Starting /dee2/code/volunteer_pipeline.sh SRR7170682 current disk space = 3088775086080 free memory = 1479687932 SRR7170682 SRAfilesize f6486202dab65f7f93eef532b3f32dba SRR7170682.sra SRR7170682.sra file validated SRR7170682 is paired end SRR7170682 is conventional basespace SRR7170682 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170682_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.98325 32.0 25.0 33.0 18.0 33.0 2 31.08375 33.0 30.0 33.0 27.0 33.0 3 31.169 33.0 31.0 33.0 28.0 33.0 4 31.3295 33.0 31.0 33.0 29.0 33.0 5 32.347 33.0 33.0 33.0 32.0 34.0 6 36.75375 38.0 37.0 38.0 35.0 38.0 7 37.124 38.0 38.0 38.0 36.0 38.0 8 37.3865 38.0 38.0 38.0 37.0 38.0 9 37.4325 38.0 38.0 38.0 37.0 38.0 10-14 37.34845 38.0 38.0 38.0 37.0 38.0 15-19 37.42 38.0 38.0 38.0 37.2 38.0 20-24 37.5225 38.0 38.0 38.0 37.6 38.0 25-29 37.540749999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.487750000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.4533 38.0 38.0 38.0 37.2 38.0 40-44 37.44635 38.0 38.0 38.0 37.0 38.0 45-49 37.39975 38.0 38.0 38.0 37.0 38.0 50-54 37.2912 38.0 38.0 38.0 36.8 38.0 55-59 37.231849999999994 38.0 38.0 38.0 36.6 38.0 60-64 37.2244 38.0 38.0 38.0 36.2 38.0 65-69 37.1256 38.0 38.0 38.0 36.0 38.0 70-74 36.9921 38.0 38.0 38.0 36.0 38.0 75-79 36.9713 38.0 38.0 38.0 35.8 38.0 80-84 36.915049999999994 38.0 38.0 38.0 35.4 38.0 85-89 36.834199999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.6655 38.0 38.0 38.0 34.6 38.0 95-99 36.5462 38.0 38.0 38.0 34.0 38.0 100-104 36.35455 38.0 37.6 38.0 33.8 38.0 105-109 36.24735 38.0 37.2 38.0 33.8 38.0 110-114 35.922549999999994 38.0 36.8 38.0 32.2 38.0 115-119 35.69775 38.0 36.4 38.0 31.0 38.0 120-124 35.6014 38.0 36.0 38.0 31.0 38.0 125-129 35.40485 38.0 36.0 38.0 30.4 38.0 130-134 34.97655 38.0 34.8 38.0 28.0 38.0 135-139 34.7872 38.0 34.6 38.0 27.6 38.0 140-144 34.264799999999994 38.0 33.8 38.0 25.4 38.0 145-149 33.373200000000004 38.0 33.0 38.0 20.6 38.0 150-151 29.16375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 4.0 20 1.0 21 3.0 22 4.0 23 7.0 24 2.0 25 13.0 26 12.0 27 23.0 28 23.0 29 39.0 30 48.0 31 56.0 32 78.0 33 113.0 34 194.0 35 317.0 36 862.0 37 2194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.11885245901639 17.827868852459016 11.834016393442623 36.21926229508197 2 18.95 26.275 37.275000000000006 17.5 3 17.175 32.25 27.224999999999998 23.35 4 20.7 36.3 22.35 20.65 5 20.280070017504375 38.10952738184546 23.080770192548137 18.529632408102024 6 16.150000000000002 36.7 24.375 22.775000000000002 7 12.025 19.525000000000002 46.150000000000006 22.3 8 16.775000000000002 20.5 28.95 33.775 9 18.05 21.625 29.875 30.45 10-14 19.6 29.294999999999998 26.619999999999997 24.485 15-19 19.939999999999998 28.494999999999997 27.095000000000002 24.47 20-24 19.905 28.494999999999997 27.85 23.75 25-29 18.970000000000002 29.065 27.735 24.23 30-34 19.595000000000002 29.154999999999998 27.41 23.84 35-39 20.195 28.139999999999997 28.134999999999998 23.53 40-44 20.035 28.15 28.125 23.69 45-49 20.395 28.470000000000002 27.655 23.48 50-54 20.055 28.655 27.544999999999998 23.745 55-59 19.24 28.24 28.735 23.785 60-64 20.53 28.105000000000004 27.744999999999997 23.62 65-69 20.275000000000002 28.37 27.47 23.885 70-74 20.205000000000002 28.48 27.875 23.44 75-79 19.53 28.7 27.439999999999998 24.33 80-84 20.06 28.27 27.884999999999998 23.785 85-89 20.59 28.64 27.42 23.35 90-94 20.169999999999998 29.12 26.875 23.835 95-99 20.5 28.505000000000003 27.595 23.400000000000002 100-104 20.95 28.28 27.495000000000005 23.275000000000002 105-109 20.87 27.944999999999997 27.439999999999998 23.745 110-114 20.605 27.725 28.000000000000004 23.669999999999998 115-119 20.31 28.715000000000003 27.894999999999996 23.080000000000002 120-124 20.84 27.994999999999997 27.845 23.32 125-129 20.62 28.17 27.675 23.535 130-134 20.945 27.755000000000003 27.325 23.974999999999998 135-139 20.625 28.395 27.62 23.36 140-144 20.875 27.779999999999998 27.675 23.669999999999998 145-149 20.605 28.675 26.97 23.75 150-151 21.5375 28.1375 27.400000000000002 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 4.0 25 5.0 26 9.5 27 13.0 28 13.5 29 16.0 30 24.0 31 32.0 32 43.5 33 49.5 34 49.5 35 64.5 36 101.0 37 125.5 38 139.0 39 164.0 40 197.0 41 210.0 42 210.5 43 248.0 44 271.0 45 255.5 46 249.0 47 253.5 48 241.5 49 202.0 50 164.5 51 136.5 52 114.0 53 100.0 54 72.5 55 52.5 56 42.0 57 30.0 58 27.0 59 22.0 60 12.0 61 7.0 62 7.5 63 7.0 64 2.5 65 2.0 66 2.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.7125 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGAAC 10 0.006577216 146.82278 1 GAAATCC 10 0.006832588 144.9875 3 AGAAATC 10 0.006832588 144.9875 2 AAATCCA 35 0.0033135517 62.1375 4 >>END_MODULE SRR7170682 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170682_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.638 33.0 33.0 34.0 32.0 34.0 2 32.684 33.0 33.0 34.0 32.0 34.0 3 32.69275 33.0 33.0 34.0 32.0 34.0 4 32.6865 33.0 33.0 34.0 32.0 34.0 5 32.7025 34.0 33.0 34.0 32.0 34.0 6 36.6855 38.0 38.0 38.0 35.0 38.0 7 36.64075 38.0 38.0 38.0 35.0 38.0 8 36.70525 38.0 38.0 38.0 36.0 38.0 9 36.778 38.0 38.0 38.0 36.0 38.0 10-14 36.68775 38.0 38.0 38.0 35.6 38.0 15-19 36.711 38.0 38.0 38.0 35.8 38.0 20-24 36.6431 38.0 38.0 38.0 35.2 38.0 25-29 36.668000000000006 38.0 38.0 38.0 36.0 38.0 30-34 36.6501 38.0 38.0 38.0 35.6 38.0 35-39 36.63405 38.0 38.0 38.0 35.8 38.0 40-44 36.58990000000001 38.0 38.0 38.0 35.6 38.0 45-49 36.547450000000005 38.0 38.0 38.0 34.8 38.0 50-54 36.3512 38.0 38.0 38.0 34.2 38.0 55-59 36.3274 38.0 38.0 38.0 34.0 38.0 60-64 36.3374 38.0 38.0 38.0 34.0 38.0 65-69 36.29344999999999 38.0 38.0 38.0 34.0 38.0 70-74 36.258449999999996 38.0 38.0 38.0 33.8 38.0 75-79 36.25225 38.0 38.0 38.0 34.0 38.0 80-84 36.086650000000006 38.0 38.0 38.0 33.6 38.0 85-89 36.01475000000001 38.0 38.0 38.0 33.4 38.0 90-94 35.90125 38.0 37.2 38.0 32.6 38.0 95-99 35.697500000000005 38.0 37.0 38.0 32.2 38.0 100-104 35.49275 38.0 37.0 38.0 30.6 38.0 105-109 35.3315 38.0 36.8 38.0 29.0 38.0 110-114 35.08125 38.0 36.2 38.0 28.4 38.0 115-119 34.849399999999996 38.0 36.0 38.0 27.8 38.0 120-124 34.630700000000004 38.0 35.4 38.0 26.6 38.0 125-129 34.1886 38.0 34.8 38.0 23.8 38.0 130-134 33.69175 38.0 33.0 38.0 21.6 38.0 135-139 33.2108 38.0 33.0 38.0 18.4 38.0 140-144 32.57895 38.0 33.0 38.0 13.6 38.0 145-149 31.471999999999998 38.0 31.4 38.0 8.4 38.0 150-151 26.210875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 19.0 4 2.0 5 0.0 6 0.0 7 2.0 8 1.0 9 0.0 10 3.0 11 2.0 12 5.0 13 4.0 14 4.0 15 3.0 16 11.0 17 4.0 18 5.0 19 6.0 20 12.0 21 9.0 22 12.0 23 13.0 24 14.0 25 22.0 26 31.0 27 42.0 28 44.0 29 54.0 30 59.0 31 84.0 32 77.0 33 114.0 34 188.0 35 303.0 36 743.0 37 2097.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.25 16.5 13.65 32.6 2 22.325 24.349999999999998 36.275 17.05 3 19.75 27.425 31.15 21.675 4 24.775 35.15 20.625 19.45 5 22.35 38.425 21.7 17.525 6 17.13497240341194 39.16206723532363 24.560963371801304 19.14199698946312 7 16.716791979949875 16.641604010025063 44.11027568922306 22.531328320802004 8 20.325814536340854 21.528822055137844 26.44110275689223 31.704260651629074 9 21.37844611528822 24.536340852130326 28.020050125313283 26.065162907268167 10-14 21.97543243920782 28.513411882677364 27.33517172223615 22.175983955878667 15-19 22.341385185927635 27.568407336874813 28.059536934950387 22.03067054224717 20-24 22.09471310448509 28.268604359809572 28.333750939614134 21.302931596091206 25-29 22.588565415643632 28.411083830235007 27.824823370246026 21.17552738387533 30-34 22.201062443620327 28.485516688383285 28.124686779593066 21.188734088403326 35-39 22.561403508771928 27.573934837092732 28.49122807017544 21.3734335839599 40-44 22.677102147300822 27.70921131848284 28.055388320288984 21.558298213927355 45-49 23.087719298245617 28.30075187969925 27.819548872180448 20.791979949874687 50-54 22.651158126942743 27.14830041111 28.953173568635314 21.247367893311942 55-59 22.76646946756242 27.42404492128748 28.25629198836859 21.55319362278151 60-64 22.50463728881536 27.8638391738106 28.4052739760365 21.226249561337546 65-69 23.066132264529056 27.680360721442888 27.500000000000004 21.753507014028056 70-74 23.822409300461015 27.23992784125075 27.475445981158547 21.462216877129688 75-79 23.11623246492986 27.90581162324649 27.605210420841686 21.372745490981966 80-84 22.76622400400902 28.29867201202706 28.14332247557003 20.791781508393886 85-89 23.17177083855446 28.138940403989775 27.6126509949376 21.076637762518168 90-94 23.465143086252695 27.384353230090714 28.2964967674034 20.854006916253194 95-99 23.055722589697332 26.7638805371818 28.597915413910602 21.58248145921026 100-104 23.2361194628182 27.435357787131693 28.086790940068152 21.24173180998196 105-109 22.784239021455786 27.937637858431923 28.469019450571487 20.809103669540807 110-114 22.90830658105939 28.18519261637239 27.80397271268058 21.10252808988764 115-119 23.161008875294588 28.085042370756657 27.82429925287068 20.929649501078075 120-124 23.721676358532186 27.772207740124323 27.757168638459994 20.748947262883497 125-129 23.82146439317954 28.074222668004012 27.7432296890672 20.36108324974925 130-134 23.95326681040967 27.974727974727976 27.35797021511307 20.714034999749288 135-139 23.860159502432662 28.033304910467976 27.85273611877414 20.253799468325223 140-144 24.27238057005219 27.04737053392212 27.82517061421116 20.85507828181453 145-149 23.927301857507636 27.79752666099234 27.972763230360986 20.30240825113904 150-151 25.115697310819264 27.029393370856784 27.04190118824265 20.8130081300813 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 2.0 4 2.0 5 1.0 6 1.0 7 0.5 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 2.5 24 5.5 25 5.0 26 4.5 27 7.0 28 9.0 29 10.5 30 15.5 31 21.5 32 30.5 33 37.5 34 46.0 35 67.5 36 80.0 37 93.0 38 128.0 39 163.5 40 189.5 41 214.5 42 236.0 43 267.0 44 287.5 45 274.0 46 271.0 47 256.5 48 216.0 49 196.5 50 171.5 51 139.5 52 122.5 53 103.5 54 78.5 55 60.0 56 50.5 57 37.0 58 24.5 59 21.5 60 15.5 61 8.0 62 6.5 63 3.0 64 2.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.35000000000000003 7 0.25 8 0.25 9 0.25 10-14 0.27499999999999997 15-19 0.22999999999999998 20-24 0.22499999999999998 25-29 0.215 30-34 0.22999999999999998 35-39 0.25 40-44 0.33999999999999997 45-49 0.25 50-54 0.27 55-59 0.27 60-64 0.265 65-69 0.2 70-74 0.22 75-79 0.2 80-84 0.22499999999999998 85-89 0.245 90-94 0.23500000000000001 95-99 0.22 100-104 0.22 105-109 0.26 110-114 0.32 115-119 0.28500000000000003 120-124 0.26 125-129 0.3 130-134 0.28500000000000003 135-139 0.315 140-144 0.36 145-149 0.135 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5031446540880503 1.0 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.2875 0.0 0.0 0.0 0.0 132-133 2.525 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAGTA 10 0.006830828 145.0 3 >>END_MODULE Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009433 spots for SRR7170682.sra Written 1009433 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra Read 1009423 spots for SRR7170682.sra Written 1009423 spots for SRR7170682.sra SRR ids: ['SRR7170682.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yzum2ixv SRR7170682.sra spots: 20188470 blocks: [[1, 1009423], [1009424, 2018846], [2018847, 3028269], [3028270, 4037692], [4037693, 5047115], [5047116, 6056538], [6056539, 7065961], [7065962, 8075384], [8075385, 9084807], [9084808, 10094230], [10094231, 11103653], [11103654, 12113076], [12113077, 13122499], [13122500, 14131922], [14131923, 15141345], [15141346, 16150768], [16150769, 17160191], [17160192, 18169614], [18169615, 19179037], [19179038, 20188470]] SRR7170682 file size 6819509 SRR7170682 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170682 SRR7170682_1.fastq SRR7170682_2.fastq Input file: SRR7170682_1.fastq Paired file: SRR7170682_2.fastq trimmed: SRR7170682-trimmed-pair1.fastq, SRR7170682-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:31:42 2025 >> started Thu Feb 13 16:32:04 2025 >> done (21.765s) 20188470 read pairs processed; of these: 23737 ( 0.12%) short read pairs filtered out after trimming by size control 22841 ( 0.11%) empty read pairs filtered out after trimming by size control 20141892 (99.77%) read pairs available; of these: 10612991 (52.69%) trimmed read pairs available after processing 9528901 (47.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 9 0.00% 21 9 0.00% 22 11 0.00% 23 6 0.00% 24 6 0.00% 25 12 0.00% 26 11 0.00% 27 16 0.00% 28 13 0.00% 29 14 0.00% 30 8 0.00% 31 11 0.00% 32 16 0.00% 33 17 0.00% 34 12 0.00% 35 12 0.00% 36 10 0.00% 37 20 0.00% 38 27 0.00% 39 24 0.00% 40 21 0.00% 41 31 0.00% 42 33 0.00% 43 44 0.00% 44 33 0.00% 45 48 0.00% 46 58 0.00% 47 64 0.00% 48 67 0.00% 49 81 0.00% 50 80 0.00% 51 84 0.00% 52 103 0.00% 53 109 0.00% 54 106 0.00% 55 134 0.00% 56 154 0.00% 57 159 0.00% 58 161 0.00% 59 194 0.00% 60 211 0.00% 61 284 0.00% 62 266 0.00% 63 299 0.00% 64 348 0.00% 65 387 0.00% 66 419 0.00% 67 455 0.00% 68 518 0.00% 69 608 0.00% 70 687 0.00% 71 711 0.00% 72 898 0.00% 73 963 0.00% 74 1115 0.01% 75 1290 0.01% 76 1457 0.01% 77 1535 0.01% 78 1526 0.01% 79 1819 0.01% 80 2003 0.01% 81 2198 0.01% 82 2673 0.01% 83 2998 0.01% 84 4246 0.02% 85 4831 0.02% 86 5297 0.03% 87 5464 0.03% 88 5555 0.03% 89 6216 0.03% 90 6431 0.03% 91 6771 0.03% 92 7393 0.04% 93 8005 0.04% 94 8498 0.04% 95 8996 0.04% 96 9400 0.05% 97 9851 0.05% 98 10357 0.05% 99 10831 0.05% 100 11341 0.06% 101 12019 0.06% 102 12887 0.06% 103 13678 0.07% 104 14239 0.07% 105 15230 0.08% 106 15861 0.08% 107 16537 0.08% 108 17073 0.08% 109 17622 0.09% 110 18815 0.09% 111 19762 0.10% 112 20762 0.10% 113 21914 0.11% 114 22728 0.11% 115 23676 0.12% 116 24618 0.12% 117 25718 0.13% 118 26207 0.13% 119 27578 0.14% 120 28709 0.14% 121 29750 0.15% 122 31254 0.16% 123 33632 0.17% 124 35302 0.18% 125 36857 0.18% 126 38995 0.19% 127 41370 0.21% 128 44173 0.22% 129 45495 0.23% 130 47576 0.24% 131 50572 0.25% 132 54519 0.27% 133 58069 0.29% 134 62792 0.31% 135 67938 0.34% 136 74056 0.37% 137 81220 0.40% 138 89250 0.44% 139 98459 0.49% 140 110345 0.55% 141 125574 0.62% 142 144104 0.72% 143 168538 0.84% 144 196636 0.98% 145 243376 1.21% 146 306617 1.52% 147 422225 2.10% 148 646306 3.21% 149 1271250 6.31% 150 5403913 26.83% 151 9528901 47.31% 20141892 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=15 prefix-density=0.70 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=42.34 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=12.5 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=10 prefix-density=0.81 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=91.27 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAA SRR7170682 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:32:48 Started mapping on | Feb 13 16:32:48 Finished on | Feb 13 16:35:20 Mapping speed, Million of reads per hour | 477.04 Number of input reads | 20141892 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18837917 Uniquely mapped reads % | 93.53% Average mapped length | 294.94 Number of splices: Total | 18496089 Number of splices: Annotated (sjdb) | 18079919 Number of splices: GT/AG | 18140764 Number of splices: GC/AG | 296293 Number of splices: AT/AC | 11013 Number of splices: Non-canonical | 48019 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 509128 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 29518 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 815807 815807 815807 N_multimapping 509128 509128 509128 N_noFeature 714043 18573121 808657 N_ambiguous 303869 1113 133002 UnstrandedReadsAssigned:17820005 PositiveStrandReadsAssigned:263683 NegativeStrandReadsAssigned:17896258 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170682 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170682-trimmed-pair1.fastq SRR7170682-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,141,892 reads, 17,815,619 reads pseudoaligned [quant] estimated average fragment length: 283.869 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52401 SRR7170682.ke.tsv 34699 SRR7170682.se.tsv 87100 total ==> SRR7170682.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.13 522 16.829 Potri.005G024800.1.v4.1 1035 752.131 252 18.7425 Potri.004G059700.1.v4.1 961 678.229 3 0.247437 Potri.007G009000.2.v4.1 1416 1133.13 0 0 Potri.003G141000.2.v4.1 2943 2660.13 995 20.9238 Potri.016G087400.1.v4.1 270 71.2808 935 733.769 Potri.015G069301.1.v4.1 564 291.74 0 0 Potri.010G195200.1.v4.1 1773 1490.13 30 1.1262 Potri.012G127500.1.v4.1 977 694.192 470 37.8738 ==> SRR7170682.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 951 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 197 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170682 completed mapping pipeline successfully