Starting /dee2/code/volunteer_pipeline.sh SRR7170687 current disk space = 3088748470272 free memory = 1446271960 SRR7170687 SRAfilesize bc2ebcbaf1d7d863b517fd8be55be801 SRR7170687.sra SRR7170687.sra file validated SRR7170687 is paired end SRR7170687 is conventional basespace SRR7170687 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170687_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.472 32.0 25.0 33.0 18.0 33.0 2 30.8845 33.0 29.0 33.0 27.0 34.0 3 31.25725 33.0 31.0 33.0 27.0 33.0 4 30.821 33.0 31.0 33.0 28.0 33.0 5 32.00425 33.0 33.0 33.0 30.0 33.0 6 36.673 38.0 37.0 38.0 34.0 38.0 7 37.027 38.0 38.0 38.0 35.0 38.0 8 37.31875 38.0 38.0 38.0 37.0 38.0 9 37.37725 38.0 38.0 38.0 37.0 38.0 10-14 37.288850000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.2879 38.0 38.0 38.0 37.0 38.0 20-24 37.42495 38.0 38.0 38.0 37.0 38.0 25-29 37.463350000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.3987 38.0 38.0 38.0 37.0 38.0 35-39 37.38195 38.0 38.0 38.0 37.0 38.0 40-44 37.3445 38.0 38.0 38.0 37.0 38.0 45-49 37.306799999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.20865 38.0 38.0 38.0 36.4 38.0 55-59 37.14095 38.0 38.0 38.0 36.0 38.0 60-64 37.080999999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.0389 38.0 38.0 38.0 36.0 38.0 70-74 36.92815 38.0 38.0 38.0 35.4 38.0 75-79 36.86415 38.0 38.0 38.0 35.0 38.0 80-84 36.75435 38.0 38.0 38.0 34.8 38.0 85-89 36.72595 38.0 38.0 38.0 34.6 38.0 90-94 36.54879999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.40915 38.0 37.0 38.0 34.0 38.0 100-104 36.14135 38.0 37.0 38.0 33.0 38.0 105-109 36.07645000000001 38.0 37.0 38.0 33.0 38.0 110-114 35.78185 38.0 36.8 38.0 31.0 38.0 115-119 35.47405 38.0 36.0 38.0 29.4 38.0 120-124 35.4421 38.0 36.0 38.0 29.8 38.0 125-129 35.3092 38.0 35.8 38.0 29.2 38.0 130-134 35.029149999999994 38.0 35.0 38.0 28.2 38.0 135-139 34.65205 38.0 35.0 38.0 27.0 38.0 140-144 33.957 38.0 34.2 38.0 23.0 38.0 145-149 33.043499999999995 38.0 33.2 38.0 19.4 38.0 150-151 27.622 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 2.0 20 4.0 21 2.0 22 3.0 23 6.0 24 3.0 25 13.0 26 8.0 27 21.0 28 32.0 29 33.0 30 43.0 31 69.0 32 104.0 33 146.0 34 200.0 35 370.0 36 985.0 37 1949.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.4025974025974 17.61038961038961 11.272727272727273 37.714285714285715 2 19.1 27.025 36.85 17.025000000000002 3 16.85 31.85 27.55 23.75 4 21.75 35.225 22.2 20.825 5 20.807219854600152 38.78164953622461 22.612183504637752 17.798947104537476 6 16.375 36.55 24.975 22.1 7 11.325000000000001 18.325 47.5 22.85 8 18.325 21.125 29.575000000000003 30.975 9 17.1 21.875 31.7 29.325000000000003 10-14 19.759999999999998 29.79 26.305 24.145 15-19 20.380000000000003 27.944999999999997 27.715 23.96 20-24 20.075000000000003 29.020000000000003 26.99 23.915 25-29 19.355 28.910000000000004 27.825 23.91 30-34 19.705000000000002 28.43 28.255000000000003 23.61 35-39 19.744999999999997 28.54 27.615000000000002 24.099999999999998 40-44 19.935 28.634999999999998 27.400000000000002 24.03 45-49 20.435 28.449999999999996 27.845 23.27 50-54 19.675 28.955 27.91 23.46 55-59 19.794999999999998 28.249999999999996 28.01 23.945 60-64 19.759999999999998 28.28 27.99 23.97 65-69 19.7 28.565 28.07 23.665 70-74 20.645 28.249999999999996 27.405 23.7 75-79 20.175 28.65 27.175 24.0 80-84 20.815 28.349999999999998 27.139999999999997 23.695 85-89 20.095 28.470000000000002 27.800000000000004 23.635 90-94 19.88 28.845 27.435 23.84 95-99 20.175 28.360000000000003 27.92 23.544999999999998 100-104 20.215 28.42 28.125 23.24 105-109 20.544999999999998 28.38 27.62 23.455000000000002 110-114 20.73 28.105000000000004 28.075 23.09 115-119 20.605 28.33 27.185 23.880000000000003 120-124 20.535 28.360000000000003 27.395000000000003 23.71 125-129 20.93 28.199999999999996 27.57 23.3 130-134 20.54 28.15 27.384999999999998 23.925 135-139 20.419999999999998 28.095 27.315 24.169999999999998 140-144 21.38 28.68 26.974999999999998 22.965 145-149 20.44 28.79 27.35 23.419999999999998 150-151 21.390173771721464 28.728591073884235 26.328291036379547 23.55294411801475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 2.5 24 4.0 25 3.0 26 5.5 27 9.5 28 10.0 29 14.5 30 23.5 31 26.5 32 33.0 33 42.5 34 57.5 35 74.0 36 93.0 37 129.0 38 143.5 39 161.5 40 183.0 41 212.0 42 268.5 43 273.5 44 234.5 45 245.0 46 269.5 47 259.5 48 237.5 49 208.0 50 173.0 51 133.5 52 112.5 53 88.5 54 68.0 55 56.0 56 38.5 57 30.0 58 24.5 59 17.5 60 12.0 61 7.0 62 2.5 63 1.5 64 1.0 65 0.0 66 1.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.4783484390735146 0.95 3 0.0755287009063444 0.22499999999999998 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 3.9875 0.0 0.0 0.0 0.0 134-135 4.2375 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138-139 4.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076588374 18.123438 130-134 >>END_MODULE SRR7170687 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170687_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4775 33.0 33.0 34.0 32.0 34.0 2 32.74775 33.0 33.0 34.0 32.0 34.0 3 32.81075 33.0 33.0 34.0 32.0 34.0 4 32.6375 33.0 33.0 34.0 32.0 34.0 5 32.6785 33.0 33.0 34.0 32.0 34.0 6 36.83625 38.0 38.0 38.0 36.0 38.0 7 36.9 38.0 38.0 38.0 36.0 38.0 8 36.91475 38.0 38.0 38.0 36.0 38.0 9 36.99625 38.0 38.0 38.0 36.0 38.0 10-14 36.96195 38.0 38.0 38.0 36.0 38.0 15-19 36.9097 38.0 38.0 38.0 36.0 38.0 20-24 36.87195 38.0 38.0 38.0 36.0 38.0 25-29 36.78425 38.0 38.0 38.0 35.4 38.0 30-34 36.698699999999995 38.0 38.0 38.0 35.2 38.0 35-39 36.8152 38.0 38.0 38.0 35.8 38.0 40-44 36.78275 38.0 38.0 38.0 35.6 38.0 45-49 36.7215 38.0 38.0 38.0 35.2 38.0 50-54 36.5963 38.0 38.0 38.0 34.6 38.0 55-59 36.49915 38.0 38.0 38.0 34.0 38.0 60-64 36.584649999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.56185 38.0 38.0 38.0 34.4 38.0 70-74 36.50215 38.0 38.0 38.0 34.4 38.0 75-79 36.4256 38.0 38.0 38.0 34.2 38.0 80-84 36.3484 38.0 38.0 38.0 34.0 38.0 85-89 36.19485 38.0 38.0 38.0 33.8 38.0 90-94 36.0643 38.0 37.6 38.0 33.2 38.0 95-99 35.8903 38.0 37.2 38.0 32.8 38.0 100-104 35.80225 38.0 37.0 38.0 31.6 38.0 105-109 35.752449999999996 38.0 37.0 38.0 31.8 38.0 110-114 35.437 38.0 36.6 38.0 29.4 38.0 115-119 35.167899999999996 38.0 36.0 38.0 29.0 38.0 120-124 34.99515000000001 38.0 36.0 38.0 28.0 38.0 125-129 34.65135 38.0 34.8 38.0 26.4 38.0 130-134 34.287850000000006 38.0 33.6 38.0 24.6 38.0 135-139 33.9448 38.0 33.2 38.0 23.4 38.0 140-144 33.22015 38.0 33.0 38.0 20.0 38.0 145-149 31.986299999999993 38.0 32.6 38.0 8.6 38.0 150-151 26.211875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 8.0 4 1.0 5 0.0 6 4.0 7 1.0 8 0.0 9 3.0 10 2.0 11 2.0 12 3.0 13 4.0 14 2.0 15 5.0 16 4.0 17 1.0 18 4.0 19 5.0 20 6.0 21 4.0 22 8.0 23 16.0 24 17.0 25 23.0 26 30.0 27 28.0 28 49.0 29 45.0 30 55.0 31 81.0 32 95.0 33 154.0 34 178.0 35 304.0 36 693.0 37 2163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.3 16.8 13.775 33.125 2 23.95 23.125 37.3 15.625 3 20.175 26.200000000000003 32.225 21.4 4 22.675 36.25 21.75 19.325 5 21.525 37.724999999999994 22.225 18.525 6 16.195244055068837 36.67083854818523 25.982478097622025 21.151439299123904 7 16.7125344008006 14.610958218663997 45.48411308481361 23.19239429572179 8 20.500625782227786 21.25156445556946 27.183979974968707 31.06382978723404 9 21.391043282461847 23.29246935201401 28.57142857142857 26.745058794095574 10-14 22.61422208877546 28.909573137166593 26.782765350547965 21.693439423509982 15-19 22.999949967478862 28.143293140541353 28.023215089808375 20.833541802171414 20-24 22.641981486114584 27.92594445834376 28.40630472854641 21.025769326995245 25-29 22.687015261446085 28.401300975731797 27.950963222416814 20.960720540405305 30-34 22.466850137603203 27.775831873905428 28.136102076557417 21.621215911933948 35-39 22.65265265265265 28.268268268268272 27.97797797797798 21.1011011011011 40-44 22.456948338005606 27.427913496195433 28.47416900280336 21.640969162995592 45-49 22.85328262610088 27.747197758206564 27.73218574859888 21.667333867093674 50-54 22.57192894671003 27.60570427820866 28.491368526394794 21.330998248686512 55-59 22.63263263263263 27.49249249249249 28.493493493493492 21.38138138138138 60-64 22.7404664197778 28.20038034230808 27.97517765989391 21.083975578020215 65-69 23.280132085855808 27.402811827687994 27.9031370390754 21.413919047380798 70-74 22.754101640656263 27.941176470588236 27.761104441776713 21.543617446978793 75-79 22.989943463251112 27.487867113623853 28.0182118376945 21.50397758543053 80-84 22.56902761104442 27.380952380952383 28.12124849939976 21.928771508603443 85-89 23.087698234028718 28.340587323027666 27.37005352944119 21.201660913502426 90-94 23.06922769107643 27.62104841936775 28.226290516206483 21.08343337334934 95-99 22.529505901180237 27.550510102020404 29.015803160632125 20.90418083616723 100-104 23.374674934987 27.58551710342068 28.055611122224445 20.984196839367875 105-109 23.494096457874726 27.661596958174904 28.211927156293775 20.632379427656595 110-114 23.155471018119933 27.17489238161978 28.37120832916208 21.298428271098206 115-119 23.687765824368277 27.62071553665249 28.14610958218664 20.545409056792593 120-124 23.80190095047524 28.129064532266135 27.24862431215608 20.82041020510255 125-129 23.934360616369823 27.62157294376626 27.9467680608365 20.497298379027416 130-134 23.961980990495245 27.848924462231118 27.788894447223612 20.400200100050025 135-139 23.791412271043942 27.805024522069864 27.860074066659994 20.543489140226203 140-144 24.48948948948949 27.93793793793794 27.312312312312315 20.26026026026026 145-149 23.997399739974 28.06780678067807 27.702770277027707 20.23202320232023 150-151 25.35 27.250000000000004 27.025 20.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.5 15 1.5 16 1.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 3.5 25 2.5 26 3.5 27 4.0 28 4.0 29 13.0 30 21.0 31 22.0 32 26.5 33 43.0 34 55.5 35 71.5 36 92.0 37 106.5 38 130.0 39 166.0 40 199.0 41 216.0 42 234.5 43 249.0 44 262.0 45 263.5 46 263.5 47 259.5 48 222.0 49 186.0 50 171.0 51 153.5 52 119.5 53 88.5 54 81.0 55 70.5 56 50.5 57 36.5 58 26.5 59 22.0 60 18.5 61 11.5 62 6.0 63 4.5 64 2.5 65 1.5 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.075 8 0.125 9 0.075 10-14 0.08499999999999999 15-19 0.065 20-24 0.075 25-29 0.075 30-34 0.075 35-39 0.1 40-44 0.12 45-49 0.08 50-54 0.075 55-59 0.1 60-64 0.09 65-69 0.065 70-74 0.04 75-79 0.065 80-84 0.04 85-89 0.055 90-94 0.04 95-99 0.02 100-104 0.02 105-109 0.06 110-114 0.11 115-119 0.075 120-124 0.05 125-129 0.06 130-134 0.05 135-139 0.09 140-144 0.1 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0379746835443 97.8 2 0.7341772151898734 1.4500000000000002 3 0.17721518987341772 0.525 4 0.025316455696202535 0.1 5 0.025316455696202535 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.7249999999999996 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138-139 4.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179076 spots for SRR7170687.sra Written 1179076 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra Read 1179071 spots for SRR7170687.sra Written 1179071 spots for SRR7170687.sra SRR ids: ['SRR7170687.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3qz2afvf SRR7170687.sra spots: 23581425 blocks: [[1, 1179071], [1179072, 2358142], [2358143, 3537213], [3537214, 4716284], [4716285, 5895355], [5895356, 7074426], [7074427, 8253497], [8253498, 9432568], [9432569, 10611639], [10611640, 11790710], [11790711, 12969781], [12969782, 14148852], [14148853, 15327923], [15327924, 16506994], [16506995, 17686065], [17686066, 18865136], [18865137, 20044207], [20044208, 21223278], [21223279, 22402349], [22402350, 23581425]] SRR7170687 file size 7969270 SRR7170687 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170687 SRR7170687_1.fastq SRR7170687_2.fastq Input file: SRR7170687_1.fastq Paired file: SRR7170687_2.fastq trimmed: SRR7170687-trimmed-pair1.fastq, SRR7170687-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:30:48 2025 >> started Thu Feb 13 16:31:15 2025 >> done (26.825s) 23581425 read pairs processed; of these: 13689 ( 0.06%) short read pairs filtered out after trimming by size control 17592 ( 0.07%) empty read pairs filtered out after trimming by size control 23550144 (99.87%) read pairs available; of these: 12167886 (51.67%) trimmed read pairs available after processing 11382258 (48.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 5 0.00% 21 6 0.00% 22 7 0.00% 23 14 0.00% 24 8 0.00% 25 9 0.00% 26 10 0.00% 27 14 0.00% 28 7 0.00% 29 11 0.00% 30 11 0.00% 31 24 0.00% 32 16 0.00% 33 20 0.00% 34 18 0.00% 35 14 0.00% 36 20 0.00% 37 18 0.00% 38 26 0.00% 39 27 0.00% 40 20 0.00% 41 32 0.00% 42 41 0.00% 43 29 0.00% 44 42 0.00% 45 59 0.00% 46 63 0.00% 47 66 0.00% 48 79 0.00% 49 99 0.00% 50 105 0.00% 51 113 0.00% 52 151 0.00% 53 148 0.00% 54 157 0.00% 55 157 0.00% 56 185 0.00% 57 181 0.00% 58 213 0.00% 59 249 0.00% 60 297 0.00% 61 333 0.00% 62 367 0.00% 63 447 0.00% 64 451 0.00% 65 492 0.00% 66 554 0.00% 67 591 0.00% 68 641 0.00% 69 735 0.00% 70 863 0.00% 71 1030 0.00% 72 1176 0.00% 73 1343 0.01% 74 1498 0.01% 75 1692 0.01% 76 1886 0.01% 77 1944 0.01% 78 2128 0.01% 79 2397 0.01% 80 2539 0.01% 81 2994 0.01% 82 3429 0.01% 83 4013 0.02% 84 5017 0.02% 85 5739 0.02% 86 6006 0.03% 87 6414 0.03% 88 6782 0.03% 89 7212 0.03% 90 7711 0.03% 91 8388 0.04% 92 9286 0.04% 93 9840 0.04% 94 10591 0.04% 95 11202 0.05% 96 11675 0.05% 97 12152 0.05% 98 12622 0.05% 99 13208 0.06% 100 14164 0.06% 101 14818 0.06% 102 16037 0.07% 103 16734 0.07% 104 17751 0.08% 105 18662 0.08% 106 19502 0.08% 107 20133 0.09% 108 20583 0.09% 109 21540 0.09% 110 22174 0.09% 111 23637 0.10% 112 24710 0.10% 113 25788 0.11% 114 27808 0.12% 115 28410 0.12% 116 29314 0.12% 117 30960 0.13% 118 31666 0.13% 119 32104 0.14% 120 33933 0.14% 121 34948 0.15% 122 37057 0.16% 123 39961 0.17% 124 41539 0.18% 125 43889 0.19% 126 45427 0.19% 127 47365 0.20% 128 49328 0.21% 129 51881 0.22% 130 54621 0.23% 131 58168 0.25% 132 61964 0.26% 133 65809 0.28% 134 71281 0.30% 135 76355 0.32% 136 83045 0.35% 137 90300 0.38% 138 98014 0.42% 139 109550 0.47% 140 122048 0.52% 141 138919 0.59% 142 162176 0.69% 143 186792 0.79% 144 218209 0.93% 145 272295 1.16% 146 349919 1.49% 147 496787 2.11% 148 742125 3.15% 149 1426540 6.06% 150 6220974 26.42% 151 11382258 48.33% 23550144 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=13 prefix-density=0.79 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=452.50 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGA criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=12 prefix-density=1.00 prefix-fanout=2.4 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=62.52 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170687 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:32:00 Started mapping on | Feb 13 16:32:00 Finished on | Feb 13 16:34:49 Mapping speed, Million of reads per hour | 501.66 Number of input reads | 23550144 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22314863 Uniquely mapped reads % | 94.75% Average mapped length | 294.93 Number of splices: Total | 22935839 Number of splices: Annotated (sjdb) | 22473051 Number of splices: GT/AG | 22500658 Number of splices: GC/AG | 365838 Number of splices: AT/AC | 12087 Number of splices: Non-canonical | 57256 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 517299 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 29115 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 734617 734617 734617 N_multimapping 517299 517299 517299 N_noFeature 798790 21974341 910015 N_ambiguous 378614 1406 148497 UnstrandedReadsAssigned:21137459 PositiveStrandReadsAssigned:339116 NegativeStrandReadsAssigned:21256351 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170687 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170687-trimmed-pair1.fastq SRR7170687-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,550,144 reads, 21,106,779 reads pseudoaligned [quant] estimated average fragment length: 278.023 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR7170687.ke.tsv 34699 SRR7170687.se.tsv 87100 total ==> SRR7170687.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.98 746 19.2049 Potri.005G024800.1.v4.1 1035 757.977 337 19.9269 Potri.004G059700.1.v4.1 961 684.035 38 2.48984 Potri.007G009000.2.v4.1 1416 1138.98 0 0 Potri.003G141000.2.v4.1 2943 2665.98 1301.47 21.8798 Potri.016G087400.1.v4.1 270 72.1967 967 600.309 Potri.015G069301.1.v4.1 564 296.839 0 0 Potri.010G195200.1.v4.1 1773 1495.98 18 0.539279 Potri.012G127500.1.v4.1 977 700.014 37 2.36898 ==> SRR7170687.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 903 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 334 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 4 SRR7170687 completed mapping pipeline successfully