Starting /dee2/code/volunteer_pipeline.sh SRR7170686 current disk space = 3088677539840 free memory = 1581734616 SRR7170686 SRAfilesize b423d0223b447226a24e4ac6f66bbcd8 SRR7170686.sra SRR7170686.sra file validated SRR7170686 is paired end SRR7170686 is conventional basespace SRR7170686 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170686_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.08775 31.0 18.0 33.0 18.0 33.0 2 30.24275 31.0 29.0 33.0 25.0 33.0 3 30.49475 31.0 29.0 33.0 27.0 33.0 4 30.2935 31.0 29.0 33.0 27.0 33.0 5 32.0465 33.0 32.0 33.0 31.0 33.0 6 36.52825 38.0 37.0 38.0 34.0 38.0 7 37.03325 38.0 38.0 38.0 35.0 38.0 8 37.4505 38.0 38.0 38.0 37.0 38.0 9 37.50025 38.0 38.0 38.0 37.0 38.0 10-14 37.36575 38.0 38.0 38.0 37.0 38.0 15-19 37.41715 38.0 38.0 38.0 37.0 38.0 20-24 37.48875 38.0 38.0 38.0 37.2 38.0 25-29 37.49395 38.0 38.0 38.0 37.8 38.0 30-34 37.41925 38.0 38.0 38.0 37.4 38.0 35-39 37.4038 38.0 38.0 38.0 37.2 38.0 40-44 37.328799999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.348200000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.24285 38.0 38.0 38.0 36.6 38.0 55-59 37.16610000000001 38.0 38.0 38.0 36.2 38.0 60-64 37.14575 38.0 38.0 38.0 36.0 38.0 65-69 37.06235 38.0 38.0 38.0 36.0 38.0 70-74 36.96405 38.0 38.0 38.0 35.8 38.0 75-79 36.81315 38.0 38.0 38.0 35.0 38.0 80-84 36.845 38.0 38.0 38.0 35.0 38.0 85-89 36.66235 38.0 38.0 38.0 34.6 38.0 90-94 36.52460000000001 38.0 38.0 38.0 34.2 38.0 95-99 36.305600000000005 38.0 37.8 38.0 34.0 38.0 100-104 36.16175 38.0 37.2 38.0 33.4 38.0 105-109 36.1582 38.0 37.2 38.0 33.4 38.0 110-114 35.98655 38.0 37.0 38.0 32.6 38.0 115-119 35.722500000000004 38.0 36.8 38.0 31.0 38.0 120-124 35.5883 38.0 36.0 38.0 31.0 38.0 125-129 35.36465 38.0 35.8 38.0 30.6 38.0 130-134 34.967349999999996 38.0 35.0 38.0 28.2 38.0 135-139 34.268 38.0 34.2 38.0 24.0 38.0 140-144 33.6809 38.0 33.4 38.0 22.2 38.0 145-149 33.112950000000005 38.0 33.4 38.0 18.8 38.0 150-151 29.104374999999997 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 8.0 20 4.0 21 5.0 22 4.0 23 4.0 24 11.0 25 16.0 26 17.0 27 22.0 28 20.0 29 38.0 30 46.0 31 55.0 32 65.0 33 131.0 34 212.0 35 364.0 36 894.0 37 2076.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.64991023339318 16.132341626057965 11.541420877147987 37.67632726340087 2 19.1 25.224999999999998 37.525 18.15 3 19.075 29.325000000000003 26.35 25.25 4 22.575 35.625 21.2 20.599999999999998 5 22.266700025018764 36.202151613710285 22.692019014260694 18.839129347010257 6 17.575 34.625 24.425 23.375 7 13.925 19.775000000000002 43.65 22.650000000000002 8 18.7 19.950000000000003 27.725 33.625 9 18.925 22.05 29.5 29.525000000000002 10-14 20.380000000000003 28.605000000000004 25.415 25.6 15-19 20.64 27.205000000000002 26.665 25.490000000000002 20-24 21.355 27.275 26.93 24.44 25-29 21.195 27.72 27.015 24.07 30-34 20.875 27.395000000000003 27.089999999999996 24.64 35-39 21.490000000000002 27.99 26.895000000000003 23.625 40-44 21.21 28.105000000000004 26.595000000000002 24.09 45-49 21.185000000000002 27.950000000000003 26.35 24.515 50-54 21.475 27.87 26.395000000000003 24.26 55-59 20.674999999999997 27.93 26.6 24.795 60-64 20.625 27.894999999999996 26.69 24.79 65-69 21.02 28.01 27.025 23.945 70-74 21.345 27.58 26.41 24.665 75-79 20.8 27.625 26.43 25.145 80-84 21.255 27.229999999999997 26.75 24.765 85-89 21.495 27.235 26.715 24.555 90-94 21.125 27.405 27.134999999999998 24.335 95-99 21.8 27.57 26.174999999999997 24.455 100-104 21.02 27.439999999999998 26.735 24.805 105-109 21.915000000000003 27.07 26.655 24.36 110-114 21.805 27.605 26.150000000000002 24.44 115-119 21.3 27.834999999999997 26.265 24.6 120-124 21.605 28.000000000000004 26.27 24.125 125-129 21.97 27.125 26.25 24.654999999999998 130-134 21.645 27.894999999999996 26.43 24.03 135-139 22.16 27.165 26.265 24.41 140-144 21.605 27.055 26.640000000000004 24.7 145-149 21.415 27.405 26.565 24.615000000000002 150-151 22.5625 26.474999999999998 26.224999999999998 24.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.5 23 3.5 24 3.5 25 2.0 26 3.5 27 7.5 28 8.5 29 13.0 30 21.0 31 30.0 32 30.5 33 34.5 34 56.0 35 78.5 36 87.0 37 89.5 38 100.0 39 116.0 40 136.5 41 158.5 42 186.5 43 191.0 44 201.0 45 225.0 46 234.0 47 249.5 48 245.5 49 220.5 50 194.5 51 173.0 52 150.5 53 129.5 54 118.5 55 109.0 56 84.5 57 65.5 58 59.5 59 48.0 60 36.5 61 25.0 62 17.0 63 11.5 64 8.0 65 6.0 66 5.5 67 3.0 68 1.5 69 2.5 70 1.5 71 1.0 72 1.0 73 2.5 74 2.0 75 0.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31374552887073 96.2 2 1.3285641287685233 2.6 3 0.2810424118548799 0.8250000000000001 4 0.0510986203372509 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02554931016862545 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.7000000000000002 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 2.9625000000000004 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170686 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170686_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58 33.0 33.0 34.0 32.0 34.0 2 32.67925 33.0 33.0 34.0 32.0 34.0 3 32.70475 33.0 33.0 34.0 32.0 34.0 4 32.605 34.0 33.0 34.0 32.0 34.0 5 32.63 33.0 33.0 34.0 32.0 34.0 6 36.76175 38.0 38.0 38.0 35.0 38.0 7 36.7515 38.0 38.0 38.0 36.0 38.0 8 36.8155 38.0 38.0 38.0 36.0 38.0 9 36.78475 38.0 38.0 38.0 36.0 38.0 10-14 36.7057 38.0 38.0 38.0 35.4 38.0 15-19 36.67195 38.0 38.0 38.0 35.4 38.0 20-24 36.648649999999996 38.0 38.0 38.0 35.4 38.0 25-29 36.573550000000004 38.0 38.0 38.0 34.8 38.0 30-34 36.54015 38.0 38.0 38.0 34.8 38.0 35-39 36.57135000000001 38.0 38.0 38.0 35.0 38.0 40-44 36.5635 38.0 38.0 38.0 34.8 38.0 45-49 36.4813 38.0 38.0 38.0 34.8 38.0 50-54 36.47865 38.0 38.0 38.0 34.2 38.0 55-59 36.3277 38.0 38.0 38.0 34.0 38.0 60-64 36.3091 38.0 38.0 38.0 34.0 38.0 65-69 36.3568 38.0 38.0 38.0 34.0 38.0 70-74 36.3037 38.0 38.0 38.0 34.0 38.0 75-79 36.25575 38.0 38.0 38.0 33.8 38.0 80-84 35.98565000000001 38.0 38.0 38.0 33.0 38.0 85-89 35.78775 38.0 37.6 38.0 32.8 38.0 90-94 35.6745 38.0 37.2 38.0 31.6 38.0 95-99 35.43595 38.0 37.0 38.0 30.2 38.0 100-104 35.298700000000004 38.0 36.8 38.0 29.4 38.0 105-109 35.20865 38.0 36.6 38.0 28.6 38.0 110-114 35.09285 38.0 36.0 38.0 28.6 38.0 115-119 34.88155 38.0 35.8 38.0 27.4 38.0 120-124 34.61565 38.0 35.6 38.0 26.4 38.0 125-129 33.939350000000005 38.0 34.2 38.0 21.2 38.0 130-134 33.4852 38.0 33.0 38.0 21.4 38.0 135-139 33.325750000000006 38.0 33.0 38.0 18.6 38.0 140-144 32.64325 38.0 33.0 38.0 14.8 38.0 145-149 31.58515 38.0 32.2 38.0 8.4 38.0 150-151 26.26425 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 3.0 5 3.0 6 1.0 7 6.0 8 0.0 9 1.0 10 5.0 11 2.0 12 9.0 13 9.0 14 2.0 15 3.0 16 8.0 17 6.0 18 8.0 19 11.0 20 13.0 21 11.0 22 13.0 23 18.0 24 12.0 25 21.0 26 22.0 27 34.0 28 47.0 29 41.0 30 55.0 31 63.0 32 123.0 33 145.0 34 196.0 35 306.0 36 716.0 37 2070.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 15.15 14.424999999999999 31.674999999999997 2 24.125 22.775000000000002 35.675000000000004 17.424999999999997 3 20.8 25.45 30.375000000000004 23.375 4 25.624999999999996 35.15 20.625 18.6 5 23.5 37.85 20.95 17.7 6 20.985492746373186 35.217608804402204 22.911455727863935 20.885442721360683 7 16.433216608304154 16.208104052026012 44.097048524262135 23.261630815407706 8 21.1855927963982 22.11105552776388 25.76288144072036 30.940470235117555 9 22.61696272204153 22.316737553164874 29.797348011008257 25.268951713785338 10-14 23.390203632361033 27.677990693951067 26.06194026116976 22.869865412518138 15-19 23.836918459229615 26.898449224612307 27.113556778389196 22.151075537768886 20-24 23.188115840544192 27.01445505927074 27.259540839293756 22.53788826089131 25-29 23.840728327747488 26.972137461857837 27.26727027162223 21.919863938772448 30-34 23.39669834917459 27.63381690845423 26.728364182091045 22.24112056028014 35-39 23.350177615450043 26.867463851503476 27.312753289638263 22.469605243408218 40-44 23.905319521593356 27.428314066956915 27.158084371715958 21.50828203973377 45-49 23.78689344672336 27.22361180590295 27.11855927963982 21.87093546773387 50-54 23.97339068674036 26.194167958785574 27.3795828539989 22.452858500475166 55-59 24.155870141563703 26.837076684508027 26.717022660197088 22.29003051373118 60-64 23.401700850425215 26.708354177088545 27.113556778389196 22.77638819409705 65-69 23.895973993498373 26.27656914228557 26.971742935733932 22.85571392848212 70-74 24.173626043906584 26.974046106916038 26.068910336550484 22.783417512626894 75-79 23.96479295859172 26.840368073614723 26.865373074614922 22.329465893178636 80-84 24.624924984996998 26.635327065413083 27.000400080016 21.739347869573912 85-89 24.45244524452445 26.662666266626662 26.817681768176815 22.06720672067207 90-94 24.035 27.334999999999997 26.875 21.755 95-99 24.285 26.619999999999997 27.105 21.990000000000002 100-104 23.919999999999998 26.740000000000002 27.215 22.125 105-109 24.266066516629156 26.726681670417605 27.03675918979745 21.97049262315579 110-114 24.936221299584812 26.712020409184134 26.481916862588168 21.86984142864289 115-119 24.904961984793918 27.225890356142457 26.57062825130052 21.298519407763106 120-124 24.188628294244136 26.79401910286543 26.87903185477822 22.138320748112218 125-129 25.045 26.06 27.12 21.775 130-134 24.85497099419884 26.36527305461092 27.275455091018202 21.504300860172034 135-139 25.26263131565783 26.35817908954477 26.853426713356676 21.52576288144072 140-144 24.892446223111556 27.133566783391693 26.423211605802898 21.550775387693847 145-149 25.101255062753136 26.681334066703332 26.336316815840792 21.881094054702736 150-151 25.7875 26.55 26.2875 21.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 2.0 21 1.0 22 1.0 23 1.5 24 1.5 25 4.0 26 6.0 27 4.0 28 3.5 29 8.5 30 12.5 31 15.5 32 24.0 33 30.5 34 36.5 35 56.5 36 77.0 37 90.0 38 114.0 39 142.5 40 141.0 41 136.0 42 163.0 43 189.5 44 205.5 45 238.0 46 249.0 47 222.5 48 239.0 49 249.0 50 209.5 51 175.0 52 157.0 53 137.5 54 117.0 55 106.5 56 89.0 57 71.5 58 58.0 59 51.5 60 48.0 61 34.0 62 19.5 63 16.5 64 13.0 65 6.5 66 4.0 67 2.0 68 4.0 69 4.5 70 1.0 71 1.0 72 2.0 73 1.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.075 10-14 0.065 15-19 0.05 20-24 0.034999999999999996 25-29 0.045 30-34 0.05 35-39 0.065 40-44 0.08499999999999999 45-49 0.05 50-54 0.034999999999999996 55-59 0.045 60-64 0.05 65-69 0.025 70-74 0.015 75-79 0.02 80-84 0.02 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.045 115-119 0.04 120-124 0.015 125-129 0.0 130-134 0.02 135-139 0.05 140-144 0.05 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.575 #Duplication Level Percentage of deduplicated Percentage of total 1 97.48899818793684 94.15 2 1.9156096298213823 3.6999999999999997 3 0.36241263266891016 1.05 4 0.12943308309603935 0.5 5 0.05177323323841575 0.25 6 0.025886616619207874 0.15 7 0.0 0.0 8 0.025886616619207874 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 8 0.2 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 33bp) GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 1.9749999999999999 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.5875 0.0 0.0 0.0 0.0 134-135 3.7750000000000004 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 15-19 >>END_MODULE Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812865 spots for SRR7170686.sra Written 812865 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra Read 812855 spots for SRR7170686.sra Written 812855 spots for SRR7170686.sra SRR ids: ['SRR7170686.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ee9pg1kq SRR7170686.sra spots: 16257110 blocks: [[1, 812855], [812856, 1625710], [1625711, 2438565], [2438566, 3251420], [3251421, 4064275], [4064276, 4877130], [4877131, 5689985], [5689986, 6502840], [6502841, 7315695], [7315696, 8128550], [8128551, 8941405], [8941406, 9754260], [9754261, 10567115], [10567116, 11379970], [11379971, 12192825], [12192826, 13005680], [13005681, 13818535], [13818536, 14631390], [14631391, 15444245], [15444246, 16257110]] SRR7170686 file size 5487300 SRR7170686 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170686 SRR7170686_1.fastq SRR7170686_2.fastq Input file: SRR7170686_1.fastq Paired file: SRR7170686_2.fastq trimmed: SRR7170686-trimmed-pair1.fastq, SRR7170686-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:23:28 2025 >> started Thu Feb 13 17:23:47 2025 >> done (18.807s) 16257110 read pairs processed; of these: 23250 ( 0.14%) short read pairs filtered out after trimming by size control 58520 ( 0.36%) empty read pairs filtered out after trimming by size control 16175340 (99.50%) read pairs available; of these: 8351840 (51.63%) trimmed read pairs available after processing 7823500 (48.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 13 0.00% 20 7 0.00% 21 6 0.00% 22 8 0.00% 23 11 0.00% 24 9 0.00% 25 8 0.00% 26 10 0.00% 27 11 0.00% 28 13 0.00% 29 11 0.00% 30 16 0.00% 31 18 0.00% 32 6 0.00% 33 13 0.00% 34 24 0.00% 35 18 0.00% 36 23 0.00% 37 32 0.00% 38 25 0.00% 39 25 0.00% 40 41 0.00% 41 45 0.00% 42 36 0.00% 43 35 0.00% 44 57 0.00% 45 62 0.00% 46 59 0.00% 47 84 0.00% 48 93 0.00% 49 101 0.00% 50 107 0.00% 51 104 0.00% 52 141 0.00% 53 128 0.00% 54 139 0.00% 55 142 0.00% 56 170 0.00% 57 208 0.00% 58 230 0.00% 59 255 0.00% 60 272 0.00% 61 272 0.00% 62 339 0.00% 63 443 0.00% 64 376 0.00% 65 450 0.00% 66 495 0.00% 67 525 0.00% 68 579 0.00% 69 664 0.00% 70 717 0.00% 71 884 0.01% 72 1021 0.01% 73 1192 0.01% 74 1354 0.01% 75 1685 0.01% 76 2606 0.02% 77 2450 0.02% 78 1953 0.01% 79 2115 0.01% 80 2347 0.01% 81 2609 0.02% 82 2935 0.02% 83 3449 0.02% 84 4501 0.03% 85 5297 0.03% 86 5774 0.04% 87 6264 0.04% 88 6243 0.04% 89 6349 0.04% 90 6744 0.04% 91 7055 0.04% 92 7618 0.05% 93 8245 0.05% 94 9056 0.06% 95 9667 0.06% 96 9899 0.06% 97 9828 0.06% 98 10432 0.06% 99 10866 0.07% 100 11516 0.07% 101 12204 0.08% 102 12943 0.08% 103 13654 0.08% 104 14352 0.09% 105 15235 0.09% 106 15870 0.10% 107 16228 0.10% 108 16458 0.10% 109 17482 0.11% 110 17768 0.11% 111 18657 0.12% 112 19897 0.12% 113 21664 0.13% 114 22024 0.14% 115 22495 0.14% 116 23191 0.14% 117 23733 0.15% 118 24566 0.15% 119 25351 0.16% 120 25975 0.16% 121 27290 0.17% 122 28401 0.18% 123 30652 0.19% 124 31369 0.19% 125 33018 0.20% 126 34548 0.21% 127 36369 0.22% 128 37453 0.23% 129 38200 0.24% 130 40778 0.25% 131 42590 0.26% 132 44659 0.28% 133 47854 0.30% 134 51129 0.32% 135 54294 0.34% 136 57760 0.36% 137 62996 0.39% 138 69021 0.43% 139 74464 0.46% 140 82258 0.51% 141 93479 0.58% 142 105446 0.65% 143 123466 0.76% 144 144798 0.90% 145 175713 1.09% 146 223943 1.38% 147 314122 1.94% 148 476425 2.95% 149 951261 5.88% 150 4268703 26.39% 151 7823500 48.37% 16175340 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.71 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=267.74 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=13.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=19 prefix-density=0.69 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAACAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=34.78 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.2 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170686 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:24:38 Started mapping on | Feb 13 17:24:38 Finished on | Feb 13 17:28:25 Mapping speed, Million of reads per hour | 256.53 Number of input reads | 16175340 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13484784 Uniquely mapped reads % | 83.37% Average mapped length | 294.65 Number of splices: Total | 12874612 Number of splices: Annotated (sjdb) | 12598418 Number of splices: GT/AG | 12629534 Number of splices: GC/AG | 198447 Number of splices: AT/AC | 7906 Number of splices: Non-canonical | 38725 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.42 Insertion rate per base | 0.03% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 511285 % of reads mapped to multiple loci | 3.16% Number of reads mapped to too many loci | 663774 % of reads mapped to too many loci | 4.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.60% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2195923 2195923 2195923 N_multimapping 511285 511285 511285 N_noFeature 645582 13182952 710580 N_ambiguous 321457 2021 83122 UnstrandedReadsAssigned:12517745 PositiveStrandReadsAssigned:299811 NegativeStrandReadsAssigned:12691082 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170686 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170686-trimmed-pair1.fastq SRR7170686-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,175,340 reads, 13,061,158 reads pseudoaligned [quant] estimated average fragment length: 274.553 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7170686.ke.tsv 34699 SRR7170686.se.tsv 87100 total ==> SRR7170686.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.45 520 15.6144 Potri.005G024800.1.v4.1 1035 761.447 110 7.56714 Potri.004G059700.1.v4.1 961 687.51 1 0.0761903 Potri.007G009000.2.v4.1 1416 1142.45 0 0 Potri.003G141000.2.v4.1 2943 2669.45 555.471 10.8998 Potri.016G087400.1.v4.1 270 73.7817 718 509.747 Potri.015G069301.1.v4.1 564 299.864 0 0 Potri.010G195200.1.v4.1 1773 1499.45 26 0.908283 Potri.012G127500.1.v4.1 977 703.459 127 9.4568 ==> SRR7170686.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 264 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 41 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170686 completed mapping pipeline successfully