Starting /dee2/code/volunteer_pipeline.sh SRR7170689 current disk space = 3088797917184 free memory = 1432693568 SRR7170689 SRAfilesize 8caff219121c8d51744cd1145b89b4e7 SRR7170689.sra SRR7170689.sra file validated SRR7170689 is paired end SRR7170689 is conventional basespace SRR7170689 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170689_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.059 27.0 18.0 32.0 18.0 33.0 2 28.98825 30.0 27.0 33.0 25.0 33.0 3 28.9225 31.0 28.0 33.0 18.0 33.0 4 29.749 31.0 29.0 33.0 25.0 33.0 5 31.78575 33.0 32.0 33.0 30.0 33.0 6 35.9415 37.0 36.0 38.0 33.0 38.0 7 36.7785 38.0 37.0 38.0 34.0 38.0 8 37.1805 38.0 38.0 38.0 36.0 38.0 9 37.34575 38.0 38.0 38.0 37.0 38.0 10-14 37.29545 38.0 38.0 38.0 36.2 38.0 15-19 37.233 38.0 38.0 38.0 36.2 38.0 20-24 37.14875 38.0 38.0 38.0 36.2 38.0 25-29 37.2299 38.0 38.0 38.0 36.6 38.0 30-34 37.263349999999996 38.0 38.0 38.0 36.8 38.0 35-39 37.27105 38.0 38.0 38.0 37.0 38.0 40-44 37.15345 38.0 38.0 38.0 36.2 38.0 45-49 37.1495 38.0 38.0 38.0 36.0 38.0 50-54 37.0147 38.0 38.0 38.0 35.8 38.0 55-59 36.913050000000005 38.0 38.0 38.0 35.6 38.0 60-64 36.8783 38.0 38.0 38.0 35.2 38.0 65-69 36.749750000000006 38.0 38.0 38.0 34.4 38.0 70-74 36.70435 38.0 38.0 38.0 34.4 38.0 75-79 36.4966 38.0 38.0 38.0 34.0 38.0 80-84 36.34845 38.0 37.4 38.0 33.8 38.0 85-89 36.292500000000004 38.0 37.2 38.0 33.6 38.0 90-94 35.91895000000001 38.0 37.0 38.0 31.6 38.0 95-99 35.8594 38.0 36.8 38.0 31.8 38.0 100-104 35.66845000000001 38.0 36.8 38.0 31.0 38.0 105-109 35.60510000000001 38.0 36.2 38.0 30.2 38.0 110-114 35.4544 38.0 36.0 38.0 29.4 38.0 115-119 35.355 38.0 36.0 38.0 29.0 38.0 120-124 34.9353 38.0 35.2 38.0 27.8 38.0 125-129 34.493500000000004 38.0 34.6 38.0 25.2 38.0 130-134 34.3558 38.0 34.6 38.0 24.8 38.0 135-139 33.576100000000004 38.0 33.0 38.0 22.4 38.0 140-144 32.856750000000005 38.0 32.6 38.0 18.0 38.0 145-149 31.606450000000002 38.0 31.2 38.0 10.4 38.0 150-151 25.410249999999998 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 1.0 16 1.0 17 3.0 18 2.0 19 5.0 20 6.0 21 5.0 22 5.0 23 8.0 24 18.0 25 11.0 26 26.0 27 31.0 28 33.0 29 47.0 30 76.0 31 104.0 32 122.0 33 164.0 34 255.0 35 454.0 36 1065.0 37 1554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.36781609195402 15.6478578892372 9.952978056426334 35.03134796238245 2 18.9 26.400000000000002 34.525 20.175 3 17.4 30.45 28.65 23.5 4 22.025 35.825 22.6 19.55 5 20.45 38.75 22.3 18.5 6 15.950000000000001 36.925000000000004 24.05 23.075000000000003 7 12.725 19.175 46.300000000000004 21.8 8 17.0 20.625 28.925 33.45 9 16.75 22.575 30.225 30.45 10-14 19.535 29.404999999999998 26.584999999999997 24.474999999999998 15-19 19.875 28.875 27.400000000000002 23.849999999999998 20-24 19.885 29.12 27.47 23.525 25-29 19.61 28.485 28.21 23.695 30-34 19.63 28.689999999999998 28.21 23.47 35-39 19.36 28.315 27.525 24.8 40-44 19.814999999999998 29.4 27.575 23.21 45-49 19.885 28.54 28.035 23.54 50-54 19.650000000000002 28.715000000000003 27.68 23.955000000000002 55-59 19.735 28.945 27.6 23.72 60-64 19.755 28.12 27.705000000000002 24.42 65-69 19.48 28.78 27.93 23.810000000000002 70-74 19.855 28.9 27.54 23.705000000000002 75-79 20.369999999999997 28.315 27.875 23.44 80-84 20.16 28.505000000000003 27.49 23.845 85-89 20.255000000000003 28.48 27.639999999999997 23.625 90-94 19.939999999999998 28.405 28.050000000000004 23.605 95-99 20.24 28.999999999999996 27.115000000000002 23.645 100-104 20.28 28.155 27.79 23.775 105-109 20.26 27.765 27.894999999999996 24.08 110-114 19.994999999999997 28.494999999999997 28.17 23.34 115-119 20.515 28.67 27.125 23.69 120-124 20.82 28.065 27.85 23.265 125-129 20.755000000000003 28.435 27.139999999999997 23.669999999999998 130-134 20.79 28.49 26.77 23.95 135-139 20.285 28.62 27.534999999999997 23.56 140-144 21.099999999999998 28.1 27.034999999999997 23.765 145-149 20.735 27.68 27.189999999999998 24.395 150-151 20.4875 27.0625 27.575 24.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.5 22 2.0 23 2.5 24 4.0 25 3.0 26 5.0 27 9.0 28 11.0 29 12.5 30 18.5 31 26.5 32 29.5 33 44.5 34 59.5 35 80.0 36 97.0 37 106.5 38 138.0 39 181.0 40 206.0 41 222.0 42 246.0 43 247.5 44 264.0 45 282.5 46 256.0 47 244.0 48 229.0 49 214.0 50 182.5 51 133.5 52 106.5 53 82.5 54 68.5 55 50.5 56 36.0 57 28.5 58 20.0 59 13.5 60 10.0 61 5.0 62 3.5 63 5.0 64 3.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.32720865844450037 0.65 3 0.17618927762396175 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.475 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGGA 10 0.005853838 152.57895 1 GAAGGGA 10 0.0068378756 144.95 4 AAAAAAA 30 0.0014466991 24.158335 60-64 >>END_MODULE SRR7170689 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170689_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43125 33.0 33.0 34.0 31.0 34.0 2 32.511 33.0 33.0 34.0 31.0 34.0 3 32.586 33.0 33.0 34.0 31.0 34.0 4 32.4755 33.0 33.0 34.0 31.0 34.0 5 32.4495 33.0 33.0 34.0 31.0 34.0 6 36.55 38.0 38.0 38.0 34.0 38.0 7 36.7265 38.0 38.0 38.0 35.0 38.0 8 36.568 38.0 38.0 38.0 34.0 38.0 9 36.68975 38.0 38.0 38.0 35.0 38.0 10-14 36.555150000000005 38.0 38.0 38.0 34.0 38.0 15-19 36.55345 38.0 38.0 38.0 34.0 38.0 20-24 36.4807 38.0 38.0 38.0 34.0 38.0 25-29 36.4744 38.0 38.0 38.0 34.0 38.0 30-34 36.45415 38.0 38.0 38.0 34.0 38.0 35-39 36.3351 38.0 38.0 38.0 34.0 38.0 40-44 36.31035 38.0 38.0 38.0 33.8 38.0 45-49 36.187200000000004 38.0 38.0 38.0 32.8 38.0 50-54 36.126599999999996 38.0 38.0 38.0 33.2 38.0 55-59 36.239549999999994 38.0 38.0 38.0 33.4 38.0 60-64 36.0153 38.0 37.8 38.0 32.6 38.0 65-69 36.0932 38.0 38.0 38.0 33.2 38.0 70-74 35.932599999999994 38.0 37.0 38.0 32.2 38.0 75-79 35.8091 38.0 37.0 38.0 31.0 38.0 80-84 35.709450000000004 38.0 37.0 38.0 30.6 38.0 85-89 35.6205 38.0 37.0 38.0 30.4 38.0 90-94 35.38225 38.0 36.6 38.0 29.0 38.0 95-99 35.3418 38.0 36.6 38.0 29.0 38.0 100-104 35.033500000000004 38.0 36.0 38.0 27.8 38.0 105-109 34.8615 38.0 36.0 38.0 26.8 38.0 110-114 34.62115 38.0 35.6 38.0 25.6 38.0 115-119 34.362550000000006 38.0 35.0 38.0 23.8 38.0 120-124 33.91630000000001 38.0 33.8 38.0 22.2 38.0 125-129 33.45655000000001 38.0 33.0 38.0 19.8 38.0 130-134 32.98475 38.0 32.6 38.0 17.4 38.0 135-139 32.38015 38.0 31.6 38.0 14.2 38.0 140-144 31.268 37.0 29.8 38.0 12.4 38.0 145-149 29.707749999999997 36.0 27.8 38.0 3.8 38.0 150-151 24.034 31.5 12.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 1.0 5 2.0 6 3.0 7 2.0 8 0.0 9 3.0 10 3.0 11 4.0 12 5.0 13 3.0 14 3.0 15 5.0 16 8.0 17 7.0 18 9.0 19 9.0 20 12.0 21 17.0 22 19.0 23 22.0 24 23.0 25 33.0 26 44.0 27 42.0 28 55.0 29 61.0 30 71.0 31 97.0 32 130.0 33 195.0 34 239.0 35 391.0 36 817.0 37 1653.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.85 16.875 13.100000000000001 25.174999999999997 2 24.474999999999998 21.65 35.05 18.825 3 20.3 26.825 33.6 19.275000000000002 4 22.95 34.025 22.900000000000002 20.125 5 22.275 36.825 22.15 18.75 6 17.474999999999998 37.9 23.849999999999998 20.775 7 17.175 17.1 45.175 20.549999999999997 8 19.45 22.400000000000002 28.95 29.2 9 21.75 24.275 27.375 26.6 10-14 22.58 28.660000000000004 27.1 21.66 15-19 22.57 28.744999999999997 28.325 20.36 20-24 23.28 28.050000000000004 27.955000000000002 20.715 25-29 22.915 28.175 27.865000000000002 21.044999999999998 30-34 22.685 28.275 28.105000000000004 20.935000000000002 35-39 22.62 28.28 28.435 20.665 40-44 22.805 27.939999999999998 27.994999999999997 21.26 45-49 23.195 28.060000000000002 27.625 21.12 50-54 22.985 28.035 28.000000000000004 20.979999999999997 55-59 23.29 27.71 27.800000000000004 21.2 60-64 23.59 27.785 27.939999999999998 20.685000000000002 65-69 23.419999999999998 27.485 28.155 20.94 70-74 23.36 28.34 27.665 20.635 75-79 23.29 28.17 27.195000000000004 21.345 80-84 23.69 27.860000000000003 27.24 21.21 85-89 23.24 27.55 28.345 20.865000000000002 90-94 22.86 28.28 28.08 20.78 95-99 23.315 27.51 28.02 21.154999999999998 100-104 23.52 27.88 27.98 20.62 105-109 23.26 27.61 28.105000000000004 21.025 110-114 23.169999999999998 28.349999999999998 27.49 20.990000000000002 115-119 23.555 27.55 28.42 20.474999999999998 120-124 23.52 28.425 27.045 21.01 125-129 23.395 28.155 27.73 20.72 130-134 24.39 27.54 27.77 20.3 135-139 24.345 27.925 28.299999999999997 19.43 140-144 24.285 27.555000000000003 28.285 19.875 145-149 24.245 28.375 27.33 20.05 150-151 24.637500000000003 27.35 28.3125 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 2.5 26 6.0 27 7.5 28 9.0 29 15.0 30 15.0 31 19.5 32 27.5 33 41.0 34 51.0 35 54.5 36 78.5 37 106.5 38 133.0 39 161.5 40 183.0 41 209.5 42 251.0 43 283.5 44 287.5 45 283.0 46 268.0 47 250.5 48 226.0 49 194.5 50 169.0 51 130.0 52 107.5 53 104.0 54 84.0 55 61.5 56 50.0 57 36.0 58 25.5 59 20.0 60 11.5 61 7.5 62 7.0 63 4.0 64 2.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16645617580197 98.15 2 0.6819904016165698 1.35 3 0.10103561505430665 0.3 4 0.050517807527153326 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.2125 0.0 0.0 0.0 0.0 134-135 3.475 0.0 0.0 0.0 0.0 136-137 3.8125 0.0 0.0 0.0 0.0 138-139 4.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAATA 10 0.006830828 145.0 2 >>END_MODULE Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022846 spots for SRR7170689.sra Written 1022846 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra Read 1022834 spots for SRR7170689.sra Written 1022834 spots for SRR7170689.sra SRR ids: ['SRR7170689.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mq7mtzec SRR7170689.sra spots: 20456692 blocks: [[1, 1022834], [1022835, 2045668], [2045669, 3068502], [3068503, 4091336], [4091337, 5114170], [5114171, 6137004], [6137005, 7159838], [7159839, 8182672], [8182673, 9205506], [9205507, 10228340], [10228341, 11251174], [11251175, 12274008], [12274009, 13296842], [13296843, 14319676], [14319677, 15342510], [15342511, 16365344], [16365345, 17388178], [17388179, 18411012], [18411013, 19433846], [19433847, 20456692]] SRR7170689 file size 6910401 SRR7170689 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170689 SRR7170689_1.fastq SRR7170689_2.fastq Input file: SRR7170689_1.fastq Paired file: SRR7170689_2.fastq trimmed: SRR7170689-trimmed-pair1.fastq, SRR7170689-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:37:17 2025 >> started Thu Feb 13 16:37:41 2025 >> done (24.597s) 20456692 read pairs processed; of these: 31514 ( 0.15%) short read pairs filtered out after trimming by size control 32542 ( 0.16%) empty read pairs filtered out after trimming by size control 20392636 (99.69%) read pairs available; of these: 12740397 (62.48%) trimmed read pairs available after processing 7652239 (37.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 7 0.00% 21 5 0.00% 22 12 0.00% 23 5 0.00% 24 11 0.00% 25 7 0.00% 26 9 0.00% 27 7 0.00% 28 0 0.00% 29 7 0.00% 30 18 0.00% 31 13 0.00% 32 10 0.00% 33 10 0.00% 34 20 0.00% 35 11 0.00% 36 18 0.00% 37 17 0.00% 38 24 0.00% 39 19 0.00% 40 34 0.00% 41 29 0.00% 42 33 0.00% 43 34 0.00% 44 43 0.00% 45 43 0.00% 46 50 0.00% 47 44 0.00% 48 48 0.00% 49 67 0.00% 50 92 0.00% 51 84 0.00% 52 73 0.00% 53 80 0.00% 54 121 0.00% 55 122 0.00% 56 134 0.00% 57 151 0.00% 58 179 0.00% 59 212 0.00% 60 200 0.00% 61 275 0.00% 62 312 0.00% 63 317 0.00% 64 352 0.00% 65 372 0.00% 66 437 0.00% 67 466 0.00% 68 514 0.00% 69 612 0.00% 70 738 0.00% 71 751 0.00% 72 918 0.00% 73 1033 0.01% 74 1183 0.01% 75 1349 0.01% 76 1493 0.01% 77 1553 0.01% 78 1748 0.01% 79 1973 0.01% 80 2296 0.01% 81 2645 0.01% 82 3039 0.01% 83 3582 0.02% 84 4964 0.02% 85 5923 0.03% 86 6079 0.03% 87 6542 0.03% 88 6684 0.03% 89 6998 0.03% 90 7245 0.04% 91 7891 0.04% 92 8381 0.04% 93 9141 0.04% 94 9534 0.05% 95 10185 0.05% 96 10790 0.05% 97 11097 0.05% 98 11581 0.06% 99 12393 0.06% 100 12786 0.06% 101 13778 0.07% 102 14671 0.07% 103 15642 0.08% 104 16355 0.08% 105 17132 0.08% 106 18274 0.09% 107 18923 0.09% 108 19874 0.10% 109 20630 0.10% 110 21498 0.11% 111 22641 0.11% 112 24316 0.12% 113 25042 0.12% 114 26572 0.13% 115 27728 0.14% 116 29035 0.14% 117 30303 0.15% 118 32330 0.16% 119 33446 0.16% 120 34882 0.17% 121 37307 0.18% 122 39289 0.19% 123 42237 0.21% 124 44461 0.22% 125 47409 0.23% 126 50645 0.25% 127 53748 0.26% 128 57168 0.28% 129 61531 0.30% 130 65489 0.32% 131 70935 0.35% 132 76830 0.38% 133 83994 0.41% 134 91548 0.45% 135 101141 0.50% 136 111436 0.55% 137 123020 0.60% 138 135581 0.66% 139 152381 0.75% 140 171576 0.84% 141 192949 0.95% 142 219077 1.07% 143 253890 1.25% 144 297936 1.46% 145 354177 1.74% 146 450753 2.21% 147 592932 2.91% 148 897522 4.40% 149 1674914 8.21% 150 5547163 27.20% 151 7652239 37.52% 20392636 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.61 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=520.15 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=15 prefix-density=0.80 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=105.32 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170689 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:38:23 Started mapping on | Feb 13 16:38:24 Finished on | Feb 13 16:40:44 Mapping speed, Million of reads per hour | 524.38 Number of input reads | 20392636 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19029493 Uniquely mapped reads % | 93.32% Average mapped length | 293.05 Number of splices: Total | 18840956 Number of splices: Annotated (sjdb) | 18402488 Number of splices: GT/AG | 18481143 Number of splices: GC/AG | 289094 Number of splices: AT/AC | 10601 Number of splices: Non-canonical | 60118 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 525768 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 45969 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.81% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 869363 869363 869363 N_multimapping 525768 525768 525768 N_noFeature 731375 18723198 840907 N_ambiguous 339854 1425 142239 UnstrandedReadsAssigned:17958264 PositiveStrandReadsAssigned:304870 NegativeStrandReadsAssigned:18046347 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170689 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170689-trimmed-pair1.fastq SRR7170689-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,392,636 reads, 17,967,639 reads pseudoaligned [quant] estimated average fragment length: 275.171 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7170689.ke.tsv 34699 SRR7170689.se.tsv 87100 total ==> SRR7170689.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.83 972 29.5235 Potri.005G024800.1.v4.1 1035 760.829 158 10.9996 Potri.004G059700.1.v4.1 961 686.907 21 1.6193 Potri.007G009000.2.v4.1 1416 1141.83 0 0 Potri.003G141000.2.v4.1 2943 2668.83 972.416 19.2991 Potri.016G087400.1.v4.1 270 71.7593 928 684.976 Potri.015G069301.1.v4.1 564 298.692 0 0 Potri.010G195200.1.v4.1 1773 1498.83 20 0.706779 Potri.012G127500.1.v4.1 977 702.863 364 27.4307 ==> SRR7170689.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 934 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 61 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170689 completed mapping pipeline successfully