Starting /dee2/code/volunteer_pipeline.sh SRR7170685 current disk space = 3088648073216 free memory = 1582595980 SRR7170685 SRAfilesize d9e65b9726cad43bd8d7bbf2750cc293 SRR7170685.sra SRR7170685.sra file validated SRR7170685 is paired end SRR7170685 is conventional basespace SRR7170685 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170685_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.55275 32.0 25.0 33.0 18.0 33.0 2 30.1585 31.0 29.0 33.0 25.0 33.0 3 30.7975 31.0 30.0 33.0 27.0 33.0 4 30.01625 31.0 29.0 33.0 25.0 33.0 5 31.91375 33.0 32.0 33.0 31.0 33.0 6 36.3235 38.0 36.0 38.0 33.0 38.0 7 36.95875 38.0 37.0 38.0 35.0 38.0 8 37.402 38.0 38.0 38.0 37.0 38.0 9 37.4645 38.0 38.0 38.0 37.0 38.0 10-14 37.40214999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.47935 38.0 38.0 38.0 37.0 38.0 20-24 37.577600000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.5678 38.0 38.0 38.0 38.0 38.0 30-34 37.536500000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.52335 38.0 38.0 38.0 37.8 38.0 40-44 37.4728 38.0 38.0 38.0 37.0 38.0 45-49 37.44085 38.0 38.0 38.0 37.2 38.0 50-54 37.39975 38.0 38.0 38.0 37.0 38.0 55-59 37.271649999999994 38.0 38.0 38.0 36.8 38.0 60-64 37.207449999999994 38.0 38.0 38.0 36.4 38.0 65-69 37.19155000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.140699999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.91055 38.0 38.0 38.0 35.6 38.0 80-84 36.92375 38.0 38.0 38.0 36.0 38.0 85-89 36.82315 38.0 38.0 38.0 35.0 38.0 90-94 36.6776 38.0 38.0 38.0 34.6 38.0 95-99 36.502100000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.381899999999995 38.0 37.8 38.0 34.0 38.0 105-109 36.32025 38.0 37.6 38.0 34.0 38.0 110-114 36.14645 38.0 37.2 38.0 33.4 38.0 115-119 35.83305 38.0 37.0 38.0 31.4 38.0 120-124 35.634750000000004 38.0 36.2 38.0 31.0 38.0 125-129 35.50410000000001 38.0 36.0 38.0 30.6 38.0 130-134 35.2933 38.0 36.0 38.0 30.2 38.0 135-139 35.1616 38.0 36.0 38.0 29.8 38.0 140-144 34.65535 38.0 34.8 38.0 27.6 38.0 145-149 33.78985 38.0 33.0 38.0 24.0 38.0 150-151 29.12175 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 3.0 18 2.0 19 6.0 20 4.0 21 2.0 22 8.0 23 7.0 24 6.0 25 9.0 26 16.0 27 17.0 28 18.0 29 25.0 30 35.0 31 47.0 32 81.0 33 102.0 34 166.0 35 303.0 36 865.0 37 2276.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.50254323499491 17.293997965412004 12.817904374364192 37.38555442522889 2 18.2 26.325 38.2 17.275 3 17.625 30.2 28.000000000000004 24.175 4 21.099999999999998 36.55 22.225 20.125 5 18.927049385810978 39.759338179994984 23.08849335673101 18.225119077463024 6 15.174999999999999 36.75 26.224999999999998 21.85 7 12.275 21.125 44.725 21.875 8 17.0 22.875 28.425 31.7 9 16.7 23.1 31.2 28.999999999999996 10-14 18.63 30.415 27.13 23.825 15-19 19.56 29.32 27.955000000000002 23.165 20-24 19.439999999999998 30.125 26.875 23.56 25-29 18.815 29.154999999999998 28.335 23.695 30-34 19.435 29.415000000000003 28.095 23.055 35-39 19.78 29.505 27.235 23.48 40-44 19.57 29.720000000000002 27.325 23.385 45-49 19.805 29.615000000000002 27.295 23.285 50-54 19.5 29.475 27.055 23.97 55-59 19.895 28.9 27.534999999999997 23.669999999999998 60-64 19.52 28.955 27.644999999999996 23.880000000000003 65-69 19.97 29.13 27.04 23.86 70-74 19.52 29.165000000000003 27.884999999999998 23.43 75-79 19.29 29.23 27.515 23.965 80-84 19.41 28.910000000000004 27.169999999999998 24.51 85-89 19.37 28.804999999999996 27.485 24.34 90-94 19.869999999999997 28.95 27.13 24.05 95-99 19.215 28.945 27.91 23.93 100-104 19.755 28.415000000000003 27.47 24.36 105-109 20.150000000000002 28.144999999999996 27.744999999999997 23.96 110-114 20.395 28.42 27.205000000000002 23.98 115-119 20.77 27.49 27.37 24.37 120-124 20.115 28.57 27.250000000000004 24.065 125-129 20.575 28.235 27.250000000000004 23.94 130-134 20.525 28.144999999999996 27.250000000000004 24.08 135-139 20.560000000000002 28.095 27.175 24.169999999999998 140-144 20.875 27.96 27.150000000000002 24.015 145-149 20.369999999999997 28.294999999999998 27.025 24.310000000000002 150-151 21.320495185694636 27.61035388270601 26.92259597349006 24.14655495810929 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 2.0 21 2.5 22 2.0 23 1.0 24 4.5 25 5.5 26 7.0 27 13.0 28 16.5 29 27.5 30 40.5 31 41.5 32 49.5 33 75.5 34 89.5 35 102.5 36 126.5 37 142.0 38 163.5 39 182.0 40 183.5 41 194.5 42 212.0 43 210.5 44 228.5 45 235.0 46 205.0 47 209.5 48 204.5 49 183.0 50 159.0 51 137.5 52 114.5 53 88.0 54 84.5 55 76.0 56 52.5 57 33.5 58 28.5 59 24.5 60 14.0 61 7.0 62 5.5 63 2.0 64 1.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15337265965633 95.675 2 1.436265709156194 2.8000000000000003 3 0.23082841754295974 0.675 4 0.12823800974608873 0.5 5 0.0 0.0 6 0.025647601949217745 0.15 7 0.0 0.0 8 0.025647601949217745 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 38bp) CGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 3.0875000000000004 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.237500000000001 0.0 0.0 0.0 0.0 132-133 4.6625 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGTGA 10 0.006830828 145.0 8 AATATAG 10 0.006830828 145.0 5 >>END_MODULE SRR7170685 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170685_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.871 33.0 33.0 34.0 32.0 34.0 2 32.93525 33.0 33.0 34.0 32.0 34.0 3 32.9335 34.0 33.0 34.0 32.0 34.0 4 32.87125 34.0 33.0 34.0 32.0 34.0 5 32.9495 34.0 33.0 34.0 32.0 34.0 6 37.01 38.0 38.0 38.0 36.0 38.0 7 37.07325 38.0 38.0 38.0 37.0 38.0 8 37.09575 38.0 38.0 38.0 36.0 38.0 9 37.0805 38.0 38.0 38.0 37.0 38.0 10-14 37.15105 38.0 38.0 38.0 37.0 38.0 15-19 37.122550000000004 38.0 38.0 38.0 36.8 38.0 20-24 37.1021 38.0 38.0 38.0 36.6 38.0 25-29 37.05715 38.0 38.0 38.0 36.4 38.0 30-34 37.0118 38.0 38.0 38.0 36.0 38.0 35-39 37.07335 38.0 38.0 38.0 37.0 38.0 40-44 37.00325 38.0 38.0 38.0 36.6 38.0 45-49 36.96925 38.0 38.0 38.0 36.2 38.0 50-54 36.944599999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.8395 38.0 38.0 38.0 35.8 38.0 60-64 36.83355 38.0 38.0 38.0 36.0 38.0 65-69 36.890750000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.7778 38.0 38.0 38.0 36.0 38.0 75-79 36.75095 38.0 38.0 38.0 35.6 38.0 80-84 36.5982 38.0 38.0 38.0 35.0 38.0 85-89 36.53845 38.0 38.0 38.0 34.8 38.0 90-94 36.48629999999999 38.0 38.0 38.0 34.8 38.0 95-99 36.391650000000006 38.0 38.0 38.0 34.4 38.0 100-104 36.1773 38.0 38.0 38.0 34.0 38.0 105-109 36.1243 38.0 38.0 38.0 34.0 38.0 110-114 35.96915 38.0 37.4 38.0 33.4 38.0 115-119 35.72025000000001 38.0 37.0 38.0 31.8 38.0 120-124 35.73905 38.0 37.0 38.0 32.4 38.0 125-129 35.31015 38.0 36.2 38.0 31.0 38.0 130-134 34.955650000000006 38.0 36.0 38.0 28.8 38.0 135-139 34.5362 38.0 35.0 38.0 27.2 38.0 140-144 34.098949999999995 38.0 33.4 38.0 25.0 38.0 145-149 33.088049999999996 38.0 33.0 38.0 18.6 38.0 150-151 28.05275 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 1.0 5 1.0 6 2.0 7 1.0 8 3.0 9 4.0 10 3.0 11 4.0 12 2.0 13 1.0 14 0.0 15 3.0 16 5.0 17 3.0 18 4.0 19 4.0 20 8.0 21 8.0 22 7.0 23 12.0 24 19.0 25 10.0 26 12.0 27 21.0 28 30.0 29 38.0 30 35.0 31 49.0 32 72.0 33 93.0 34 156.0 35 271.0 36 584.0 37 2527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.225 16.950000000000003 15.725 30.099999999999998 2 24.349999999999998 23.25 35.775 16.625 3 20.25 25.55 32.75 21.45 4 24.175 35.275 19.650000000000002 20.9 5 24.375 37.625 20.925 17.075000000000003 6 18.7 37.35 24.375 19.575 7 19.925 16.400000000000002 41.5 22.175 8 21.5 22.5 26.224999999999998 29.775000000000002 9 22.775000000000002 23.525 28.025 25.674999999999997 10-14 23.53 28.575 26.07 21.825 15-19 23.669999999999998 27.365000000000002 28.04 20.925 20-24 23.794999999999998 27.67 27.584999999999997 20.95 25-29 23.265 28.29 27.665 20.78 30-34 23.400000000000002 27.810000000000002 28.665000000000003 20.125 35-39 23.72 28.050000000000004 27.644999999999996 20.585 40-44 23.880000000000003 28.175 27.145000000000003 20.8 45-49 23.925 28.23 27.455000000000002 20.39 50-54 23.515 27.6 27.689999999999998 21.195 55-59 24.455 27.37 27.27 20.905 60-64 23.835 27.73 27.965 20.47 65-69 24.295 27.384999999999998 27.900000000000002 20.419999999999998 70-74 24.97 27.33 27.305 20.395 75-79 23.585 27.884999999999998 28.075 20.455000000000002 80-84 23.925 27.52 27.650000000000002 20.905 85-89 24.224999999999998 27.595 27.605 20.575 90-94 23.794999999999998 27.49 28.360000000000003 20.355 95-99 23.580000000000002 27.845 27.82 20.755000000000003 100-104 24.755 27.57 28.134999999999998 19.54 105-109 24.665 28.04 27.339999999999996 19.955000000000002 110-114 23.86 28.02 27.915 20.205000000000002 115-119 23.905 27.779999999999998 27.98 20.335 120-124 23.89 27.46 28.17 20.48 125-129 24.805 27.889999999999997 27.205000000000002 20.1 130-134 24.759999999999998 27.13 28.060000000000002 20.05 135-139 24.709999999999997 27.82 27.495000000000005 19.975 140-144 24.865000000000002 27.77 27.189999999999998 20.175 145-149 25.580000000000002 27.875 27.089999999999996 19.455 150-151 26.1125 26.700000000000003 27.437499999999996 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.5 24 2.5 25 2.5 26 2.5 27 5.0 28 8.0 29 14.0 30 18.0 31 21.5 32 30.5 33 33.5 34 38.5 35 50.5 36 79.5 37 102.0 38 109.0 39 146.0 40 180.5 41 197.0 42 224.5 43 252.5 44 270.0 45 279.0 46 271.5 47 249.0 48 229.0 49 208.5 50 181.5 51 143.5 52 127.5 53 111.5 54 93.5 55 92.5 56 65.5 57 47.0 58 38.0 59 25.0 60 15.0 61 7.0 62 6.5 63 4.0 64 2.0 65 1.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.28469022017408 95.975 2 1.4336917562724014 2.8000000000000003 3 0.15360983102918588 0.44999999999999996 4 0.051203277009728626 0.2 5 0.025601638504864313 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.051203277009728626 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 9 0.22499999999999998 Illumina Single End PCR Primer 1 (96% over 33bp) CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 9 0.22499999999999998 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.262499999999999 0.0 0.0 0.0 0.0 132-133 4.675000000000001 0.0 0.0 0.0 0.0 134-135 5.012499999999999 0.0 0.0 0.0 0.0 136-137 5.525 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGCC 10 0.006830828 145.0 6 GAAAGAG 10 0.006830828 145.0 145 >>END_MODULE Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770081 spots for SRR7170685.sra Written 770081 spots for SRR7170685.sra Read 770083 spots for SRR7170685.sra Written 770083 spots for SRR7170685.sra SRR ids: ['SRR7170685.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nqzb3s1u SRR7170685.sra spots: 15401622 blocks: [[1, 770081], [770082, 1540162], [1540163, 2310243], [2310244, 3080324], [3080325, 3850405], [3850406, 4620486], [4620487, 5390567], [5390568, 6160648], [6160649, 6930729], [6930730, 7700810], [7700811, 8470891], [8470892, 9240972], [9240973, 10011053], [10011054, 10781134], [10781135, 11551215], [11551216, 12321296], [12321297, 13091377], [13091378, 13861458], [13861459, 14631539], [14631540, 15401622]] SRR7170685 file size 5197403 SRR7170685 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170685 SRR7170685_1.fastq SRR7170685_2.fastq Input file: SRR7170685_1.fastq Paired file: SRR7170685_2.fastq trimmed: SRR7170685-trimmed-pair1.fastq, SRR7170685-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:14:33 2025 >> started Thu Feb 13 17:14:50 2025 >> done (17.168s) 15401622 read pairs processed; of these: 10179 ( 0.07%) short read pairs filtered out after trimming by size control 43039 ( 0.28%) empty read pairs filtered out after trimming by size control 15348404 (99.65%) read pairs available; of these: 7647413 (49.83%) trimmed read pairs available after processing 7700991 (50.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 10 0.00% 21 3 0.00% 22 4 0.00% 23 12 0.00% 24 16 0.00% 25 3 0.00% 26 7 0.00% 27 11 0.00% 28 9 0.00% 29 13 0.00% 30 12 0.00% 31 7 0.00% 32 16 0.00% 33 17 0.00% 34 12 0.00% 35 16 0.00% 36 25 0.00% 37 27 0.00% 38 31 0.00% 39 25 0.00% 40 25 0.00% 41 38 0.00% 42 34 0.00% 43 57 0.00% 44 61 0.00% 45 55 0.00% 46 65 0.00% 47 74 0.00% 48 111 0.00% 49 120 0.00% 50 144 0.00% 51 144 0.00% 52 181 0.00% 53 162 0.00% 54 199 0.00% 55 196 0.00% 56 213 0.00% 57 217 0.00% 58 253 0.00% 59 348 0.00% 60 366 0.00% 61 419 0.00% 62 456 0.00% 63 483 0.00% 64 561 0.00% 65 607 0.00% 66 618 0.00% 67 709 0.00% 68 792 0.01% 69 885 0.01% 70 995 0.01% 71 1237 0.01% 72 1422 0.01% 73 1634 0.01% 74 1805 0.01% 75 2181 0.01% 76 3127 0.02% 77 3222 0.02% 78 2607 0.02% 79 2860 0.02% 80 3167 0.02% 81 3506 0.02% 82 3995 0.03% 83 4537 0.03% 84 5581 0.04% 85 6127 0.04% 86 6569 0.04% 87 6871 0.04% 88 7113 0.05% 89 7767 0.05% 90 8084 0.05% 91 8634 0.06% 92 9519 0.06% 93 10265 0.07% 94 10958 0.07% 95 11831 0.08% 96 12029 0.08% 97 12415 0.08% 98 13040 0.08% 99 13519 0.09% 100 14283 0.09% 101 14890 0.10% 102 16114 0.10% 103 17318 0.11% 104 18314 0.12% 105 18931 0.12% 106 19763 0.13% 107 19932 0.13% 108 19833 0.13% 109 21206 0.14% 110 21558 0.14% 111 22468 0.15% 112 23880 0.16% 113 25768 0.17% 114 26241 0.17% 115 26594 0.17% 116 27509 0.18% 117 28007 0.18% 118 28416 0.19% 119 28530 0.19% 120 29600 0.19% 121 30260 0.20% 122 31476 0.21% 123 33442 0.22% 124 34523 0.22% 125 35517 0.23% 126 37168 0.24% 127 37898 0.25% 128 39215 0.26% 129 39584 0.26% 130 41676 0.27% 131 42587 0.28% 132 44403 0.29% 133 47071 0.31% 134 50099 0.33% 135 53280 0.35% 136 56377 0.37% 137 60370 0.39% 138 64185 0.42% 139 67652 0.44% 140 74025 0.48% 141 81432 0.53% 142 89874 0.59% 143 105074 0.68% 144 120958 0.79% 145 146192 0.95% 146 185041 1.21% 147 252027 1.64% 148 392198 2.56% 149 793546 5.17% 150 3895614 25.38% 151 7700991 50.17% 15348404 reads passed initial QC criterion=sequence-density sequence-density=1.73 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=37 prefix-density=1.63 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=22.72 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.6 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=30 prefix-density=1.07 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=44.99 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=AACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7170685 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:15:34 Started mapping on | Feb 13 17:15:35 Finished on | Feb 13 17:17:39 Mapping speed, Million of reads per hour | 445.60 Number of input reads | 15348404 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14136929 Uniquely mapped reads % | 92.11% Average mapped length | 293.64 Number of splices: Total | 13265572 Number of splices: Annotated (sjdb) | 12951477 Number of splices: GT/AG | 13003672 Number of splices: GC/AG | 201171 Number of splices: AT/AC | 12263 Number of splices: Non-canonical | 48466 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.03% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376599 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 24205 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.22% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 845952 845952 845952 N_multimapping 376599 376599 376599 N_noFeature 450867 13704075 528954 N_ambiguous 474227 1031 119116 UnstrandedReadsAssigned:13211835 PositiveStrandReadsAssigned:431823 NegativeStrandReadsAssigned:13488859 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170685 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170685-trimmed-pair1.fastq SRR7170685-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,348,404 reads, 13,300,702 reads pseudoaligned [quant] estimated average fragment length: 251.566 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR7170685.ke.tsv 34699 SRR7170685.se.tsv 87100 total ==> SRR7170685.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.43 679 18.2244 Potri.005G024800.1.v4.1 1035 784.434 571 34.5307 Potri.004G059700.1.v4.1 961 710.484 17 1.13506 Potri.007G009000.2.v4.1 1416 1165.43 0 0 Potri.003G141000.2.v4.1 2943 2692.43 534.382 9.41527 Potri.016G087400.1.v4.1 270 78.9969 922 553.665 Potri.015G069301.1.v4.1 564 318.755 0 0 Potri.010G195200.1.v4.1 1773 1522.43 161 5.01665 Potri.012G127500.1.v4.1 977 726.444 182 11.8849 ==> SRR7170685.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 515 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 520 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR7170685 completed mapping pipeline successfully