Starting /dee2/code/volunteer_pipeline.sh SRR7170688 current disk space = 3088751820800 free memory = 1438056436 SRR7170688 SRAfilesize c89efb152ae7e06aff72b77755ba9f2a SRR7170688.sra SRR7170688.sra file validated SRR7170688 is paired end SRR7170688 is conventional basespace SRR7170688 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170688_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.67825 30.0 18.0 33.0 18.0 33.0 2 30.31375 31.0 29.0 33.0 27.0 33.0 3 30.52775 31.0 29.0 33.0 27.0 33.0 4 31.17025 32.0 32.0 33.0 28.0 33.0 5 32.37225 33.0 33.0 33.0 32.0 33.0 6 36.78625 38.0 37.0 38.0 35.0 38.0 7 37.16225 38.0 38.0 38.0 36.0 38.0 8 37.43625 38.0 38.0 38.0 37.0 38.0 9 37.4635 38.0 38.0 38.0 37.0 38.0 10-14 37.41585 38.0 38.0 38.0 37.0 38.0 15-19 37.46849999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.5484 38.0 38.0 38.0 37.8 38.0 25-29 37.58385 38.0 38.0 38.0 38.0 38.0 30-34 37.5594 38.0 38.0 38.0 38.0 38.0 35-39 37.505250000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.4695 38.0 38.0 38.0 37.4 38.0 45-49 37.45625 38.0 38.0 38.0 37.2 38.0 50-54 37.3857 38.0 38.0 38.0 37.0 38.0 55-59 37.2653 38.0 38.0 38.0 37.0 38.0 60-64 37.26434999999999 38.0 38.0 38.0 36.8 38.0 65-69 37.17215 38.0 38.0 38.0 36.0 38.0 70-74 37.18025 38.0 38.0 38.0 36.0 38.0 75-79 37.07595 38.0 38.0 38.0 36.0 38.0 80-84 36.950450000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.81525 38.0 38.0 38.0 35.0 38.0 90-94 36.7726 38.0 38.0 38.0 35.0 38.0 95-99 36.60105 38.0 38.0 38.0 34.2 38.0 100-104 36.4893 38.0 38.0 38.0 34.0 38.0 105-109 36.33325 38.0 37.2 38.0 33.8 38.0 110-114 36.16825 38.0 37.0 38.0 33.4 38.0 115-119 35.87175 38.0 37.0 38.0 31.8 38.0 120-124 35.7369 38.0 36.4 38.0 31.0 38.0 125-129 35.6965 38.0 36.0 38.0 31.0 38.0 130-134 35.498000000000005 38.0 36.0 38.0 31.4 38.0 135-139 34.972300000000004 38.0 34.8 38.0 28.8 38.0 140-144 34.109449999999995 38.0 33.8 38.0 24.0 38.0 145-149 33.68565 38.0 33.0 38.0 23.6 38.0 150-151 29.27775 34.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 1.0 16 0.0 17 0.0 18 3.0 19 3.0 20 1.0 21 5.0 22 2.0 23 6.0 24 3.0 25 8.0 26 15.0 27 15.0 28 19.0 29 31.0 30 43.0 31 50.0 32 52.0 33 120.0 34 155.0 35 347.0 36 913.0 37 2204.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.40143003064352 17.900919305413687 11.082737487231869 37.61491317671093 2 18.6 27.6 37.35 16.45 3 17.45 31.125000000000004 27.325 24.099999999999998 4 20.75 35.575 23.1 20.575 5 20.01501125844383 37.22792094070553 23.44258193645234 19.314485864398296 6 16.425 35.9 25.0 22.675 7 12.2 19.125 46.175 22.5 8 16.925 20.7 29.925 32.45 9 17.474999999999998 22.475 31.2 28.849999999999998 10-14 19.384999999999998 29.125 27.095000000000002 24.395 15-19 19.165 28.42 28.035 24.38 20-24 19.515 28.910000000000004 27.87 23.705000000000002 25-29 19.75 28.720000000000002 27.665 23.865 30-34 19.59 28.655 28.105000000000004 23.65 35-39 20.015 28.655 27.250000000000004 24.08 40-44 20.16 27.810000000000002 28.265 23.765 45-49 19.615 28.544999999999998 27.944999999999997 23.895 50-54 19.685 28.63 27.88 23.805 55-59 19.275000000000002 27.884999999999998 28.555000000000003 24.285 60-64 20.41 28.27 28.115000000000002 23.205000000000002 65-69 20.085 28.455000000000002 27.965 23.494999999999997 70-74 19.900000000000002 28.03 27.935 24.135 75-79 19.794999999999998 28.62 27.735 23.849999999999998 80-84 19.86 29.075 27.455000000000002 23.61 85-89 20.215 28.410000000000004 27.77 23.605 90-94 19.785 28.46 28.084999999999997 23.669999999999998 95-99 19.975 28.194999999999997 27.889999999999997 23.94 100-104 20.18 27.765 28.425 23.630000000000003 105-109 19.965 28.444999999999997 27.950000000000003 23.64 110-114 20.835 27.77 27.98 23.415 115-119 20.69 29.044999999999998 26.834999999999997 23.43 120-124 20.225 28.970000000000002 26.889999999999997 23.915 125-129 20.64 28.715000000000003 26.76 23.885 130-134 20.52 28.349999999999998 27.32 23.810000000000002 135-139 20.945 27.495000000000005 27.875 23.685000000000002 140-144 20.580000000000002 27.694999999999997 27.589999999999996 24.135 145-149 20.01 28.189999999999998 27.694999999999997 24.104999999999997 150-151 20.599999999999998 28.462500000000002 26.125 24.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 2.0 21 2.0 22 2.5 23 4.0 24 4.5 25 4.0 26 3.5 27 6.5 28 13.5 29 19.0 30 24.0 31 35.0 32 39.5 33 38.0 34 54.0 35 87.0 36 111.5 37 119.0 38 133.5 39 170.0 40 196.0 41 217.0 42 245.0 43 256.0 44 259.0 45 248.0 46 251.5 47 254.0 48 224.5 49 191.0 50 164.0 51 148.0 52 109.0 53 85.5 54 73.0 55 56.5 56 45.0 57 28.5 58 23.5 59 15.5 60 10.0 61 5.5 62 6.0 63 5.0 64 1.5 65 2.0 66 1.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6048387096774194 1.2 3 0.10080645161290322 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.025 0.0 126-127 3.0125 0.0 0.0 0.025 0.0 128-129 3.2375 0.0 0.0 0.025 0.0 130-131 3.45 0.0 0.0 0.025 0.0 132-133 3.6500000000000004 0.0 0.0 0.025 0.0 134-135 4.012499999999999 0.0 0.0 0.025 0.0 136-137 4.3 0.0 0.0 0.025 0.0 138-139 4.4625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCTCC 10 0.006832588 144.9875 5 >>END_MODULE SRR7170688 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170688_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79225 33.0 33.0 34.0 32.0 34.0 2 32.9195 33.0 33.0 34.0 32.0 34.0 3 32.88375 34.0 33.0 34.0 32.0 34.0 4 32.827 34.0 33.0 34.0 32.0 34.0 5 32.8995 34.0 33.0 34.0 32.0 34.0 6 37.08475 38.0 38.0 38.0 36.0 38.0 7 37.08475 38.0 38.0 38.0 37.0 38.0 8 37.07825 38.0 38.0 38.0 37.0 38.0 9 37.10325 38.0 38.0 38.0 37.0 38.0 10-14 37.066649999999996 38.0 38.0 38.0 36.2 38.0 15-19 37.036899999999996 38.0 38.0 38.0 36.8 38.0 20-24 37.00345 38.0 38.0 38.0 36.4 38.0 25-29 36.9099 38.0 38.0 38.0 36.0 38.0 30-34 36.923449999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.9772 38.0 38.0 38.0 36.4 38.0 40-44 36.92185 38.0 38.0 38.0 36.2 38.0 45-49 36.893449999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.78555 38.0 38.0 38.0 36.0 38.0 55-59 36.77244999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.74685 38.0 38.0 38.0 36.0 38.0 65-69 36.70890000000001 38.0 38.0 38.0 35.6 38.0 70-74 36.62765 38.0 38.0 38.0 35.0 38.0 75-79 36.5829 38.0 38.0 38.0 35.4 38.0 80-84 36.46685 38.0 38.0 38.0 34.2 38.0 85-89 36.431400000000004 38.0 38.0 38.0 34.4 38.0 90-94 36.37094999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.130900000000004 38.0 38.0 38.0 33.8 38.0 100-104 35.9985 38.0 37.8 38.0 33.0 38.0 105-109 35.8865 38.0 37.2 38.0 33.0 38.0 110-114 35.64345 38.0 37.0 38.0 31.4 38.0 115-119 35.42675 38.0 36.8 38.0 30.6 38.0 120-124 35.384249999999994 38.0 36.4 38.0 31.0 38.0 125-129 35.10795 38.0 36.0 38.0 29.4 38.0 130-134 34.4971 38.0 35.0 38.0 26.4 38.0 135-139 34.097500000000004 38.0 33.4 38.0 24.8 38.0 140-144 33.39995 38.0 33.0 38.0 20.4 38.0 145-149 32.3194 38.0 33.0 38.0 11.0 38.0 150-151 27.016375 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 11.0 4 4.0 5 3.0 6 1.0 7 2.0 8 0.0 9 2.0 10 5.0 11 0.0 12 2.0 13 2.0 14 3.0 15 5.0 16 2.0 17 4.0 18 7.0 19 7.0 20 14.0 21 5.0 22 9.0 23 9.0 24 10.0 25 17.0 26 23.0 27 27.0 28 28.0 29 41.0 30 40.0 31 52.0 32 85.0 33 101.0 34 166.0 35 265.0 36 681.0 37 2366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.85 15.825 15.375 29.95 2 23.0 23.150000000000002 37.574999999999996 16.275000000000002 3 19.775000000000002 26.0 32.6 21.625 4 23.9 35.949999999999996 20.7 19.45 5 22.5 38.475 21.6 17.424999999999997 6 17.775 37.2 24.675 20.349999999999998 7 17.05 15.25 46.35 21.349999999999998 8 20.474999999999998 21.275 28.849999999999998 29.4 9 22.575 23.025000000000002 28.499999999999996 25.900000000000002 10-14 22.075 28.444999999999997 27.105 22.375 15-19 22.955000000000002 27.939999999999998 28.24 20.865000000000002 20-24 22.775000000000002 27.884999999999998 28.139999999999997 21.2 25-29 22.66 28.185 27.994999999999997 21.16 30-34 23.015 27.625 28.215 21.145 35-39 22.665 27.865000000000002 28.01 21.46 40-44 22.884999999999998 27.905 27.925 21.285 45-49 22.650000000000002 27.715 28.395 21.240000000000002 50-54 23.23 28.16 27.555000000000003 21.055 55-59 23.09 28.050000000000004 27.950000000000003 20.91 60-64 23.25 28.03 27.555000000000003 21.165 65-69 23.74 27.555000000000003 27.534999999999997 21.17 70-74 23.35 27.810000000000002 27.894999999999996 20.945 75-79 23.61 27.77 27.61 21.01 80-84 22.96 28.205000000000002 27.625 21.21 85-89 24.044999999999998 27.63 27.465 20.86 90-94 22.720000000000002 28.165000000000003 28.18 20.935000000000002 95-99 23.494999999999997 27.800000000000004 27.705000000000002 21.0 100-104 23.085 27.845 28.03 21.04 105-109 24.05 28.035 27.935 19.98 110-114 23.875 28.299999999999997 27.58 20.244999999999997 115-119 23.705000000000002 27.905 28.12 20.27 120-124 23.585 27.839999999999996 28.084999999999997 20.49 125-129 24.6 27.435 27.555000000000003 20.41 130-134 24.315 28.294999999999998 27.325 20.064999999999998 135-139 24.03 27.775 27.794999999999998 20.4 140-144 24.355 27.845 27.93 19.869999999999997 145-149 24.29 27.735 27.58 20.395 150-151 24.325 27.8625 27.237499999999997 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 4.0 24 3.0 25 2.5 26 4.5 27 5.0 28 6.5 29 12.5 30 17.0 31 22.5 32 27.0 33 40.5 34 53.5 35 60.5 36 83.5 37 106.0 38 127.5 39 160.0 40 200.0 41 234.5 42 242.0 43 247.0 44 256.0 45 275.0 46 268.0 47 239.0 48 222.5 49 198.5 50 176.5 51 139.0 52 106.0 53 92.0 54 76.5 55 66.5 56 64.0 57 49.5 58 30.0 59 24.0 60 19.5 61 9.5 62 6.0 63 4.5 64 2.5 65 3.0 66 2.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16687705124968 98.2 2 0.7321383489017925 1.4500000000000002 3 0.050492299924261554 0.15 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0125 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.1 0.0 0.0 0.025 0.0 92-93 0.15 0.0 0.0 0.025 0.0 94-95 0.225 0.0 0.0 0.025 0.0 96-97 0.3125 0.0 0.0 0.025 0.0 98-99 0.4625 0.0 0.0 0.025 0.0 100-101 0.5625 0.0 0.0 0.025 0.0 102-103 0.675 0.0 0.0 0.025 0.0 104-105 0.7375 0.0 0.0 0.025 0.0 106-107 0.925 0.0 0.0 0.025 0.0 108-109 1.125 0.0 0.0 0.025 0.0 110-111 1.3 0.0 0.0 0.025 0.0 112-113 1.4875 0.0 0.0 0.025 0.0 114-115 1.6625 0.0 0.0 0.025 0.0 116-117 1.9125 0.0 0.0 0.025 0.0 118-119 2.0875 0.0 0.0 0.025 0.0 120-121 2.3 0.0 0.0 0.025 0.0 122-123 2.4875 0.0 0.0 0.025 0.0 124-125 2.8 0.0 0.0 0.025 0.0 126-127 3.025 0.0 0.0 0.025 0.0 128-129 3.2625 0.0 0.0 0.025 0.0 130-131 3.4749999999999996 0.0 0.0 0.025 0.0 132-133 3.6625 0.0 0.0 0.025 0.0 134-135 4.025 0.0 0.0 0.025 0.0 136-137 4.325 0.0 0.0 0.025 0.0 138-139 4.487500000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAATC 10 0.006830828 145.0 2 >>END_MODULE Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729827 spots for SRR7170688.sra Written 729827 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra Read 729809 spots for SRR7170688.sra Written 729809 spots for SRR7170688.sra SRR ids: ['SRR7170688.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nje_xts0 SRR7170688.sra spots: 14596198 blocks: [[1, 729809], [729810, 1459618], [1459619, 2189427], [2189428, 2919236], [2919237, 3649045], [3649046, 4378854], [4378855, 5108663], [5108664, 5838472], [5838473, 6568281], [6568282, 7298090], [7298091, 8027899], [8027900, 8757708], [8757709, 9487517], [9487518, 10217326], [10217327, 10947135], [10947136, 11676944], [11676945, 12406753], [12406754, 13136562], [13136563, 13866371], [13866372, 14596198]] SRR7170688 file size 4924472 SRR7170688 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170688 SRR7170688_1.fastq SRR7170688_2.fastq Input file: SRR7170688_1.fastq Paired file: SRR7170688_2.fastq trimmed: SRR7170688-trimmed-pair1.fastq, SRR7170688-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:29:17 2025 >> started Thu Feb 13 16:29:35 2025 >> done (18.017s) 14596198 read pairs processed; of these: 12447 ( 0.09%) short read pairs filtered out after trimming by size control 17455 ( 0.12%) empty read pairs filtered out after trimming by size control 14566296 (99.80%) read pairs available; of these: 7754567 (53.24%) trimmed read pairs available after processing 6811729 (46.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 4 0.00% 21 5 0.00% 22 8 0.00% 23 8 0.00% 24 5 0.00% 25 4 0.00% 26 6 0.00% 27 9 0.00% 28 10 0.00% 29 6 0.00% 30 9 0.00% 31 11 0.00% 32 13 0.00% 33 14 0.00% 34 9 0.00% 35 11 0.00% 36 14 0.00% 37 11 0.00% 38 18 0.00% 39 16 0.00% 40 33 0.00% 41 35 0.00% 42 38 0.00% 43 29 0.00% 44 45 0.00% 45 51 0.00% 46 50 0.00% 47 58 0.00% 48 60 0.00% 49 70 0.00% 50 81 0.00% 51 114 0.00% 52 112 0.00% 53 113 0.00% 54 103 0.00% 55 117 0.00% 56 127 0.00% 57 153 0.00% 58 181 0.00% 59 188 0.00% 60 211 0.00% 61 264 0.00% 62 305 0.00% 63 314 0.00% 64 355 0.00% 65 386 0.00% 66 422 0.00% 67 417 0.00% 68 492 0.00% 69 582 0.00% 70 614 0.00% 71 748 0.01% 72 803 0.01% 73 1017 0.01% 74 1053 0.01% 75 1266 0.01% 76 1478 0.01% 77 1497 0.01% 78 1508 0.01% 79 1740 0.01% 80 1853 0.01% 81 2158 0.01% 82 2408 0.02% 83 2876 0.02% 84 3612 0.02% 85 4139 0.03% 86 4379 0.03% 87 4632 0.03% 88 4750 0.03% 89 5240 0.04% 90 5420 0.04% 91 5708 0.04% 92 6264 0.04% 93 6928 0.05% 94 7250 0.05% 95 7604 0.05% 96 7958 0.05% 97 8228 0.06% 98 8578 0.06% 99 9056 0.06% 100 9652 0.07% 101 10061 0.07% 102 10694 0.07% 103 11574 0.08% 104 11840 0.08% 105 12504 0.09% 106 13141 0.09% 107 13506 0.09% 108 14079 0.10% 109 14654 0.10% 110 15097 0.10% 111 15553 0.11% 112 16362 0.11% 113 17327 0.12% 114 17957 0.12% 115 18576 0.13% 116 19211 0.13% 117 20036 0.14% 118 20312 0.14% 119 20991 0.14% 120 22004 0.15% 121 22631 0.16% 122 23892 0.16% 123 25505 0.18% 124 26807 0.18% 125 27778 0.19% 126 28724 0.20% 127 30188 0.21% 128 31599 0.22% 129 33264 0.23% 130 35233 0.24% 131 36942 0.25% 132 39269 0.27% 133 41935 0.29% 134 44949 0.31% 135 48436 0.33% 136 53065 0.36% 137 57788 0.40% 138 62465 0.43% 139 69350 0.48% 140 78281 0.54% 141 86688 0.60% 142 98726 0.68% 143 115417 0.79% 144 138124 0.95% 145 172192 1.18% 146 218506 1.50% 147 303298 2.08% 148 472269 3.24% 149 947874 6.51% 150 3931771 26.99% 151 6811729 46.76% 14566296 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=23 prefix-density=0.50 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=300.68 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.74 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=24.55 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.1 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7170688 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:30:27 Started mapping on | Feb 13 16:30:28 Finished on | Feb 13 16:31:55 Mapping speed, Million of reads per hour | 602.74 Number of input reads | 14566296 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13651554 Uniquely mapped reads % | 93.72% Average mapped length | 294.60 Number of splices: Total | 13228352 Number of splices: Annotated (sjdb) | 12939830 Number of splices: GT/AG | 12988778 Number of splices: GC/AG | 193492 Number of splices: AT/AC | 7878 Number of splices: Non-canonical | 38204 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378719 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 63684 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 549503 549503 549503 N_multimapping 378719 378719 378719 N_noFeature 546522 13393640 615797 N_ambiguous 282190 1129 92819 UnstrandedReadsAssigned:12822842 PositiveStrandReadsAssigned:256785 NegativeStrandReadsAssigned:12942938 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170688 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170688-trimmed-pair1.fastq SRR7170688-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,566,296 reads, 12,874,544 reads pseudoaligned [quant] estimated average fragment length: 275.976 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7170688.ke.tsv 34699 SRR7170688.se.tsv 87100 total ==> SRR7170688.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.02 729 27.7894 Potri.005G024800.1.v4.1 1035 760.024 199 17.3972 Potri.004G059700.1.v4.1 961 686.119 29 2.80837 Potri.007G009000.2.v4.1 1416 1141.02 0 0 Potri.003G141000.2.v4.1 2943 2668.02 910.813 22.6827 Potri.016G087400.1.v4.1 270 73.353 565 511.783 Potri.015G069301.1.v4.1 564 297.922 0 0 Potri.010G195200.1.v4.1 1773 1498.02 62 2.74997 Potri.012G127500.1.v4.1 977 702.069 177 16.7513 ==> SRR7170688.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1107 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7170688 completed mapping pipeline successfully