Starting /dee2/code/volunteer_pipeline.sh SRR7170681 current disk space = 3088764395520 free memory = 1492826040 SRR7170681 SRAfilesize 587f01ac2637771a39e7d2bf6d11b59f SRR7170681.sra SRR7170681.sra file validated SRR7170681 is paired end SRR7170681 is conventional basespace SRR7170681 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170681_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.67125 28.0 18.0 33.0 18.0 33.0 2 28.92925 30.0 27.0 31.0 25.0 33.0 3 31.847 33.0 31.0 33.0 29.0 33.0 4 32.015 33.0 31.0 33.0 30.0 33.0 5 32.28575 33.0 33.0 33.0 32.0 34.0 6 37.07725 38.0 37.0 38.0 35.0 38.0 7 37.36925 38.0 38.0 38.0 37.0 38.0 8 37.4965 38.0 38.0 38.0 37.0 38.0 9 37.52925 38.0 38.0 38.0 38.0 38.0 10-14 37.5256 38.0 38.0 38.0 38.0 38.0 15-19 37.5033 38.0 38.0 38.0 38.0 38.0 20-24 37.550799999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.51695 38.0 38.0 38.0 38.0 38.0 30-34 37.5289 38.0 38.0 38.0 38.0 38.0 35-39 37.50235 38.0 38.0 38.0 38.0 38.0 40-44 37.433400000000006 38.0 38.0 38.0 37.6 38.0 45-49 37.420500000000004 38.0 38.0 38.0 37.2 38.0 50-54 37.2947 38.0 38.0 38.0 37.0 38.0 55-59 37.259100000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.25435 38.0 38.0 38.0 37.0 38.0 65-69 37.2016 38.0 38.0 38.0 36.8 38.0 70-74 37.127500000000005 38.0 38.0 38.0 36.2 38.0 75-79 37.00235 38.0 38.0 38.0 36.0 38.0 80-84 36.9697 38.0 38.0 38.0 36.0 38.0 85-89 36.96885 38.0 38.0 38.0 36.0 38.0 90-94 36.793899999999994 38.0 38.0 38.0 35.2 38.0 95-99 36.65215 38.0 38.0 38.0 34.6 38.0 100-104 36.5246 38.0 38.0 38.0 34.2 38.0 105-109 36.453199999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.3121 38.0 38.0 38.0 34.0 38.0 115-119 36.11465 38.0 37.6 38.0 33.6 38.0 120-124 35.97935 38.0 37.0 38.0 33.0 38.0 125-129 35.88405 38.0 37.0 38.0 33.0 38.0 130-134 35.61540000000001 38.0 36.4 38.0 31.6 38.0 135-139 35.347350000000006 38.0 36.0 38.0 30.6 38.0 140-144 34.7265 38.0 34.8 38.0 28.2 38.0 145-149 34.0838 38.0 33.6 38.0 25.0 38.0 150-151 30.2795 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 8.0 20 5.0 21 4.0 22 7.0 23 6.0 24 5.0 25 16.0 26 10.0 27 16.0 28 15.0 29 27.0 30 28.0 31 54.0 32 62.0 33 108.0 34 130.0 35 228.0 36 703.0 37 2559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.85800909550278 15.613946437594745 14.982314300151591 30.545730166750886 2 17.599999999999998 24.45 40.675 17.275 3 16.225 30.0 32.074999999999996 21.7 4 19.525000000000002 35.575 24.349999999999998 20.549999999999997 5 20.336429826763748 35.04895807180517 26.18629173989455 18.428320361536528 6 14.174999999999999 37.05 28.525 20.25 7 12.075 20.525 46.725 20.674999999999997 8 17.05 22.55 28.925 31.474999999999998 9 16.25 24.75 29.825000000000003 29.175 10-14 18.39 31.53 26.895000000000003 23.185 15-19 18.985 30.37 27.68 22.965 20-24 18.87 30.385 27.67 23.075000000000003 25-29 18.95 30.044999999999998 27.735 23.27 30-34 19.08 29.935000000000002 27.515 23.47 35-39 18.509999999999998 29.830000000000002 27.839999999999996 23.82 40-44 18.725 30.28 27.87 23.125 45-49 18.925 30.085 27.544999999999998 23.445 50-54 18.995 29.904999999999998 27.544999999999998 23.555 55-59 19.06 29.725 27.750000000000004 23.465 60-64 18.735 29.945 27.93 23.39 65-69 19.23 29.695 27.33 23.745 70-74 19.384999999999998 29.459999999999997 26.895000000000003 24.26 75-79 19.235 30.145 27.005000000000003 23.615 80-84 19.23 29.34 27.169999999999998 24.26 85-89 19.575 29.854999999999997 26.56 24.01 90-94 19.235 29.57 27.435 23.76 95-99 19.265 29.25 26.915 24.57 100-104 19.52 29.645 27.045 23.79 105-109 20.200000000000003 28.799999999999997 26.479999999999997 24.52 110-114 20.095 28.455000000000002 27.33 24.12 115-119 19.455 29.28 26.75 24.515 120-124 20.385 28.694999999999997 27.005000000000003 23.915 125-129 20.44 28.425 26.96 24.175 130-134 20.580000000000002 28.62 26.76 24.04 135-139 20.275000000000002 28.310000000000002 26.795 24.62 140-144 19.7 28.249999999999996 26.740000000000002 25.31 145-149 20.165 28.08 26.445 25.31 150-151 20.260292829433112 27.46840195219622 27.06795144537605 25.203353772994618 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 2.5 20 3.5 21 2.5 22 3.0 23 4.5 24 5.5 25 12.0 26 19.5 27 22.0 28 28.0 29 41.5 30 51.5 31 55.5 32 72.5 33 97.5 34 119.5 35 122.5 36 126.5 37 143.0 38 160.5 39 175.0 40 183.0 41 196.5 42 226.0 43 224.5 44 198.0 45 199.0 46 185.0 47 177.5 48 172.5 49 136.5 50 112.0 51 105.5 52 103.5 53 99.5 54 92.0 55 80.0 56 56.5 57 50.0 58 46.5 59 33.0 60 20.0 61 13.5 62 10.0 63 1.5 64 0.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.42500000000000004 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.496740547588 93.475 2 1.7209908735332464 3.3000000000000003 3 0.3389830508474576 0.975 4 0.18252933507170796 0.7000000000000001 5 0.07822685788787484 0.375 6 0.1303780964797914 0.75 7 0.0 0.0 8 0.02607561929595828 0.2 9 0.02607561929595828 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCG 9 0.22499999999999998 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 8 0.2 TruSeq Adapter, Index 2 (97% over 37bp) GCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGT 6 0.15 No Hit CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 6 0.15 No Hit CGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGG 6 0.15 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit GTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATC 6 0.15 No Hit GTTTGATTGGCCTTTCACCCCCAGCCACAAGTCATCCGCTAATTTTTCAA 5 0.125 No Hit GATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAG 5 0.125 No Hit GTTCGATTCAGCATCCGAATCCAGAAAGCAAAAACAAAGTAGAATATTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.225 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.0125 0.0 0.0 0.0 0.0 118-119 4.5375 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 5.9875 0.0 0.0 0.0 0.0 126-127 6.575 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.625 0.0 0.0 0.0 0.0 132-133 8.125 0.0 0.0 0.0 0.0 134-135 8.5375 0.0 0.0 0.0 0.0 136-137 9.225 0.0 0.0 0.0 0.0 138-139 9.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTCT 10 0.006830828 145.0 4 CATCCTC 10 0.006830828 145.0 3 GGACAAC 10 0.006830828 145.0 1 CTCAGAC 10 0.006830828 145.0 9 TCATCCT 10 0.006830828 145.0 2 TCCTCTC 20 3.5877043E-4 108.75 5 >>END_MODULE SRR7170681 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170681_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72475 33.0 33.0 34.0 32.0 34.0 2 32.917 33.0 33.0 34.0 32.0 34.0 3 32.90275 34.0 33.0 34.0 32.0 34.0 4 32.73375 34.0 33.0 34.0 32.0 34.0 5 32.75125 34.0 33.0 34.0 32.0 34.0 6 36.9405 38.0 38.0 38.0 36.0 38.0 7 36.87675 38.0 38.0 38.0 36.0 38.0 8 36.8185 38.0 38.0 38.0 36.0 38.0 9 36.893 38.0 38.0 38.0 36.0 38.0 10-14 36.86825 38.0 38.0 38.0 36.0 38.0 15-19 36.8922 38.0 38.0 38.0 36.0 38.0 20-24 36.85695 38.0 38.0 38.0 36.2 38.0 25-29 36.81895000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.798500000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.8438 38.0 38.0 38.0 36.0 38.0 40-44 36.86365 38.0 38.0 38.0 36.6 38.0 45-49 36.74605 38.0 38.0 38.0 36.0 38.0 50-54 36.74055 38.0 38.0 38.0 36.0 38.0 55-59 36.677499999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.66725 38.0 38.0 38.0 36.0 38.0 65-69 36.6492 38.0 38.0 38.0 35.6 38.0 70-74 36.56045 38.0 38.0 38.0 35.6 38.0 75-79 36.466150000000006 38.0 38.0 38.0 35.0 38.0 80-84 36.406850000000006 38.0 38.0 38.0 34.8 38.0 85-89 36.31505 38.0 38.0 38.0 34.6 38.0 90-94 36.18555 38.0 38.0 38.0 34.2 38.0 95-99 36.16465000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.00065 38.0 38.0 38.0 33.8 38.0 105-109 35.86375 38.0 38.0 38.0 33.2 38.0 110-114 35.655100000000004 38.0 37.4 38.0 32.6 38.0 115-119 35.54285 38.0 37.0 38.0 31.6 38.0 120-124 35.45365 38.0 37.0 38.0 31.0 38.0 125-129 34.9868 38.0 36.0 38.0 28.8 38.0 130-134 34.5331 38.0 35.8 38.0 26.4 38.0 135-139 34.21645 38.0 34.8 38.0 25.4 38.0 140-144 33.5526 38.0 33.4 38.0 21.2 38.0 145-149 32.5279 38.0 33.0 38.0 9.6 38.0 150-151 27.279625000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 11.0 4 4.0 5 5.0 6 7.0 7 0.0 8 2.0 9 1.0 10 1.0 11 7.0 12 5.0 13 5.0 14 1.0 15 4.0 16 1.0 17 9.0 18 6.0 19 7.0 20 5.0 21 4.0 22 5.0 23 16.0 24 19.0 25 16.0 26 21.0 27 20.0 28 26.0 29 36.0 30 47.0 31 56.0 32 71.0 33 97.0 34 136.0 35 240.0 36 561.0 37 2539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.525 15.575 14.549999999999999 27.35 2 25.724999999999998 22.6 34.825 16.85 3 22.1 26.1 31.125000000000004 20.674999999999997 4 24.825 34.225 21.4 19.55 5 23.875 36.725 21.2 18.2 6 18.8 37.9 23.95 19.35 7 18.85 16.1 43.65 21.4 8 22.45 21.075 25.75 30.725 9 22.475 24.125 27.975 25.424999999999997 10-14 24.485 28.754999999999995 25.735000000000003 21.025 15-19 24.605 27.87 27.315 20.21 20-24 24.465 27.935 27.325 20.275000000000002 25-29 24.775 27.85 27.279999999999998 20.095 30-34 24.169999999999998 27.975 27.35 20.505000000000003 35-39 24.505 28.299999999999997 27.36 19.835 40-44 24.66 27.125 28.000000000000004 20.215 45-49 24.3 27.58 27.83 20.29 50-54 23.715 27.37 28.355000000000004 20.560000000000002 55-59 24.145 27.615000000000002 28.055000000000003 20.185 60-64 24.375 27.21 28.17 20.244999999999997 65-69 24.12 27.36 28.23 20.29 70-74 24.385 27.595 27.905 20.115 75-79 24.185000000000002 27.79 27.865000000000002 20.16 80-84 24.055 27.87 28.025 20.05 85-89 24.404999999999998 27.76 27.66 20.175 90-94 24.16 28.48 27.55 19.81 95-99 24.21 28.199999999999996 28.075 19.515 100-104 24.915000000000003 27.985 27.605 19.495 105-109 24.66 27.62 28.035 19.685 110-114 24.7 27.944999999999997 28.155 19.2 115-119 24.33 28.355000000000004 28.244999999999997 19.07 120-124 24.85 27.700000000000003 27.860000000000003 19.59 125-129 25.0 28.349999999999998 28.025 18.625 130-134 24.925 28.065 27.529999999999998 19.48 135-139 25.52 27.839999999999996 27.900000000000002 18.740000000000002 140-144 25.629999999999995 28.084999999999997 27.72 18.565 145-149 26.68 27.735 27.46 18.125 150-151 26.710016256096036 27.660372639739904 27.972989871201705 17.65662123296236 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.5 14 1.5 15 0.5 16 1.0 17 1.0 18 1.0 19 1.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 4.5 26 7.5 27 9.5 28 12.0 29 13.0 30 15.5 31 22.0 32 26.0 33 40.0 34 61.0 35 66.5 36 78.5 37 104.5 38 126.5 39 155.0 40 173.5 41 185.5 42 203.5 43 230.5 44 253.0 45 241.5 46 237.0 47 241.0 48 227.5 49 208.0 50 182.5 51 150.5 52 133.5 53 116.5 54 112.0 55 104.0 56 69.0 57 51.0 58 37.5 59 27.0 60 19.5 61 14.0 62 13.5 63 5.5 64 1.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.5 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7979274611399 94.375 2 1.4766839378238341 2.85 3 0.466321243523316 1.35 4 0.15544041450777202 0.6 5 0.025906735751295335 0.125 6 0.0 0.0 7 0.0 0.0 8 0.05181347150259067 0.4 9 0.0 0.0 >10 0.025906735751295335 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 12 0.3 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 8 0.2 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.6500000000000004 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.6625 0.0 0.0 0.0 0.0 116-117 4.025 0.0 0.0 0.0 0.0 118-119 4.5375 0.0 0.0 0.0 0.0 120-121 5.0 0.0 0.0 0.0 0.0 122-123 5.4875 0.0 0.0 0.0 0.0 124-125 6.0375 0.0 0.0 0.0 0.0 126-127 6.612500000000001 0.0 0.0 0.0 0.0 128-129 7.225 0.0 0.0 0.0 0.0 130-131 7.675 0.0 0.0 0.0 0.0 132-133 8.175 0.0 0.0 0.0 0.0 134-135 8.5625 0.0 0.0 0.0 0.0 136-137 9.25 0.0 0.0 0.0 0.0 138-139 9.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCATT 10 0.006830828 145.0 1 CCTCTCT 10 0.006830828 145.0 1 >>END_MODULE Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543082 spots for SRR7170681.sra Written 543082 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra Read 543063 spots for SRR7170681.sra Written 543063 spots for SRR7170681.sra SRR ids: ['SRR7170681.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nledimm6 SRR7170681.sra spots: 10861279 blocks: [[1, 543063], [543064, 1086126], [1086127, 1629189], [1629190, 2172252], [2172253, 2715315], [2715316, 3258378], [3258379, 3801441], [3801442, 4344504], [4344505, 4887567], [4887568, 5430630], [5430631, 5973693], [5973694, 6516756], [6516757, 7059819], [7059820, 7602882], [7602883, 8145945], [8145946, 8689008], [8689009, 9232071], [9232072, 9775134], [9775135, 10318197], [10318198, 10861279]] SRR7170681 file size 3658830 SRR7170681 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170681 SRR7170681_1.fastq SRR7170681_2.fastq Input file: SRR7170681_1.fastq Paired file: SRR7170681_2.fastq trimmed: SRR7170681-trimmed-pair1.fastq, SRR7170681-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:28:12 2025 >> started Thu Feb 13 16:28:24 2025 >> done (12.220s) 10861279 read pairs processed; of these: 14408 ( 0.13%) short read pairs filtered out after trimming by size control 47830 ( 0.44%) empty read pairs filtered out after trimming by size control 10799041 (99.43%) read pairs available; of these: 5502144 (50.95%) trimmed read pairs available after processing 5296897 (49.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 10 0.00% 21 5 0.00% 22 4 0.00% 23 11 0.00% 24 19 0.00% 25 5 0.00% 26 9 0.00% 27 9 0.00% 28 4 0.00% 29 12 0.00% 30 9 0.00% 31 15 0.00% 32 5 0.00% 33 9 0.00% 34 16 0.00% 35 17 0.00% 36 15 0.00% 37 16 0.00% 38 23 0.00% 39 33 0.00% 40 18 0.00% 41 32 0.00% 42 29 0.00% 43 40 0.00% 44 48 0.00% 45 47 0.00% 46 52 0.00% 47 61 0.00% 48 90 0.00% 49 105 0.00% 50 96 0.00% 51 105 0.00% 52 124 0.00% 53 150 0.00% 54 140 0.00% 55 170 0.00% 56 160 0.00% 57 238 0.00% 58 232 0.00% 59 293 0.00% 60 329 0.00% 61 406 0.00% 62 428 0.00% 63 481 0.00% 64 521 0.00% 65 552 0.01% 66 610 0.01% 67 653 0.01% 68 751 0.01% 69 804 0.01% 70 994 0.01% 71 1160 0.01% 72 1353 0.01% 73 1523 0.01% 74 1647 0.02% 75 1954 0.02% 76 2414 0.02% 77 2736 0.03% 78 2593 0.02% 79 3082 0.03% 80 3017 0.03% 81 3422 0.03% 82 3967 0.04% 83 4495 0.04% 84 5864 0.05% 85 6585 0.06% 86 7213 0.07% 87 7287 0.07% 88 7867 0.07% 89 8092 0.07% 90 8568 0.08% 91 9330 0.09% 92 9861 0.09% 93 10719 0.10% 94 10736 0.10% 95 11933 0.11% 96 12513 0.12% 97 12913 0.12% 98 13187 0.12% 99 13834 0.13% 100 14581 0.14% 101 15116 0.14% 102 16374 0.15% 103 17256 0.16% 104 18396 0.17% 105 19498 0.18% 106 19923 0.18% 107 19899 0.18% 108 20195 0.19% 109 21418 0.20% 110 22091 0.20% 111 22267 0.21% 112 23462 0.22% 113 26477 0.25% 114 26166 0.24% 115 26095 0.24% 116 26787 0.25% 117 26333 0.24% 118 27370 0.25% 119 27759 0.26% 120 29244 0.27% 121 28941 0.27% 122 29697 0.27% 123 31533 0.29% 124 32272 0.30% 125 32553 0.30% 126 33976 0.31% 127 33464 0.31% 128 35109 0.33% 129 35369 0.33% 130 37216 0.34% 131 37938 0.35% 132 39193 0.36% 133 40903 0.38% 134 42564 0.39% 135 44350 0.41% 136 46224 0.43% 137 48939 0.45% 138 50363 0.47% 139 53217 0.49% 140 55818 0.52% 141 62130 0.58% 142 66921 0.62% 143 74787 0.69% 144 83509 0.77% 145 98473 0.91% 146 122568 1.13% 147 163462 1.51% 148 249858 2.31% 149 485634 4.50% 150 2639579 24.44% 151 5296897 49.05% 10799041 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=18 prefix-density=0.54 prefix-fanout=2.1 sequence=TACGCTTGTAAGGATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=74.69 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.2 sequence=AAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTG criterion=sequence-density sequence-density=1.34 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=35 prefix-density=1.33 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=20.06 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.8 sequence=AAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGT SRR7170681 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:29:13 Started mapping on | Feb 13 16:29:16 Finished on | Feb 13 16:31:24 Mapping speed, Million of reads per hour | 303.72 Number of input reads | 10799041 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 9221317 Uniquely mapped reads % | 85.39% Average mapped length | 291.54 Number of splices: Total | 7316015 Number of splices: Annotated (sjdb) | 7102780 Number of splices: GT/AG | 7162692 Number of splices: GC/AG | 104918 Number of splices: AT/AC | 7162 Number of splices: Non-canonical | 41243 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.64 Insertion rate per base | 0.03% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346480 % of reads mapped to multiple loci | 3.21% Number of reads mapped to too many loci | 12284 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.16% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1245565 1245565 1245565 N_multimapping 346480 346480 346480 N_noFeature 281657 8954985 330435 N_ambiguous 306377 802 88789 UnstrandedReadsAssigned:8633283 PositiveStrandReadsAssigned:265530 NegativeStrandReadsAssigned:8802093 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170681 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170681-trimmed-pair1.fastq SRR7170681-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,799,041 reads, 8,691,551 reads pseudoaligned [quant] estimated average fragment length: 231.259 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7170681.ke.tsv 34699 SRR7170681.se.tsv 87100 total ==> SRR7170681.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.74 724 30.7038 Potri.005G024800.1.v4.1 1035 804.741 745 70.1873 Potri.004G059700.1.v4.1 961 730.755 2 0.207499 Potri.007G009000.2.v4.1 1416 1185.74 0 0 Potri.003G141000.2.v4.1 2943 2712.74 495 13.8342 Potri.016G087400.1.v4.1 270 84.3705 1259.31 1131.62 Potri.015G069301.1.v4.1 564 336.99 0 0 Potri.010G195200.1.v4.1 1773 1542.74 695 34.1547 Potri.012G127500.1.v4.1 977 746.751 87 8.83287 ==> SRR7170681.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 228 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 326 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 48 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7170681 completed mapping pipeline successfully