Starting /dee2/code/volunteer_pipeline.sh SRR7170683 current disk space = 3088948367360 free memory = 1412741748 SRR7170683 SRAfilesize dea506aec480db9c5427645f20e774ea SRR7170683.sra SRR7170683.sra file validated SRR7170683 is paired end SRR7170683 is conventional basespace SRR7170683 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170683_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.29375 18.0 18.0 31.0 18.0 33.0 2 30.2915 31.0 29.0 33.0 27.0 33.0 3 31.18975 33.0 31.0 33.0 27.0 33.0 4 32.17425 33.0 33.0 33.0 31.0 34.0 5 32.8 33.0 33.0 34.0 32.0 34.0 6 37.18375 38.0 38.0 38.0 36.0 38.0 7 37.38375 38.0 38.0 38.0 37.0 38.0 8 37.44775 38.0 38.0 38.0 37.0 38.0 9 37.523 38.0 38.0 38.0 37.0 38.0 10-14 37.407000000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.35 38.0 38.0 38.0 37.0 38.0 20-24 37.446250000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.3935 38.0 38.0 38.0 37.0 38.0 30-34 37.341750000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.34310000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.24415 38.0 38.0 38.0 36.8 38.0 45-49 37.217349999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.0971 38.0 38.0 38.0 36.0 38.0 55-59 36.9807 38.0 38.0 38.0 36.0 38.0 60-64 36.98945 38.0 38.0 38.0 36.0 38.0 65-69 36.8867 38.0 38.0 38.0 35.6 38.0 70-74 36.7627 38.0 38.0 38.0 35.4 38.0 75-79 36.5236 38.0 38.0 38.0 34.0 38.0 80-84 36.53775 38.0 38.0 38.0 34.8 38.0 85-89 36.367599999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.1738 38.0 37.6 38.0 33.4 38.0 95-99 36.0625 38.0 37.4 38.0 33.4 38.0 100-104 35.82745 38.0 37.0 38.0 32.0 38.0 105-109 35.7741 38.0 37.0 38.0 31.4 38.0 110-114 35.64125 38.0 36.8 38.0 31.2 38.0 115-119 35.45985 38.0 36.2 38.0 30.6 38.0 120-124 35.28185 38.0 36.0 38.0 29.8 38.0 125-129 34.84965 38.0 35.4 38.0 27.8 38.0 130-134 34.376599999999996 38.0 35.0 38.0 24.8 38.0 135-139 33.66955 38.0 33.6 38.0 21.0 38.0 140-144 32.94655 38.0 33.0 38.0 16.8 38.0 145-149 32.28404999999999 38.0 32.6 38.0 13.2 38.0 150-151 28.333125000000003 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 1.0 10 1.0 11 3.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 7.0 18 7.0 19 11.0 20 5.0 21 4.0 22 6.0 23 9.0 24 10.0 25 29.0 26 29.0 27 27.0 28 28.0 29 37.0 30 40.0 31 55.0 32 74.0 33 126.0 34 203.0 35 357.0 36 960.0 37 1962.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.3429158110883 17.838809034907595 17.2741273100616 30.544147843942504 2 18.85 25.6 36.7 18.85 3 16.2 30.7 28.9 24.2 4 20.125 37.35 23.400000000000002 19.125 5 21.866399799849887 36.22717037778334 23.317488116087066 18.58894170627971 6 16.375 36.449999999999996 25.0 22.175 7 12.725 19.650000000000002 45.824999999999996 21.8 8 17.599999999999998 22.175 27.925 32.300000000000004 9 18.725 22.1 29.4 29.775000000000002 10-14 18.95 30.0 26.41 24.64 15-19 19.6 28.965000000000003 27.88 23.555 20-24 19.455 29.270000000000003 27.345000000000002 23.93 25-29 20.14 29.175 27.21 23.474999999999998 30-34 19.759999999999998 29.080000000000002 27.084999999999997 24.075 35-39 19.919999999999998 28.78 27.455000000000002 23.845 40-44 20.135 28.799999999999997 27.195000000000004 23.87 45-49 20.23 28.794999999999998 26.8 24.175 50-54 20.330000000000002 28.410000000000004 27.26 24.0 55-59 19.93 29.085 27.384999999999998 23.599999999999998 60-64 20.549999999999997 28.335 27.97 23.145 65-69 19.73 28.645 27.565 24.060000000000002 70-74 20.724999999999998 28.685 27.12 23.47 75-79 19.73 29.225 27.405 23.64 80-84 19.355 28.015 27.77 24.86 85-89 19.68 28.23 27.85 24.240000000000002 90-94 20.36 28.74 27.115000000000002 23.785 95-99 20.055 28.425 27.495000000000005 24.025 100-104 20.45 28.64 27.139999999999997 23.77 105-109 20.419999999999998 27.915 27.675 23.990000000000002 110-114 20.845 27.750000000000004 27.465 23.94 115-119 21.065 28.349999999999998 27.685 22.900000000000002 120-124 21.295 28.51 26.76 23.435 125-129 20.96 28.055000000000003 27.384999999999998 23.599999999999998 130-134 21.060000000000002 28.050000000000004 27.13 23.76 135-139 21.105 28.044999999999998 26.96 23.89 140-144 21.11 27.42 27.47 24.0 145-149 20.75 27.85 27.224999999999998 24.175 150-151 21.15 27.987499999999997 25.85 25.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 1.0 23 4.0 24 5.5 25 5.0 26 9.5 27 13.0 28 11.0 29 14.5 30 27.0 31 39.0 32 44.0 33 52.5 34 69.5 35 82.5 36 105.0 37 119.0 38 139.0 39 156.0 40 173.0 41 211.0 42 220.5 43 224.0 44 236.5 45 240.5 46 241.5 47 238.0 48 225.5 49 212.0 50 182.5 51 143.0 52 123.5 53 93.0 54 72.0 55 70.5 56 56.5 57 41.5 58 30.5 59 21.0 60 11.5 61 8.5 62 5.0 63 3.5 64 3.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67346938775509 96.7 2 1.0459183673469388 2.0500000000000003 3 0.17857142857142858 0.525 4 0.05102040816326531 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05102040816326531 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 3 (97% over 36bp) CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.5250000000000004 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 5.05 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAGA 10 0.006830828 145.0 8 CAACTTG 10 0.006830828 145.0 3 TGCAGAA 10 0.006830828 145.0 5 >>END_MODULE SRR7170683 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170683_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77 33.0 33.0 34.0 32.0 34.0 2 32.87275 33.0 33.0 34.0 32.0 34.0 3 32.84425 34.0 33.0 34.0 32.0 34.0 4 32.82675 34.0 33.0 34.0 32.0 34.0 5 32.8255 34.0 33.0 34.0 32.0 34.0 6 36.868 38.0 38.0 38.0 36.0 38.0 7 36.911 38.0 38.0 38.0 36.0 38.0 8 36.9545 38.0 38.0 38.0 36.0 38.0 9 37.032 38.0 38.0 38.0 36.0 38.0 10-14 36.98395000000001 38.0 38.0 38.0 36.2 38.0 15-19 36.92095 38.0 38.0 38.0 36.2 38.0 20-24 36.86155 38.0 38.0 38.0 36.0 38.0 25-29 36.807249999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.82395 38.0 38.0 38.0 36.2 38.0 35-39 36.80595000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.769999999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.7057 38.0 38.0 38.0 35.8 38.0 50-54 36.6968 38.0 38.0 38.0 36.0 38.0 55-59 36.547549999999994 38.0 38.0 38.0 35.2 38.0 60-64 36.5212 38.0 38.0 38.0 35.0 38.0 65-69 36.503750000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.54365 38.0 38.0 38.0 35.0 38.0 75-79 36.418899999999994 38.0 38.0 38.0 34.6 38.0 80-84 36.18675 38.0 38.0 38.0 34.0 38.0 85-89 36.03995 38.0 38.0 38.0 33.8 38.0 90-94 35.93169999999999 38.0 38.0 38.0 33.4 38.0 95-99 35.75345 38.0 37.8 38.0 32.6 38.0 100-104 35.540499999999994 38.0 37.4 38.0 31.2 38.0 105-109 35.54780000000001 38.0 37.0 38.0 31.0 38.0 110-114 35.4623 38.0 37.0 38.0 31.2 38.0 115-119 35.14555 38.0 36.6 38.0 29.2 38.0 120-124 34.9535 38.0 36.4 38.0 28.4 38.0 125-129 34.443400000000004 38.0 35.6 38.0 25.0 38.0 130-134 34.16505000000001 38.0 34.4 38.0 24.0 38.0 135-139 33.904250000000005 38.0 33.2 38.0 23.6 38.0 140-144 33.31515 38.0 33.0 38.0 19.0 38.0 145-149 32.306650000000005 38.0 33.0 38.0 10.6 38.0 150-151 27.224375000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 7.0 5 4.0 6 4.0 7 2.0 8 3.0 9 0.0 10 3.0 11 3.0 12 3.0 13 4.0 14 3.0 15 4.0 16 5.0 17 12.0 18 9.0 19 8.0 20 11.0 21 12.0 22 12.0 23 10.0 24 18.0 25 6.0 26 19.0 27 34.0 28 32.0 29 32.0 30 50.0 31 63.0 32 88.0 33 102.0 34 131.0 35 272.0 36 645.0 37 2372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.0 15.65 16.25 29.099999999999998 2 25.275 22.625 33.625 18.475 3 21.075 26.424999999999997 30.575000000000003 21.925 4 24.075 34.9 20.599999999999998 20.424999999999997 5 24.75 36.0 21.275 17.974999999999998 6 18.55927963981991 38.19409704852426 23.23661830915458 20.01000500250125 7 17.129282320580145 16.179044761190298 43.785946486621654 22.9057264316079 8 19.35967983991996 23.011505752876438 27.33866933466733 30.29014507253627 9 22.086043021510758 23.36168084042021 28.139069534767387 26.413206603301653 10-14 23.187753264295363 28.31057081394767 26.729701335734653 21.771974586022314 15-19 23.680920230057513 27.446861715428856 27.521880470117527 21.350337584396097 20-24 23.447344734473447 28.05780578057806 27.367736773677372 21.127112711271128 25-29 23.330000000000002 27.839999999999996 27.725 21.105 30-34 23.138098334417045 28.234882208773072 27.38458460461161 21.24243485219827 35-39 23.401700850425215 27.963981990995496 27.463731865932967 21.170585292646322 40-44 23.565317456346627 27.72802321508981 27.91814679541702 20.788512533146545 45-49 23.34700410123037 27.163148944683407 27.808342502750826 21.6815044513354 50-54 23.39 27.36 28.244999999999997 21.005 55-59 23.403191116890913 27.40459160706247 27.224528585004755 21.967688691041865 60-64 23.544708941788357 26.985397079415886 28.155631126225245 21.314262852570515 65-69 23.04 27.334999999999997 28.26 21.365000000000002 70-74 23.525 28.205000000000002 26.729999999999997 21.54 75-79 23.957395739573958 27.437743774377438 27.057705770577055 21.547154715471546 80-84 24.001200060003 27.891394569728483 27.29136456822841 20.816040802040103 85-89 23.661183059152957 27.881394069703486 27.12635631781589 21.331066553327666 90-94 23.685000000000002 27.565 27.435 21.315 95-99 23.549999999999997 27.93 27.395000000000003 21.125 100-104 24.135 27.089999999999996 27.55 21.224999999999998 105-109 23.94 27.68 27.145000000000003 21.235 110-114 24.17741774177418 27.652765276527653 27.75777577757776 20.412041204120413 115-119 23.81357203580537 27.62914437165575 27.909186377956697 20.648097214582187 120-124 24.07 27.400000000000002 27.435 21.095 125-129 24.755 27.495000000000005 27.005000000000003 20.745 130-134 24.445 27.0 27.37 21.185000000000002 135-139 24.21468587434974 27.230892356942775 27.506002400960384 21.048419367747098 140-144 24.771147016157272 27.60242108949027 27.202241008453804 20.424190885898653 145-149 25.009999999999998 28.42 26.384999999999998 20.185 150-151 25.2875 27.425 26.987499999999997 20.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.5 19 1.0 20 2.0 21 2.5 22 2.0 23 1.5 24 1.5 25 5.0 26 7.0 27 7.0 28 6.5 29 8.5 30 14.5 31 17.5 32 24.0 33 33.5 34 46.0 35 58.5 36 72.0 37 84.0 38 103.0 39 138.0 40 169.0 41 195.5 42 221.0 43 252.5 44 273.5 45 273.0 46 266.5 47 245.0 48 230.5 49 229.5 50 186.0 51 145.5 52 131.5 53 97.5 54 94.5 55 92.5 56 71.5 57 55.5 58 33.0 59 25.5 60 24.0 61 13.5 62 7.5 63 8.5 64 5.5 65 2.5 66 1.0 67 2.0 68 1.5 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.025 8 0.05 9 0.05 10-14 0.055 15-19 0.025 20-24 0.01 25-29 0.0 30-34 0.034999999999999996 35-39 0.05 40-44 0.065 45-49 0.03 50-54 0.0 55-59 0.034999999999999996 60-64 0.02 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.04 140-144 0.045 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41025641025641 95.95 2 1.153846153846154 2.25 3 0.28205128205128205 0.8250000000000001 4 0.07692307692307693 0.3 5 0.0 0.0 6 0.02564102564102564 0.15 7 0.0 0.0 8 0.02564102564102564 0.2 9 0.0 0.0 >10 0.02564102564102564 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 13 0.325 Illumina Single End PCR Primer 1 (97% over 34bp) TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 8 0.2 No Hit CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.6375 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGACC 10 0.006830828 145.0 5 >>END_MODULE Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra Read 826325 spots for SRR7170683.sra Written 826325 spots for SRR7170683.sra Read 826312 spots for SRR7170683.sra Written 826312 spots for SRR7170683.sra SRR ids: ['SRR7170683.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tjhu8t7w SRR7170683.sra spots: 16526253 blocks: [[1, 826312], [826313, 1652624], [1652625, 2478936], [2478937, 3305248], [3305249, 4131560], [4131561, 4957872], [4957873, 5784184], [5784185, 6610496], [6610497, 7436808], [7436809, 8263120], [8263121, 9089432], [9089433, 9915744], [9915745, 10742056], [10742057, 11568368], [11568369, 12394680], [12394681, 13220992], [13220993, 14047304], [14047305, 14873616], [14873617, 15699928], [15699929, 16526253]] SRR7170683 file size 5578504 SRR7170683 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170683 SRR7170683_1.fastq SRR7170683_2.fastq Input file: SRR7170683_1.fastq Paired file: SRR7170683_2.fastq trimmed: SRR7170683-trimmed-pair1.fastq, SRR7170683-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:09:51 2025 >> started Thu Feb 13 16:10:20 2025 >> done (28.536s) 16526253 read pairs processed; of these: 24428 ( 0.15%) short read pairs filtered out after trimming by size control 78086 ( 0.47%) empty read pairs filtered out after trimming by size control 16423739 (99.38%) read pairs available; of these: 8430133 (51.33%) trimmed read pairs available after processing 7993606 (48.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 11 0.00% 20 4 0.00% 21 14 0.00% 22 16 0.00% 23 15 0.00% 24 10 0.00% 25 12 0.00% 26 19 0.00% 27 18 0.00% 28 10 0.00% 29 17 0.00% 30 12 0.00% 31 18 0.00% 32 21 0.00% 33 10 0.00% 34 16 0.00% 35 20 0.00% 36 33 0.00% 37 13 0.00% 38 25 0.00% 39 25 0.00% 40 31 0.00% 41 30 0.00% 42 37 0.00% 43 49 0.00% 44 46 0.00% 45 68 0.00% 46 95 0.00% 47 80 0.00% 48 112 0.00% 49 121 0.00% 50 125 0.00% 51 145 0.00% 52 159 0.00% 53 158 0.00% 54 183 0.00% 55 195 0.00% 56 185 0.00% 57 257 0.00% 58 271 0.00% 59 319 0.00% 60 352 0.00% 61 391 0.00% 62 384 0.00% 63 461 0.00% 64 535 0.00% 65 498 0.00% 66 646 0.00% 67 652 0.00% 68 710 0.00% 69 827 0.01% 70 952 0.01% 71 1011 0.01% 72 1220 0.01% 73 1352 0.01% 74 1585 0.01% 75 1912 0.01% 76 2967 0.02% 77 3361 0.02% 78 2381 0.01% 79 2614 0.02% 80 2810 0.02% 81 3113 0.02% 82 3399 0.02% 83 3973 0.02% 84 5246 0.03% 85 6088 0.04% 86 6598 0.04% 87 7326 0.04% 88 7302 0.04% 89 7483 0.05% 90 7909 0.05% 91 8407 0.05% 92 8635 0.05% 93 9600 0.06% 94 10118 0.06% 95 10652 0.06% 96 10969 0.07% 97 11392 0.07% 98 12029 0.07% 99 12763 0.08% 100 13264 0.08% 101 13956 0.08% 102 14780 0.09% 103 15710 0.10% 104 16216 0.10% 105 17212 0.10% 106 18037 0.11% 107 18846 0.11% 108 18974 0.12% 109 19967 0.12% 110 20723 0.13% 111 21424 0.13% 112 22569 0.14% 113 23930 0.15% 114 24362 0.15% 115 24638 0.15% 116 25953 0.16% 117 26803 0.16% 118 27576 0.17% 119 28290 0.17% 120 29357 0.18% 121 30495 0.19% 122 30823 0.19% 123 33437 0.20% 124 34473 0.21% 125 34859 0.21% 126 36792 0.22% 127 38384 0.23% 128 40522 0.25% 129 41617 0.25% 130 42824 0.26% 131 44627 0.27% 132 46803 0.28% 133 49456 0.30% 134 52142 0.32% 135 54995 0.33% 136 59193 0.36% 137 63506 0.39% 138 67873 0.41% 139 74659 0.45% 140 80613 0.49% 141 90732 0.55% 142 101932 0.62% 143 118158 0.72% 144 138910 0.85% 145 168850 1.03% 146 213875 1.30% 147 299001 1.82% 148 461146 2.81% 149 937227 5.71% 150 4315987 26.28% 151 7993606 48.67% 16423739 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=24 prefix-density=0.79 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=23.56 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.3 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=18 prefix-density=0.87 prefix-fanout=2.0 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.31 sequence-density-rank=18 fanout-score=9.99 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=3.8 sequence=AGCAATGGCAGCA SRR7170683 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:11:16 Started mapping on | Feb 13 16:11:17 Finished on | Feb 13 16:14:00 Mapping speed, Million of reads per hour | 362.73 Number of input reads | 16423739 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15237629 Uniquely mapped reads % | 92.78% Average mapped length | 294.06 Number of splices: Total | 15043991 Number of splices: Annotated (sjdb) | 14687383 Number of splices: GT/AG | 14755724 Number of splices: GC/AG | 229690 Number of splices: AT/AC | 11240 Number of splices: Non-canonical | 47337 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.03% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440057 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 24253 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.34% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 766543 766543 766543 N_multimapping 440057 440057 440057 N_noFeature 487299 14869882 569404 N_ambiguous 426052 890 139949 UnstrandedReadsAssigned:14324278 PositiveStrandReadsAssigned:366857 NegativeStrandReadsAssigned:14528276 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170683 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170683-trimmed-pair1.fastq SRR7170683-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,423,739 reads, 14,462,116 reads pseudoaligned [quant] estimated average fragment length: 260.975 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR7170683.ke.tsv 34699 SRR7170683.se.tsv 87100 total ==> SRR7170683.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.02 571 14.8422 Potri.005G024800.1.v4.1 1035 775.025 223 13.1485 Potri.004G059700.1.v4.1 961 701.121 23 1.49907 Potri.007G009000.2.v4.1 1416 1156.02 0 0 Potri.003G141000.2.v4.1 2943 2683.02 414 7.05121 Potri.016G087400.1.v4.1 270 76.8772 1177.49 699.919 Potri.015G069301.1.v4.1 564 311.752 0 0 Potri.010G195200.1.v4.1 1773 1513.02 101 3.05045 Potri.012G127500.1.v4.1 977 717.076 185 11.7895 ==> SRR7170683.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 565 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 416 Potri.001G212900.v4.1 51 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7170683 completed mapping pipeline successfully