27.608989438910857 27.904299514490216 20.266279593573252 125-129 24.03384060873048 27.50800961153384 27.583099719663593 20.875050060072088 130-134 24.524429315178214 27.417901481778134 27.52803364036844 20.52963556267521 135-139 24.374123773282598 27.72381333867414 27.56358902463449 20.338473863408773 140-144 24.45401723101583 27.659787617711885 27.259066319374874 20.627128831897416 145-149 24.29971988795518 27.77611044417767 27.576030412164865 20.34813925570228 150-151 24.978122265283158 27.82847855981998 26.89086135766971 20.302537817227154 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.5 22 2.0 23 2.5 24 2.0 25 2.0 26 3.0 27 5.0 28 7.5 29 8.5 30 15.0 31 26.0 32 34.0 33 33.0 34 40.5 35 52.0 36 68.0 37 93.0 38 114.0 39 141.0 40 163.5 41 195.5 42 226.0 43 239.5 44 262.5 45 278.5 46 276.5 47 276.5 48 245.0 49 203.5 50 184.5 51 163.5 52 143.0 53 117.5 54 93.0 55 72.0 56 53.0 57 45.0 58 34.5 59 25.5 60 18.5 61 9.5 62 6.0 63 4.0 64 2.5 65 0.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.15 7 0.1 8 0.1 9 0.1 10-14 0.11 15-19 0.09 20-24 0.08 25-29 0.06999999999999999 30-34 0.08 35-39 0.1 40-44 0.16 45-49 0.1 50-54 0.105 55-59 0.11 60-64 0.11 65-69 0.065 70-74 0.08499999999999999 75-79 0.06 80-84 0.08 85-89 0.09 90-94 0.08499999999999999 95-99 0.08 100-104 0.075 105-109 0.12 110-114 0.145 115-119 0.11499999999999999 120-124 0.105 125-129 0.12 130-134 0.12 135-139 0.13999999999999999 140-144 0.18 145-149 0.04 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.7575757575757576 1.5 3 0.12626262626262627 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.5875000000000004 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.85 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.3875 0.0 0.0 0.0 0.0 132-133 4.675000000000001 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.4375 0.0 0.0 0.0 0.0 138-139 5.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004273 spots for SRR7170679.sra Written 1004273 spots for SRR7170679.sra Read 1004276 spots for SRR7170679.sra Written 1004276 spots for SRR7170679.sra SRR ids: ['SRR7170679.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_muzetubv SRR7170679.sra spots: 20085463 blocks: [[1, 1004273], [1004274, 2008546], [2008547, 3012819], [3012820, 4017092], [4017093, 5021365], [5021366, 6025638], [6025639, 7029911], [7029912, 8034184], [8034185, 9038457], [9038458, 10042730], [10042731, 11047003], [11047004, 12051276], [12051277, 13055549], [13055550, 14059822], [14059823, 15064095], [15064096, 16068368], [16068369, 17072641], [17072642, 18076914], [18076915, 19081187], [19081188, 20085463]] SRR7170679 file size 6784603 SRR7170679 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170679 SRR7170679_1.fastq SRR7170679_2.fastq Input file: SRR7170679_1.fastq Paired file: SRR7170679_2.fastq trimmed: SRR7170679-trimmed-pair1.fastq, SRR7170679-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:15:32 2025 >> started Thu Feb 13 16:15:54 2025 >> done (21.809s) 20085463 read pairs processed; of these: 27116 ( 0.14%) short read pairs filtered out after trimming by size control 58455 ( 0.29%) empty read pairs filtered out after trimming by size control 19999892 (99.57%) read pairs available; of these: 10489225 (52.45%) trimmed read pairs available after processing 9510667 (47.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 14 0.00% 20 9 0.00% 21 14 0.00% 22 9 0.00% 23 7 0.00% 24 14 0.00% 25 13 0.00% 26 16 0.00% 27 26 0.00% 28 18 0.00% 29 18 0.00% 30 24 0.00% 31 22 0.00% 32 14 0.00% 33 20 0.00% 34 21 0.00% 35 30 0.00% 36 23 0.00% 37 31 0.00% 38 39 0.00% 39 41 0.00% 40 49 0.00% 41 78 0.00% 42 66 0.00% 43 80 0.00% 44 77 0.00% 45 98 0.00% 46 106 0.00% 47 121 0.00% 48 144 0.00% 49 167 0.00% 50 191 0.00% 51 206 0.00% 52 238 0.00% 53 247 0.00% 54 230 0.00% 55 276 0.00% 56 319 0.00% 57 329 0.00% 58 376 0.00% 59 453 0.00% 60 470 0.00% 61 568 0.00% 62 677 0.00% 63 696 0.00% 64 753 0.00% 65 875 0.00% 66 862 0.00% 67 904 0.00% 68 1030 0.01% 69 1180 0.01% 70 1300 0.01% 71 1480 0.01% 72 1801 0.01% 73 2062 0.01% 74 2142 0.01% 75 2563 0.01% 76 2966 0.01% 77 3268 0.02% 78 3055 0.02% 79 3318 0.02% 80 3709 0.02% 81 4112 0.02% 82 4741 0.02% 83 5388 0.03% 84 6951 0.03% 85 7871 0.04% 86 8201 0.04% 87 8504 0.04% 88 8864 0.04% 89 9454 0.05% 90 9745 0.05% 91 10463 0.05% 92 11201 0.06% 93 11902 0.06% 94 13066 0.07% 95 13301 0.07% 96 14080 0.07% 97 14395 0.07% 98 14873 0.07% 99 15362 0.08% 100 16163 0.08% 101 17128 0.09% 102 18174 0.09% 103 19451 0.10% 104 19922 0.10% 105 21044 0.11% 106 22148 0.11% 107 22037 0.11% 108 22775 0.11% 109 23547 0.12% 110 24337 0.12% 111 25230 0.13% 112 26830 0.13% 113 27922 0.14% 114 29394 0.15% 115 30069 0.15% 116 30619 0.15% 117 31580 0.16% 118 32676 0.16% 119 33452 0.17% 120 34480 0.17% 121 35707 0.18% 122 36848 0.18% 123 39471 0.20% 124 40817 0.20% 125 42333 0.21% 126 44671 0.22% 127 46697 0.23% 128 49281 0.25% 129 50308 0.25% 130 52319 0.26% 131 54884 0.27% 132 58575 0.29% 133 62129 0.31% 134 65929 0.33% 135 71116 0.36% 136 76572 0.38% 137 83307 0.42% 138 89186 0.45% 139 98290 0.49% 140 108101 0.54% 141 121867 0.61% 142 138031 0.69% 143 159842 0.80% 144 185334 0.93% 145 227140 1.14% 146 284143 1.42% 147 388838 1.94% 148 597252 2.99% 149 1186248 5.93% 150 5232576 26.16% 151 9510667 47.55% 19999892 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=14 prefix-density=0.85 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=51.25 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=15 prefix-density=0.65 prefix-fanout=2.2 sequence=AATGACATTACTTCCATTGCAAGCAATGG criterion=fanout-score sequence-density=0.26 sequence-density-rank=16 fanout-score=10.87 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=4.1 sequence=AGCAATGGCAGCA SRR7170679 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:16:37 Started mapping on | Feb 13 16:16:37 Finished on | Feb 13 16:19:24 Mapping speed, Million of reads per hour | 431.14 Number of input reads | 19999892 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18328921 Uniquely mapped reads % | 91.65% Average mapped length | 293.79 Number of splices: Total | 17263138 Number of splices: Annotated (sjdb) | 16901844 Number of splices: GT/AG | 16927769 Number of splices: GC/AG | 274351 Number of splices: AT/AC | 11940 Number of splices: Non-canonical | 49078 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 553019 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 23195 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.43% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1140192 1140192 1140192 N_multimapping 553019 553019 553019 N_noFeature 572901 17971442 682959 N_ambiguous 373035 1397 124827 UnstrandedReadsAssigned:17382985 PositiveStrandReadsAssigned:356082 NegativeStrandReadsAssigned:17521135 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170679 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170679-trimmed-pair1.fastq SRR7170679-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,999,892 reads, 17,494,063 reads pseudoaligned [quant] estimated average fragment length: 264.225 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7170679.ke.tsv 34699 SRR7170679.se.tsv 87100 total ==> SRR7170679.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.77 877 24.5808 Potri.005G024800.1.v4.1 1035 771.775 442 28.1676 Potri.004G059700.1.v4.1 961 697.82 7 0.493369 Potri.007G009000.2.v4.1 1416 1152.77 0 0 Potri.003G141000.2.v4.1 2943 2679.77 782.359 14.359 Potri.016G087400.1.v4.1 270 76.2531 1132 730.14 Potri.015G069301.1.v4.1 564 307.813 0 0 Potri.010G195200.1.v4.1 1773 1509.77 84 2.73643 Potri.012G127500.1.v4.1 977 713.78 202 13.9189 ==> SRR7170679.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1020 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 278 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 58 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7170679 completed mapping pipeline successfully