Starting /dee2/code/volunteer_pipeline.sh SRR7170680 current disk space = 3088817078272 free memory = 1439389984 SRR7170680 SRAfilesize 56e8ffd451ddcc113ca0400d87417ae1 SRR7170680.sra SRR7170680.sra file validated SRR7170680 is paired end SRR7170680 is conventional basespace SRR7170680 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170680_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.6225 32.0 25.0 33.0 18.0 33.0 2 30.787 31.0 29.0 33.0 27.0 33.0 3 31.03025 33.0 31.0 33.0 27.0 33.0 4 31.26525 33.0 31.0 33.0 29.0 33.0 5 32.3065 33.0 33.0 33.0 32.0 34.0 6 36.63725 38.0 37.0 38.0 34.0 38.0 7 36.9815 38.0 38.0 38.0 35.0 38.0 8 37.41125 38.0 38.0 38.0 37.0 38.0 9 37.33575 38.0 38.0 38.0 37.0 38.0 10-14 37.4049 38.0 38.0 38.0 37.0 38.0 15-19 37.4153 38.0 38.0 38.0 37.0 38.0 20-24 37.515950000000004 38.0 38.0 38.0 37.4 38.0 25-29 37.48935 38.0 38.0 38.0 37.4 38.0 30-34 37.4759 38.0 38.0 38.0 37.2 38.0 35-39 37.5108 38.0 38.0 38.0 37.4 38.0 40-44 37.422000000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.38100000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.338100000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.2582 38.0 38.0 38.0 36.4 38.0 60-64 37.1872 38.0 38.0 38.0 36.0 38.0 65-69 37.1002 38.0 38.0 38.0 36.0 38.0 70-74 36.989650000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.89875 38.0 38.0 38.0 35.2 38.0 80-84 36.794850000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.73555 38.0 38.0 38.0 34.8 38.0 90-94 36.522000000000006 38.0 37.8 38.0 34.0 38.0 95-99 36.42895 38.0 38.0 38.0 33.8 38.0 100-104 36.29755 38.0 37.4 38.0 34.0 38.0 105-109 36.209500000000006 38.0 37.4 38.0 33.4 38.0 110-114 35.916250000000005 38.0 36.8 38.0 32.2 38.0 115-119 35.764250000000004 38.0 36.4 38.0 31.0 38.0 120-124 35.53945 38.0 36.0 38.0 31.0 38.0 125-129 35.31085 38.0 35.8 38.0 29.6 38.0 130-134 34.93599999999999 38.0 34.8 38.0 28.0 38.0 135-139 34.72685 38.0 34.2 38.0 27.6 38.0 140-144 34.1605 38.0 33.2 38.0 25.4 38.0 145-149 33.16835 38.0 33.0 38.0 20.0 38.0 150-151 28.650875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 4.0 19 6.0 20 3.0 21 4.0 22 3.0 23 6.0 24 8.0 25 6.0 26 13.0 27 17.0 28 22.0 29 28.0 30 38.0 31 48.0 32 86.0 33 128.0 34 220.0 35 375.0 36 920.0 37 2060.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.716181725370085 15.849923430321592 12.046962736089842 38.38693210821848 2 21.05 25.1 34.875 18.975 3 19.25 30.275000000000002 25.174999999999997 25.3 4 22.6 35.35 20.5 21.55 5 19.959979989995 37.99399699849925 22.886443221610804 19.15957978989495 6 17.424999999999997 35.225 25.3 22.05 7 12.975 19.675 45.525 21.825 8 18.875 18.45 27.900000000000002 34.775 9 18.425 21.875 29.7 30.0 10-14 19.919999999999998 29.205 25.745 25.130000000000003 15-19 20.835 27.939999999999998 26.735 24.490000000000002 20-24 20.265 28.28 27.150000000000002 24.305 25-29 21.025 28.105000000000004 26.575 24.295 30-34 20.695 27.779999999999998 26.52 25.005 35-39 21.315 28.065 26.365 24.255 40-44 20.77 28.194999999999997 26.815 24.22 45-49 20.599999999999998 27.725 26.96 24.715 50-54 20.78 28.405 26.155 24.66 55-59 20.395 28.16 27.025 24.42 60-64 21.47 27.255000000000003 26.66 24.615000000000002 65-69 20.93 28.355000000000004 26.290000000000003 24.425 70-74 20.68 28.335 26.455000000000002 24.529999999999998 75-79 21.535 27.275 26.919999999999998 24.27 80-84 21.12 28.13 26.005 24.745 85-89 21.37 27.565 26.43 24.635 90-94 21.175 27.73 26.474999999999998 24.62 95-99 21.385 27.465 26.88 24.27 100-104 21.175 28.055000000000003 26.584999999999997 24.185000000000002 105-109 21.67 27.705000000000002 26.33 24.295 110-114 21.565 27.045 27.22 24.169999999999998 115-119 21.62 27.405 26.3 24.675 120-124 21.18 27.92 26.484999999999996 24.415 125-129 21.89 28.33 25.290000000000003 24.490000000000002 130-134 21.865000000000002 27.485 26.02 24.63 135-139 21.945 27.575 25.97 24.51 140-144 21.55 27.99 25.685000000000002 24.775 145-149 21.34 27.575 26.619999999999997 24.465 150-151 22.3375 27.125 26.424999999999997 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 4.0 26 4.5 27 5.0 28 9.0 29 15.5 30 18.0 31 20.0 32 22.5 33 34.5 34 55.5 35 63.5 36 69.5 37 86.5 38 106.5 39 129.0 40 147.5 41 170.0 42 199.5 43 204.0 44 208.0 45 235.5 46 249.5 47 254.0 48 244.0 49 234.0 50 220.5 51 179.0 52 147.5 53 138.0 54 114.0 55 92.5 56 78.5 57 65.5 58 54.0 59 36.5 60 25.5 61 16.0 62 11.0 63 6.0 64 2.5 65 2.5 66 3.0 67 1.0 68 1.0 69 2.5 70 2.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.07987711213516 95.775 2 1.6897081413210446 3.3000000000000003 3 0.12800819252432155 0.375 4 0.025601638504864313 0.1 5 0.051203277009728626 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025601638504864313 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 8 0.2 TruSeq Adapter, Index 3 (97% over 36bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9249999999999998 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.5875 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGCC 10 0.0068343505 144.975 6 ACTCCAC 10 0.0068343505 144.975 5 >>END_MODULE SRR7170680 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170680_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.638 33.0 33.0 34.0 32.0 34.0 2 32.7835 33.0 33.0 34.0 32.0 34.0 3 32.78075 33.0 33.0 34.0 32.0 34.0 4 32.73725 33.0 33.0 34.0 32.0 34.0 5 32.71075 33.0 33.0 34.0 32.0 34.0 6 36.87275 38.0 38.0 38.0 36.0 38.0 7 36.80025 38.0 38.0 38.0 36.0 38.0 8 36.92025 38.0 38.0 38.0 36.0 38.0 9 36.904 38.0 38.0 38.0 36.0 38.0 10-14 36.911 38.0 38.0 38.0 36.0 38.0 15-19 36.8247 38.0 38.0 38.0 36.0 38.0 20-24 36.79275 38.0 38.0 38.0 36.0 38.0 25-29 36.8523 38.0 38.0 38.0 36.0 38.0 30-34 36.80375 38.0 38.0 38.0 36.0 38.0 35-39 36.82469999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.7956 38.0 38.0 38.0 36.0 38.0 45-49 36.704299999999996 38.0 38.0 38.0 35.4 38.0 50-54 36.565549999999995 38.0 38.0 38.0 35.2 38.0 55-59 36.521 38.0 38.0 38.0 34.8 38.0 60-64 36.53895 38.0 38.0 38.0 34.8 38.0 65-69 36.430150000000005 38.0 38.0 38.0 34.4 38.0 70-74 36.41205 38.0 38.0 38.0 34.4 38.0 75-79 36.372400000000006 38.0 38.0 38.0 34.4 38.0 80-84 36.104 38.0 38.0 38.0 34.0 38.0 85-89 36.06055 38.0 38.0 38.0 33.2 38.0 90-94 35.975350000000006 38.0 37.8 38.0 33.0 38.0 95-99 35.81 38.0 37.4 38.0 32.6 38.0 100-104 35.521 38.0 37.0 38.0 30.8 38.0 105-109 35.42385 38.0 37.0 38.0 31.0 38.0 110-114 35.2538 38.0 36.4 38.0 30.4 38.0 115-119 35.01535 38.0 36.0 38.0 28.4 38.0 120-124 34.87 38.0 35.6 38.0 28.0 38.0 125-129 34.41495 38.0 34.8 38.0 26.0 38.0 130-134 33.85025 38.0 33.0 38.0 23.0 38.0 135-139 33.409800000000004 38.0 33.0 38.0 21.2 38.0 140-144 32.80955 38.0 33.0 38.0 16.4 38.0 145-149 31.82325 38.0 32.2 38.0 10.8 38.0 150-151 26.466124999999998 33.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 7.0 4 2.0 5 4.0 6 0.0 7 1.0 8 4.0 9 4.0 10 0.0 11 2.0 12 2.0 13 3.0 14 6.0 15 3.0 16 8.0 17 7.0 18 6.0 19 10.0 20 8.0 21 5.0 22 14.0 23 13.0 24 17.0 25 16.0 26 21.0 27 26.0 28 40.0 29 41.0 30 65.0 31 70.0 32 84.0 33 121.0 34 190.0 35 313.0 36 722.0 37 2153.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6 15.174999999999999 16.575 31.65 2 23.225 21.9 36.925000000000004 17.95 3 21.075 25.2 31.225 22.5 4 23.875 34.300000000000004 21.0 20.825 5 24.175 36.449999999999996 21.099999999999998 18.275 6 18.193193193193196 36.711711711711715 24.174174174174173 20.92092092092092 7 16.91268451338504 15.861896422316738 43.93294971228421 23.29246935201401 8 19.81981981981982 21.246246246246248 26.876876876876878 32.05705705705706 9 21.31598699024268 22.016512384288216 28.946710032524393 27.72079059294471 10-14 22.520268241417277 27.209488539685715 27.094384946451804 23.1758582724452 15-19 22.805964174922448 26.293405383768636 28.14970479335535 22.75092564795357 20-24 22.843706223734237 26.936161697018214 27.77166299779868 22.44846908144887 25-29 22.982640452248738 27.630196608134472 27.390064535494524 21.997098404122266 30-34 22.54852911747048 27.25135081048629 27.566539923954377 22.633580148088853 35-39 23.444928188960617 27.213131161487265 27.263173697642994 22.078766951909124 40-44 23.60860860860861 26.796796796796794 27.217217217217215 22.37737737737738 45-49 23.015714142728456 27.05935341807627 27.49474527074367 22.430187168451607 50-54 23.170853768391552 26.759083174857373 27.52477229506556 22.545290761685514 55-59 23.741367230507457 26.333700330297265 26.779101191071963 23.14583124812331 60-64 23.66247935538762 25.684400180171163 27.841449376908063 22.811671087533156 65-69 23.948171494321876 26.749712341787983 27.18995447496123 22.11216168892891 70-74 23.875519087406815 26.19702806824436 26.987541902236455 22.939910942112373 75-79 24.25712856428214 26.118059029514757 27.548774387193596 22.076038019009506 80-84 24.061843290303212 26.338436905834083 27.329130391273893 22.270589412588812 85-89 23.798088948921908 27.159937965881237 26.774726099354645 22.267246985842213 90-94 23.491444010807566 26.908836185329733 27.244070849594713 22.355648954267988 95-99 24.12326779728851 25.899244584521487 27.600180099054477 22.377307519135524 100-104 24.325811777655478 26.347125631660578 27.64797118126782 21.67909140941612 105-109 23.9191353082466 26.866493194555645 27.251801441152924 21.962570056044836 110-114 24.268054651919325 27.010660127120765 26.96061258195285 21.760672639007055 115-119 24.258193645233924 27.175381536152116 26.685013760320242 21.881411058293722 120-124 23.94915932746197 26.621297037630104 26.78642914331465 22.643114491593273 125-129 24.374499599679744 26.706365092073657 27.782225780624497 21.136909527622098 130-134 24.116705034531076 27.08938044239816 26.919227304574118 21.874687218496646 135-139 25.178919973975276 26.68034632901256 27.185826535208445 20.954907161803714 140-144 24.42564692927574 26.943290454977724 26.838180089093548 21.792882526652985 145-149 24.511127781945486 26.66166541635409 27.316829207301822 21.510377594398598 150-151 25.05 26.400000000000002 27.900000000000002 20.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 0.5 24 1.0 25 2.5 26 2.5 27 5.5 28 8.0 29 6.0 30 12.0 31 16.5 32 17.5 33 28.5 34 38.5 35 51.5 36 66.5 37 76.0 38 95.5 39 121.5 40 146.5 41 174.5 42 201.5 43 225.5 44 251.0 45 259.0 46 238.5 47 226.0 48 224.5 49 222.0 50 198.0 51 170.5 52 159.5 53 147.5 54 121.5 55 100.0 56 90.5 57 72.5 58 51.0 59 39.5 60 40.5 61 28.0 62 16.0 63 11.5 64 5.5 65 4.0 66 3.0 67 2.0 68 2.5 69 2.0 70 1.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 1.0 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.075 8 0.1 9 0.075 10-14 0.09 15-19 0.06999999999999999 20-24 0.06 25-29 0.055 30-34 0.06 35-39 0.08499999999999999 40-44 0.1 45-49 0.09 50-54 0.09 55-59 0.09 60-64 0.095 65-69 0.055 70-74 0.065 75-79 0.05 80-84 0.06999999999999999 85-89 0.055 90-94 0.06999999999999999 95-99 0.055 100-104 0.065 105-109 0.08 110-114 0.095 115-119 0.075 120-124 0.08 125-129 0.08 130-134 0.09 135-139 0.095 140-144 0.105 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.59627810803825 94.39999999999999 2 1.9384853967433446 3.75 3 0.2843111915223572 0.8250000000000001 4 0.025846471956577927 0.1 5 0.051692943913155855 0.25 6 0.051692943913155855 0.3 7 0.025846471956577927 0.17500000000000002 8 0.025846471956577927 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 33bp) GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 7 0.17500000000000002 No Hit TTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACC 6 0.15 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit CCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGT 5 0.125 No Hit CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.9500000000000002 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGCA 10 0.006830828 145.0 6 GCACTGC 10 0.006830828 145.0 5 TACCCCA 10 0.006830828 145.0 9 CTGCATA 10 0.006830828 145.0 8 GGAGCAC 10 0.006830828 145.0 2 >>END_MODULE Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741956 spots for SRR7170680.sra Written 741956 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra Read 741951 spots for SRR7170680.sra Written 741951 spots for SRR7170680.sra SRR ids: ['SRR7170680.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wpnq1b0v SRR7170680.sra spots: 14839025 blocks: [[1, 741951], [741952, 1483902], [1483903, 2225853], [2225854, 2967804], [2967805, 3709755], [3709756, 4451706], [4451707, 5193657], [5193658, 5935608], [5935609, 6677559], [6677560, 7419510], [7419511, 8161461], [8161462, 8903412], [8903413, 9645363], [9645364, 10387314], [10387315, 11129265], [11129266, 11871216], [11871217, 12613167], [12613168, 13355118], [13355119, 14097069], [14097070, 14839025]] SRR7170680 file size 5006758 SRR7170680 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170680 SRR7170680_1.fastq SRR7170680_2.fastq Input file: SRR7170680_1.fastq Paired file: SRR7170680_2.fastq trimmed: SRR7170680-trimmed-pair1.fastq, SRR7170680-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:02:57 2025 >> started Thu Feb 13 16:03:13 2025 >> done (16.139s) 14839025 read pairs processed; of these: 16798 ( 0.11%) short read pairs filtered out after trimming by size control 53890 ( 0.36%) empty read pairs filtered out after trimming by size control 14768337 (99.52%) read pairs available; of these: 7781652 (52.69%) trimmed read pairs available after processing 6986685 (47.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 8 0.00% 22 9 0.00% 23 6 0.00% 24 12 0.00% 25 4 0.00% 26 5 0.00% 27 9 0.00% 28 6 0.00% 29 10 0.00% 30 4 0.00% 31 12 0.00% 32 8 0.00% 33 7 0.00% 34 9 0.00% 35 18 0.00% 36 11 0.00% 37 17 0.00% 38 14 0.00% 39 19 0.00% 40 22 0.00% 41 16 0.00% 42 27 0.00% 43 19 0.00% 44 33 0.00% 45 37 0.00% 46 57 0.00% 47 74 0.00% 48 62 0.00% 49 73 0.00% 50 76 0.00% 51 100 0.00% 52 88 0.00% 53 102 0.00% 54 113 0.00% 55 89 0.00% 56 135 0.00% 57 123 0.00% 58 171 0.00% 59 169 0.00% 60 170 0.00% 61 197 0.00% 62 225 0.00% 63 275 0.00% 64 275 0.00% 65 313 0.00% 66 348 0.00% 67 334 0.00% 68 413 0.00% 69 421 0.00% 70 523 0.00% 71 608 0.00% 72 760 0.01% 73 757 0.01% 74 941 0.01% 75 1181 0.01% 76 1718 0.01% 77 1912 0.01% 78 1408 0.01% 79 1581 0.01% 80 1565 0.01% 81 1819 0.01% 82 2146 0.01% 83 2563 0.02% 84 3440 0.02% 85 3911 0.03% 86 4256 0.03% 87 4240 0.03% 88 4478 0.03% 89 4875 0.03% 90 5003 0.03% 91 5380 0.04% 92 5875 0.04% 93 6452 0.04% 94 6914 0.05% 95 7188 0.05% 96 7582 0.05% 97 7781 0.05% 98 8100 0.05% 99 8758 0.06% 100 9406 0.06% 101 9716 0.07% 102 10571 0.07% 103 11284 0.08% 104 11648 0.08% 105 12366 0.08% 106 13105 0.09% 107 13100 0.09% 108 13946 0.09% 109 14342 0.10% 110 14729 0.10% 111 15508 0.11% 112 16767 0.11% 113 17579 0.12% 114 18427 0.12% 115 18706 0.13% 116 19580 0.13% 117 20076 0.14% 118 21249 0.14% 119 21591 0.15% 120 22633 0.15% 121 23550 0.16% 122 24505 0.17% 123 26194 0.18% 124 27644 0.19% 125 28789 0.19% 126 29976 0.20% 127 31874 0.22% 128 33598 0.23% 129 34469 0.23% 130 36383 0.25% 131 38008 0.26% 132 40798 0.28% 133 43591 0.30% 134 46663 0.32% 135 50201 0.34% 136 54853 0.37% 137 59737 0.40% 138 64849 0.44% 139 71476 0.48% 140 78729 0.53% 141 89503 0.61% 142 101708 0.69% 143 119787 0.81% 144 139416 0.94% 145 171090 1.16% 146 217965 1.48% 147 299395 2.03% 148 464013 3.14% 149 922225 6.24% 150 3965860 26.85% 151 6986685 47.31% 14768337 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=1.00 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=252.90 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=14 prefix-density=1.16 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=22.62 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.5 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR7170680 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:03:58 Started mapping on | Feb 13 16:03:59 Finished on | Feb 13 16:05:48 Mapping speed, Million of reads per hour | 487.76 Number of input reads | 14768337 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13503936 Uniquely mapped reads % | 91.44% Average mapped length | 295.07 Number of splices: Total | 13118808 Number of splices: Annotated (sjdb) | 12881070 Number of splices: GT/AG | 12852532 Number of splices: GC/AG | 228872 Number of splices: AT/AC | 5666 Number of splices: Non-canonical | 31738 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390764 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 282061 % of reads mapped to too many loci | 1.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 889365 889365 889365 N_multimapping 390764 390764 390764 N_noFeature 479747 13218217 556455 N_ambiguous 285252 1670 74916 UnstrandedReadsAssigned:12738937 PositiveStrandReadsAssigned:284049 NegativeStrandReadsAssigned:12872565 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170680 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170680-trimmed-pair1.fastq SRR7170680-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,768,337 reads, 12,936,053 reads pseudoaligned [quant] estimated average fragment length: 276.413 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7170680.ke.tsv 34699 SRR7170680.se.tsv 87100 total ==> SRR7170680.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.59 280 9.22327 Potri.005G024800.1.v4.1 1035 759.587 86 6.49894 Potri.004G059700.1.v4.1 961 685.626 6 0.502326 Potri.007G009000.2.v4.1 1416 1140.59 0 0 Potri.003G141000.2.v4.1 2943 2667.59 945 20.3346 Potri.016G087400.1.v4.1 270 71.6518 496 397.353 Potri.015G069301.1.v4.1 564 297.104 0 0 Potri.010G195200.1.v4.1 1773 1497.59 4 0.153317 Potri.012G127500.1.v4.1 977 701.609 110 8.99951 ==> SRR7170680.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 218 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170680 completed mapping pipeline successfully