Starting /dee2/code/volunteer_pipeline.sh SRR7170684 current disk space = 3088705331200 free memory = 1443071612 SRR7170684 SRAfilesize 01c79aa839313fb3d83e99c713177444 SRR7170684.sra SRR7170684.sra file validated SRR7170684 is paired end SRR7170684 is conventional basespace SRR7170684 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170684_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.9825 32.0 25.0 33.0 18.0 33.0 2 31.10025 33.0 30.0 33.0 27.0 34.0 3 31.543 33.0 31.0 33.0 29.0 33.0 4 30.884 33.0 31.0 33.0 28.0 33.0 5 32.10475 33.0 33.0 33.0 31.0 34.0 6 36.719 38.0 37.0 38.0 34.0 38.0 7 37.05625 38.0 38.0 38.0 36.0 38.0 8 37.4595 38.0 38.0 38.0 37.0 38.0 9 37.45075 38.0 38.0 38.0 37.0 38.0 10-14 37.35175 38.0 38.0 38.0 37.0 38.0 15-19 37.38965 38.0 38.0 38.0 37.0 38.0 20-24 37.512800000000006 38.0 38.0 38.0 37.2 38.0 25-29 37.5361 38.0 38.0 38.0 38.0 38.0 30-34 37.4811 38.0 38.0 38.0 37.6 38.0 35-39 37.47855 38.0 38.0 38.0 37.0 38.0 40-44 37.42065 38.0 38.0 38.0 37.0 38.0 45-49 37.39115 38.0 38.0 38.0 37.0 38.0 50-54 37.2934 38.0 38.0 38.0 36.6 38.0 55-59 37.2769 38.0 38.0 38.0 36.4 38.0 60-64 37.210300000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.166250000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.08655 38.0 38.0 38.0 36.0 38.0 75-79 36.976749999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.8254 38.0 38.0 38.0 35.2 38.0 85-89 36.79425 38.0 38.0 38.0 34.8 38.0 90-94 36.60035 38.0 38.0 38.0 34.0 38.0 95-99 36.4466 38.0 37.8 38.0 34.0 38.0 100-104 36.20615 38.0 37.0 38.0 33.6 38.0 105-109 36.2174 38.0 37.0 38.0 34.0 38.0 110-114 35.8977 38.0 36.8 38.0 32.2 38.0 115-119 35.713350000000005 38.0 36.2 38.0 31.0 38.0 120-124 35.5632 38.0 36.0 38.0 30.6 38.0 125-129 35.346500000000006 38.0 35.8 38.0 30.2 38.0 130-134 35.0242 38.0 35.0 38.0 28.2 38.0 135-139 34.81995 38.0 35.0 38.0 27.8 38.0 140-144 34.17855 38.0 34.4 38.0 24.8 38.0 145-149 33.289100000000005 38.0 33.2 38.0 21.0 38.0 150-151 28.22375 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 3.0 16 2.0 17 2.0 18 1.0 19 2.0 20 4.0 21 3.0 22 2.0 23 8.0 24 8.0 25 4.0 26 11.0 27 22.0 28 24.0 29 25.0 30 35.0 31 61.0 32 93.0 33 100.0 34 207.0 35 383.0 36 923.0 37 2076.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.91617382360504 17.922345075854977 11.31396245821548 36.84751864232451 2 18.075 27.275 37.875 16.775000000000002 3 16.3 31.125000000000004 27.35 25.224999999999998 4 20.674999999999997 37.724999999999994 22.425 19.175 5 19.924812030075188 38.52130325814536 23.659147869674186 17.894736842105264 6 16.125 37.0 24.75 22.125 7 11.225 19.825 47.449999999999996 21.5 8 17.75 20.25 29.125 32.875 9 17.150000000000002 21.125 30.475 31.25 10-14 19.235 29.965000000000003 26.795 24.005000000000003 15-19 19.485 28.625 28.345 23.544999999999998 20-24 19.49 29.095 27.915 23.5 25-29 19.564999999999998 29.325000000000003 27.529999999999998 23.580000000000002 30-34 19.235 28.799999999999997 27.97 23.995 35-39 19.545 28.92 27.99 23.544999999999998 40-44 19.395 29.225 27.665 23.715 45-49 19.72 28.105000000000004 28.065 24.11 50-54 19.314999999999998 28.375 28.625 23.685000000000002 55-59 19.61 27.875 28.660000000000004 23.855 60-64 19.59 28.449999999999996 28.51 23.45 65-69 19.62 28.9 28.205000000000002 23.275000000000002 70-74 19.82 29.544999999999998 27.925 22.71 75-79 19.650000000000002 28.925 27.755000000000003 23.669999999999998 80-84 19.86 27.834999999999997 28.560000000000002 23.745 85-89 19.46 28.525 28.38 23.635 90-94 19.775000000000002 28.84 28.095 23.29 95-99 19.79 28.665000000000003 27.825 23.72 100-104 19.73 28.345 28.065 23.86 105-109 20.075000000000003 28.735 28.025 23.165 110-114 20.515 28.63 28.110000000000003 22.745 115-119 20.335 28.244999999999997 27.82 23.599999999999998 120-124 19.67 29.044999999999998 27.755000000000003 23.53 125-129 19.919999999999998 28.57 28.275 23.235 130-134 20.5 28.565 27.765 23.169999999999998 135-139 20.25 28.470000000000002 27.665 23.615 140-144 20.395 29.01 27.065 23.53 145-149 20.669999999999998 28.89 27.644999999999996 22.795 150-151 20.22752844105513 29.15364420552569 27.278409801225152 23.340417552194022 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.5 21 2.0 22 3.0 23 2.0 24 2.0 25 4.0 26 7.5 27 10.0 28 10.0 29 13.5 30 27.5 31 34.0 32 37.5 33 54.0 34 70.5 35 88.5 36 104.5 37 126.5 38 145.0 39 173.5 40 200.0 41 210.0 42 251.0 43 280.5 44 274.5 45 273.0 46 274.0 47 251.0 48 222.5 49 187.5 50 150.0 51 120.5 52 99.5 53 83.5 54 63.5 55 47.5 56 32.5 57 20.5 58 11.0 59 7.0 60 3.5 61 2.0 62 4.0 63 4.0 64 1.5 65 0.5 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.5375 0.0 0.0 0.0 0.0 128-129 2.6624999999999996 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.025 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGAAT 10 0.0058598793 152.52632 1 GAATTGA 10 0.006589099 146.73418 4 >>END_MODULE SRR7170684 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170684_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.593 33.0 33.0 34.0 32.0 34.0 2 32.76375 33.0 33.0 34.0 32.0 34.0 3 32.87875 34.0 33.0 34.0 32.0 34.0 4 32.74225 33.0 33.0 34.0 32.0 34.0 5 32.76725 34.0 33.0 34.0 32.0 34.0 6 36.9175 38.0 38.0 38.0 36.0 38.0 7 37.05175 38.0 38.0 38.0 37.0 38.0 8 36.94125 38.0 38.0 38.0 36.0 38.0 9 36.953 38.0 38.0 38.0 36.0 38.0 10-14 36.952099999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.923500000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.86220000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.81614999999999 38.0 38.0 38.0 35.4 38.0 30-34 36.76285 38.0 38.0 38.0 35.4 38.0 35-39 36.83865 38.0 38.0 38.0 35.8 38.0 40-44 36.7667 38.0 38.0 38.0 35.6 38.0 45-49 36.72915 38.0 38.0 38.0 35.4 38.0 50-54 36.63175 38.0 38.0 38.0 35.0 38.0 55-59 36.58165 38.0 38.0 38.0 34.6 38.0 60-64 36.5178 38.0 38.0 38.0 34.2 38.0 65-69 36.505449999999996 38.0 38.0 38.0 34.2 38.0 70-74 36.509100000000004 38.0 38.0 38.0 34.2 38.0 75-79 36.4083 38.0 38.0 38.0 34.2 38.0 80-84 36.28699999999999 38.0 38.0 38.0 34.0 38.0 85-89 36.1885 38.0 38.0 38.0 34.0 38.0 90-94 36.100699999999996 38.0 38.0 38.0 33.8 38.0 95-99 35.94855 38.0 37.6 38.0 33.0 38.0 100-104 35.785450000000004 38.0 37.0 38.0 32.2 38.0 105-109 35.675 38.0 37.0 38.0 32.0 38.0 110-114 35.309000000000005 38.0 36.6 38.0 29.6 38.0 115-119 35.011199999999995 38.0 36.0 38.0 28.0 38.0 120-124 35.05085 38.0 36.0 38.0 28.6 38.0 125-129 34.53615 38.0 35.4 38.0 25.8 38.0 130-134 34.142 38.0 34.0 38.0 24.4 38.0 135-139 33.68204999999999 38.0 33.0 38.0 22.0 38.0 140-144 32.98425 38.0 33.0 38.0 17.2 38.0 145-149 31.926250000000003 38.0 32.6 38.0 10.4 38.0 150-151 26.37875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 3.0 6 1.0 7 0.0 8 1.0 9 2.0 10 6.0 11 2.0 12 6.0 13 3.0 14 5.0 15 5.0 16 1.0 17 5.0 18 0.0 19 9.0 20 14.0 21 10.0 22 20.0 23 13.0 24 15.0 25 23.0 26 21.0 27 29.0 28 37.0 29 47.0 30 62.0 31 68.0 32 88.0 33 120.0 34 171.0 35 341.0 36 700.0 37 2164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.0 14.7 14.875 32.425 2 22.05 23.525 37.675 16.75 3 18.8 25.6 34.150000000000006 21.45 4 22.85 34.949999999999996 22.675 19.525000000000002 5 23.1 37.875 21.0 18.025 6 16.566566566566568 38.83883883883884 24.424424424424423 20.17017017017017 7 15.332666333166584 14.607303651825912 48.274137068534266 21.785892946473236 8 20.995995995995994 21.646646646646648 27.45245245245245 29.904904904904907 9 21.085542771385693 23.911955977988995 28.864432216108053 26.138069034517258 10-14 21.954879695863138 28.702916312340555 27.572407583412534 21.769796408383773 15-19 21.95268343920372 28.11984194468064 28.855099284749663 21.07237533136598 20-24 22.233893557422967 28.45138055222089 28.701480592236894 20.61324529811925 25-29 22.514005602240896 28.45138055222089 28.53641456582633 20.498199279711883 30-34 22.33505077284778 27.957580911410133 28.39777900055025 21.309589315191836 35-39 21.69584792396198 28.134067033516757 28.83941970985493 21.33066533266633 40-44 22.727045283962973 28.401300975731797 28.19114335751814 20.68051038278709 45-49 22.810264619078584 27.877544895202846 28.607873543094392 20.70431694262418 50-54 22.498999599839937 27.761104441776713 28.511404561824733 21.228491396558624 55-59 22.42121060530265 27.813906953476735 28.489244622311155 21.275637818909455 60-64 22.939175670268106 28.30132052821128 28.04621848739496 20.713285314125653 65-69 22.75296353723803 27.459610863802332 28.52998549492322 21.257440104036412 70-74 23.014602920584117 28.300660132026405 28.685737147429485 19.998999799959993 75-79 22.97919167667067 28.026210484193676 28.801520608243298 20.193077230892357 80-84 22.960740185046262 27.991997999499873 28.562140535133786 20.48512128032008 85-89 23.1807951987997 27.62690672668167 28.60715178794699 20.585146286571643 90-94 22.50337550632595 28.27924188628294 28.364254638195728 20.853127969195377 95-99 22.906145307265362 28.056402820141006 28.21641082054103 20.821041052052603 100-104 23.14615730786539 28.451422571128553 28.176408820441022 20.226011300565027 105-109 23.37701310393118 27.813344003200964 28.633590077023108 20.176052815844752 110-114 23.205083304147696 28.783709411117226 27.863111022164404 20.14809626257067 115-119 23.21544695112801 28.007603421539695 28.212695713070886 20.564253914261418 120-124 22.91572893223306 28.20205051262816 28.402100525131285 20.4801200300075 125-129 23.622086625987794 28.593578073422027 27.53826147844353 20.24607382214664 130-134 24.121030257564392 27.9869967491873 27.786946736684172 20.10502625656414 135-139 23.696848424212106 27.87393696848424 28.349174587293646 20.080040020010003 140-144 24.07703851925963 27.63881940970485 28.534267133566782 19.749874937468732 145-149 24.381219060953047 27.801390069503473 27.936396819840994 19.880994049702487 150-151 23.7375 27.650000000000002 28.625 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 3.0 22 2.0 23 1.5 24 3.0 25 5.5 26 7.5 27 8.5 28 10.0 29 15.5 30 19.5 31 26.5 32 32.5 33 40.0 34 60.5 35 82.5 36 90.0 37 115.5 38 163.0 39 187.0 40 207.0 41 233.0 42 259.5 43 285.5 44 281.0 45 268.0 46 237.5 47 209.0 48 217.0 49 196.0 50 145.5 51 121.0 52 102.0 53 82.5 54 66.5 55 49.0 56 48.0 57 41.5 58 26.0 59 14.0 60 10.5 61 7.5 62 4.0 63 2.0 64 0.5 65 0.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.05 8 0.1 9 0.05 10-14 0.045 15-19 0.034999999999999996 20-24 0.04 25-29 0.04 30-34 0.045 35-39 0.05 40-44 0.075 45-49 0.045 50-54 0.04 55-59 0.05 60-64 0.04 65-69 0.034999999999999996 70-74 0.02 75-79 0.04 80-84 0.025 85-89 0.025 90-94 0.015 95-99 0.005 100-104 0.005 105-109 0.03 110-114 0.065 115-119 0.045 120-124 0.025 125-129 0.03 130-134 0.025 135-139 0.05 140-144 0.05 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.554016620498615 1.0999999999999999 3 0.0503651473180559 0.15 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.025 0.0 88-89 0.275 0.0 0.0 0.025 0.0 90-91 0.30000000000000004 0.0 0.0 0.025 0.0 92-93 0.38749999999999996 0.0 0.0 0.025 0.0 94-95 0.425 0.0 0.0 0.025 0.0 96-97 0.4625 0.0 0.0 0.025 0.0 98-99 0.525 0.0 0.0 0.025 0.0 100-101 0.6125 0.0 0.0 0.025 0.0 102-103 0.7125 0.0 0.0 0.025 0.0 104-105 0.8125 0.0 0.0 0.025 0.0 106-107 0.975 0.0 0.0 0.025 0.0 108-109 1.0750000000000002 0.0 0.0 0.025 0.0 110-111 1.225 0.0 0.0 0.025 0.0 112-113 1.35 0.0 0.0 0.025 0.0 114-115 1.4625 0.0 0.0 0.025 0.0 116-117 1.525 0.0 0.0 0.025 0.0 118-119 1.75 0.0 0.0 0.025 0.0 120-121 1.875 0.0 0.0 0.025 0.0 122-123 2.0375 0.0 0.0 0.025 0.0 124-125 2.3125 0.0 0.0 0.025 0.0 126-127 2.5375 0.0 0.0 0.025 0.0 128-129 2.65 0.0 0.0 0.025 0.0 130-131 2.8375 0.0 0.0 0.025 0.0 132-133 3.0 0.0 0.0 0.025 0.0 134-135 3.175 0.0 0.0 0.025 0.0 136-137 3.325 0.0 0.0 0.025 0.0 138-139 3.625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917718 spots for SRR7170684.sra Written 917718 spots for SRR7170684.sra Read 917721 spots for SRR7170684.sra Written 917721 spots for SRR7170684.sra SRR ids: ['SRR7170684.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9dwvxyvg SRR7170684.sra spots: 18354363 blocks: [[1, 917718], [917719, 1835436], [1835437, 2753154], [2753155, 3670872], [3670873, 4588590], [4588591, 5506308], [5506309, 6424026], [6424027, 7341744], [7341745, 8259462], [8259463, 9177180], [9177181, 10094898], [10094899, 11012616], [11012617, 11930334], [11930335, 12848052], [12848053, 13765770], [13765771, 14683488], [14683489, 15601206], [15601207, 16518924], [16518925, 17436642], [17436643, 18354363]] SRR7170684 file size 6197990 SRR7170684 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170684 SRR7170684_1.fastq SRR7170684_2.fastq Input file: SRR7170684_1.fastq Paired file: SRR7170684_2.fastq trimmed: SRR7170684-trimmed-pair1.fastq, SRR7170684-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:35:16 2025 >> started Thu Feb 13 16:35:47 2025 >> done (30.913s) 18354363 read pairs processed; of these: 13053 ( 0.07%) short read pairs filtered out after trimming by size control 21846 ( 0.12%) empty read pairs filtered out after trimming by size control 18319464 (99.81%) read pairs available; of these: 9470209 (51.69%) trimmed read pairs available after processing 8849255 (48.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 9 0.00% 21 9 0.00% 22 10 0.00% 23 7 0.00% 24 19 0.00% 25 9 0.00% 26 8 0.00% 27 11 0.00% 28 7 0.00% 29 10 0.00% 30 15 0.00% 31 11 0.00% 32 8 0.00% 33 17 0.00% 34 16 0.00% 35 11 0.00% 36 23 0.00% 37 27 0.00% 38 23 0.00% 39 16 0.00% 40 26 0.00% 41 30 0.00% 42 40 0.00% 43 42 0.00% 44 62 0.00% 45 55 0.00% 46 58 0.00% 47 69 0.00% 48 84 0.00% 49 94 0.00% 50 101 0.00% 51 130 0.00% 52 140 0.00% 53 138 0.00% 54 163 0.00% 55 165 0.00% 56 180 0.00% 57 225 0.00% 58 237 0.00% 59 244 0.00% 60 293 0.00% 61 321 0.00% 62 345 0.00% 63 436 0.00% 64 493 0.00% 65 477 0.00% 66 538 0.00% 67 609 0.00% 68 706 0.00% 69 725 0.00% 70 845 0.00% 71 938 0.01% 72 1124 0.01% 73 1361 0.01% 74 1443 0.01% 75 1553 0.01% 76 1775 0.01% 77 1937 0.01% 78 2007 0.01% 79 2201 0.01% 80 2469 0.01% 81 2859 0.02% 82 3114 0.02% 83 3589 0.02% 84 4517 0.02% 85 5075 0.03% 86 5373 0.03% 87 5636 0.03% 88 6123 0.03% 89 6353 0.03% 90 6856 0.04% 91 7181 0.04% 92 7817 0.04% 93 8377 0.05% 94 8937 0.05% 95 9279 0.05% 96 9768 0.05% 97 10132 0.06% 98 10619 0.06% 99 11395 0.06% 100 11621 0.06% 101 12126 0.07% 102 13085 0.07% 103 13693 0.07% 104 14498 0.08% 105 15197 0.08% 106 15979 0.09% 107 16199 0.09% 108 16392 0.09% 109 17115 0.09% 110 18184 0.10% 111 18668 0.10% 112 19583 0.11% 113 20474 0.11% 114 21582 0.12% 115 22297 0.12% 116 22802 0.12% 117 23500 0.13% 118 24363 0.13% 119 24980 0.14% 120 26148 0.14% 121 27345 0.15% 122 28336 0.15% 123 30112 0.16% 124 31715 0.17% 125 32864 0.18% 126 34787 0.19% 127 35914 0.20% 128 37499 0.20% 129 39760 0.22% 130 41373 0.23% 131 44123 0.24% 132 46852 0.26% 133 49900 0.27% 134 54499 0.30% 135 58391 0.32% 136 63801 0.35% 137 68938 0.38% 138 76312 0.42% 139 85133 0.46% 140 94321 0.51% 141 107884 0.59% 142 124759 0.68% 143 145068 0.79% 144 168070 0.92% 145 211267 1.15% 146 271844 1.48% 147 384038 2.10% 148 575915 3.14% 149 1102786 6.02% 150 4849957 26.47% 151 8849255 48.31% 18319464 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.46 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=472.22 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=18.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=11 prefix-density=0.50 prefix-fanout=2.2 sequence=AATGACATTACTTCCATTGCAAGCAATGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=28.82 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=10.1 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170684 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:36:34 Started mapping on | Feb 13 16:36:34 Finished on | Feb 13 16:38:35 Mapping speed, Million of reads per hour | 545.04 Number of input reads | 18319464 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17254867 Uniquely mapped reads % | 94.19% Average mapped length | 294.59 Number of splices: Total | 17124552 Number of splices: Annotated (sjdb) | 16687185 Number of splices: GT/AG | 16809330 Number of splices: GC/AG | 250499 Number of splices: AT/AC | 10202 Number of splices: Non-canonical | 54521 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486271 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 28391 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 594204 594204 594204 N_multimapping 486271 486271 486271 N_noFeature 774468 16966877 872324 N_ambiguous 329753 1588 138504 UnstrandedReadsAssigned:16150646 PositiveStrandReadsAssigned:286402 NegativeStrandReadsAssigned:16244039 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170684 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170684-trimmed-pair1.fastq SRR7170684-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,319,464 reads, 16,103,750 reads pseudoaligned [quant] estimated average fragment length: 282.169 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7170684.ke.tsv 34699 SRR7170684.se.tsv 87100 total ==> SRR7170684.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.83 1193 40.5624 Potri.005G024800.1.v4.1 1035 753.831 302 23.6578 Potri.004G059700.1.v4.1 961 679.956 3 0.260544 Potri.007G009000.2.v4.1 1416 1134.83 0 0 Potri.003G141000.2.v4.1 2943 2661.83 890.803 19.7625 Potri.016G087400.1.v4.1 270 72.6259 938 762.697 Potri.015G069301.1.v4.1 564 293.746 0 0 Potri.010G195200.1.v4.1 1773 1491.83 93 3.68132 Potri.012G127500.1.v4.1 977 695.888 132 11.2015 ==> SRR7170684.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 725 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 31 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170684 completed mapping pipeline successfully