Starting /dee2/code/volunteer_pipeline.sh SRR7170690 current disk space = 3088718749696 free memory = 1417254680 SRR7170690 SRAfilesize 060c2759352a2f40e75e5e109bd30a1e SRR7170690.sra SRR7170690.sra file validated SRR7170690 is paired end SRR7170690 is conventional basespace SRR7170690 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170690_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.12575 30.0 18.0 33.0 18.0 33.0 2 29.12025 31.0 28.0 33.0 18.0 33.0 3 31.66525 33.0 31.0 33.0 29.0 33.0 4 32.1895 33.0 33.0 33.0 31.0 34.0 5 32.6345 33.0 33.0 34.0 31.0 34.0 6 37.0385 38.0 37.0 38.0 35.0 38.0 7 37.29325 38.0 38.0 38.0 36.0 38.0 8 37.47725 38.0 38.0 38.0 37.0 38.0 9 37.52575 38.0 38.0 38.0 37.0 38.0 10-14 37.50085 38.0 38.0 38.0 37.2 38.0 15-19 37.425700000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.45465 38.0 38.0 38.0 37.6 38.0 25-29 37.51245 38.0 38.0 38.0 38.0 38.0 30-34 37.4415 38.0 38.0 38.0 37.6 38.0 35-39 37.43965 38.0 38.0 38.0 37.0 38.0 40-44 37.387 38.0 38.0 38.0 37.0 38.0 45-49 37.33655 38.0 38.0 38.0 37.0 38.0 50-54 37.2319 38.0 38.0 38.0 36.6 38.0 55-59 37.1085 38.0 38.0 38.0 36.2 38.0 60-64 37.11495000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.08055 38.0 38.0 38.0 36.0 38.0 70-74 36.994150000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.812650000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.705400000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.63705 38.0 38.0 38.0 35.0 38.0 90-94 36.4694 38.0 38.0 38.0 34.0 38.0 95-99 36.40345 38.0 38.0 38.0 34.0 38.0 100-104 36.16655 38.0 37.2 38.0 33.6 38.0 105-109 36.1092 38.0 37.0 38.0 33.4 38.0 110-114 35.81570000000001 38.0 37.0 38.0 32.2 38.0 115-119 35.63445 38.0 36.6 38.0 31.0 38.0 120-124 35.440749999999994 38.0 36.0 38.0 30.8 38.0 125-129 35.27055 38.0 36.0 38.0 30.0 38.0 130-134 34.9736 38.0 35.6 38.0 27.8 38.0 135-139 34.75765 38.0 35.0 38.0 27.8 38.0 140-144 34.1283 38.0 34.6 38.0 24.0 38.0 145-149 33.27065 38.0 33.2 38.0 20.2 38.0 150-151 28.57625 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 1.0 15 4.0 16 3.0 17 2.0 18 4.0 19 12.0 20 4.0 21 4.0 22 8.0 23 5.0 24 7.0 25 6.0 26 18.0 27 17.0 28 15.0 29 30.0 30 46.0 31 57.0 32 71.0 33 119.0 34 172.0 35 322.0 36 879.0 37 2188.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.367372989532804 18.76436047995915 13.964768955833545 33.903497574674496 2 17.325 28.075 37.375 17.224999999999998 3 16.025 32.4 28.1 23.474999999999998 4 19.825 37.05 22.650000000000002 20.474999999999998 5 18.692057128539215 37.81007266349286 24.32974191931847 19.16812828864946 6 16.400000000000002 36.199999999999996 25.674999999999997 21.725 7 12.15 19.75 47.325 20.775 8 17.724999999999998 21.15 28.050000000000004 33.074999999999996 9 16.6 22.325 32.074999999999996 28.999999999999996 10-14 18.89 30.85 26.165 24.095 15-19 18.945 29.53 27.82 23.705000000000002 20-24 19.13 30.165 27.310000000000002 23.395 25-29 18.68 29.585 27.725 24.01 30-34 18.805 29.345 28.015 23.835 35-39 19.61 29.73 27.345000000000002 23.315 40-44 19.355 30.04 27.16 23.445 45-49 19.555 29.275000000000002 27.284999999999997 23.885 50-54 19.325 29.38 27.315 23.98 55-59 19.28 29.335 27.49 23.895 60-64 19.55 28.754999999999995 27.715 23.98 65-69 19.235 29.125 27.389999999999997 24.25 70-74 19.15 29.695 27.49 23.665 75-79 19.36 28.945 27.91 23.785 80-84 19.11 29.439999999999998 27.395000000000003 24.055 85-89 19.97 28.62 27.83 23.580000000000002 90-94 20.215 28.78 27.32 23.685000000000002 95-99 19.705000000000002 28.835 27.389999999999997 24.07 100-104 20.630000000000003 28.455000000000002 27.05 23.865 105-109 19.985 28.249999999999996 27.400000000000002 24.365000000000002 110-114 20.305 28.59 26.825 24.279999999999998 115-119 20.445 28.744999999999997 26.995 23.815 120-124 20.49 29.060000000000002 26.495 23.955000000000002 125-129 20.565 28.444999999999997 27.0 23.990000000000002 130-134 19.835 28.405 27.22 24.54 135-139 20.3 28.549999999999997 26.900000000000002 24.25 140-144 20.175 28.749999999999996 26.950000000000003 24.125 145-149 19.900000000000002 28.735 26.740000000000002 24.625 150-151 19.977497187148394 28.59107388423553 26.903362920365048 24.52806600825103 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 2.5 20 2.0 21 2.0 22 3.0 23 4.5 24 6.5 25 5.5 26 6.5 27 15.0 28 23.5 29 28.0 30 33.0 31 44.0 32 62.5 33 68.0 34 88.5 35 121.0 36 117.5 37 130.5 38 168.5 39 175.0 40 177.0 41 206.5 42 225.0 43 219.5 44 219.5 45 221.0 46 212.5 47 212.0 48 195.0 49 184.0 50 160.0 51 131.5 52 120.0 53 87.0 54 74.0 55 73.5 56 51.5 57 29.5 58 25.0 59 21.5 60 18.0 61 11.0 62 4.5 63 3.0 64 2.0 65 0.5 66 1.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00889453621346 97.39999999999999 2 0.7623888182973316 1.5 3 0.12706480304955528 0.375 4 0.025412960609911054 0.1 5 0.025412960609911054 0.125 6 0.025412960609911054 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025412960609911054 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 13 (97% over 38bp) CCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCA 6 0.15 No Hit GTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.5875 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.7125000000000004 0.0 0.0 0.0 0.0 120-121 4.2 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.45 0.0 0.0 0.0 0.0 134-135 7.1 0.0 0.0 0.0 0.0 136-137 7.6 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAACC 10 0.0068343505 144.975 2 >>END_MODULE SRR7170690 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170690_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6675 33.0 33.0 34.0 32.0 34.0 2 32.88625 33.0 33.0 34.0 32.0 34.0 3 32.84025 34.0 33.0 34.0 32.0 34.0 4 32.848 34.0 33.0 34.0 32.0 34.0 5 32.88175 33.0 33.0 34.0 32.0 34.0 6 37.0365 38.0 38.0 38.0 36.0 38.0 7 37.13325 38.0 38.0 38.0 37.0 38.0 8 37.0405 38.0 38.0 38.0 36.0 38.0 9 37.12475 38.0 38.0 38.0 37.0 38.0 10-14 37.08175000000001 38.0 38.0 38.0 36.2 38.0 15-19 37.1017 38.0 38.0 38.0 36.4 38.0 20-24 37.047700000000006 38.0 38.0 38.0 36.4 38.0 25-29 37.0065 38.0 38.0 38.0 36.2 38.0 30-34 37.0359 38.0 38.0 38.0 36.4 38.0 35-39 37.0384 38.0 38.0 38.0 36.2 38.0 40-44 36.980599999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.93555 38.0 38.0 38.0 36.0 38.0 50-54 36.8484 38.0 38.0 38.0 36.0 38.0 55-59 36.725049999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.798899999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.78185 38.0 38.0 38.0 35.6 38.0 70-74 36.67555 38.0 38.0 38.0 35.2 38.0 75-79 36.64425 38.0 38.0 38.0 34.8 38.0 80-84 36.46554999999999 38.0 38.0 38.0 34.4 38.0 85-89 36.4096 38.0 38.0 38.0 34.0 38.0 90-94 36.3195 38.0 38.0 38.0 34.0 38.0 95-99 36.09 38.0 38.0 38.0 33.4 38.0 100-104 36.03259999999999 38.0 37.6 38.0 33.4 38.0 105-109 35.9034 38.0 37.4 38.0 33.0 38.0 110-114 35.65599999999999 38.0 37.2 38.0 31.4 38.0 115-119 35.27345 38.0 36.4 38.0 29.4 38.0 120-124 35.29625 38.0 36.4 38.0 30.0 38.0 125-129 34.90495 38.0 36.0 38.0 28.4 38.0 130-134 34.502500000000005 38.0 35.2 38.0 26.2 38.0 135-139 34.1679 38.0 33.8 38.0 24.8 38.0 140-144 33.527 38.0 33.0 38.0 21.2 38.0 145-149 32.40735 38.0 33.0 38.0 11.2 38.0 150-151 26.612499999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 4.0 12 1.0 13 3.0 14 7.0 15 2.0 16 7.0 17 7.0 18 12.0 19 5.0 20 14.0 21 10.0 22 7.0 23 7.0 24 15.0 25 20.0 26 26.0 27 19.0 28 46.0 29 43.0 30 46.0 31 48.0 32 84.0 33 106.0 34 167.0 35 270.0 36 668.0 37 2348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.1 14.85 15.75 32.300000000000004 2 24.8 23.674999999999997 35.675000000000004 15.85 3 20.25 26.724999999999998 32.425 20.599999999999998 4 22.7 35.8 21.45 20.05 5 22.85 38.1 21.45 17.599999999999998 6 17.546933667083856 37.74718397997497 24.93116395494368 19.774718397997496 7 15.982991495747875 15.182591295647823 46.048024012006 22.786393196598297 8 20.926157697121404 21.60200250312891 27.909887359198997 29.561952440550687 9 22.836418209104554 23.936968484242122 28.339169584792394 24.88744372186093 10-14 23.684210526315788 28.752251350810486 25.720432259355615 21.84310586351811 15-19 23.003051067873756 28.264892712449356 27.80473165607963 20.927324563597256 20-24 23.400530238607374 28.85298384272923 27.332299534790653 20.414186383872742 25-29 23.05537491871342 28.207693462057925 27.7124706117753 21.024461007453354 30-34 23.448206872405343 28.665032761466513 27.809733406692345 20.077026959435802 35-39 23.87648883995596 27.669902912621357 27.790011009908916 20.663597237513763 40-44 23.47434292866083 27.709637046307883 27.774718397997493 21.041301627033793 45-49 23.706853426713355 27.86893446723362 27.688844422211105 20.735367683841922 50-54 23.091927578273484 27.673301990597178 28.423527058117436 20.811243373011905 55-59 23.596236612951657 27.664898408567712 28.000200180162143 20.73866479831849 60-64 23.484090454272565 27.516509905943565 28.47708625175105 20.52231338803282 65-69 23.283149102185767 27.619666883409195 28.6600310108538 20.43715300355124 70-74 23.66855028254238 28.124218632794918 27.589138370755613 20.618092713907085 75-79 23.734493797519008 27.921168467386952 28.26130452180872 20.083033213285315 80-84 23.645911477869465 27.616904226056516 28.132033008252062 20.605151287821954 85-89 24.53358675536438 27.59465813034562 27.36957935277347 20.50217576151653 90-94 24.02360354053108 28.114217132569884 27.684152622893432 20.1780267040056 95-99 24.325 28.345 27.445000000000004 19.885 100-104 24.636231811590577 27.966398319915996 27.476373818690934 19.92099604980249 105-109 24.246061515378845 27.826956739184794 27.956989247311824 19.96999249812453 110-114 24.34813072418798 28.206796456633803 27.731344777538663 19.71372804163956 115-119 24.145865639537792 27.73748186684008 28.197688960032014 19.918963533590116 120-124 24.798719807971196 27.53413011951793 27.57913687053058 20.0880132019803 125-129 25.01500300060012 27.89057811562313 27.530506101220244 19.56391278255651 130-134 24.863729559433914 27.30409561434215 27.754163124468672 20.078011701755262 135-139 25.36529223378703 27.987389911929544 27.216773418734984 19.430544435548438 140-144 25.477930137123412 28.210389350415372 27.48473626263637 18.82694424982484 145-149 26.009999999999998 27.955000000000002 26.665 19.37 150-151 25.2625 28.4 27.575 18.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 1.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 5.0 27 8.0 28 13.0 29 18.0 30 18.0 31 16.5 32 28.5 33 41.5 34 49.0 35 72.0 36 89.5 37 98.0 38 129.0 39 159.5 40 189.0 41 212.0 42 227.0 43 252.0 44 266.5 45 257.5 46 246.0 47 249.0 48 241.5 49 213.5 50 170.5 51 147.0 52 129.5 53 106.5 54 87.5 55 67.0 56 51.0 57 36.5 58 24.0 59 19.5 60 17.0 61 10.5 62 7.0 63 4.0 64 1.5 65 1.5 66 1.0 67 0.0 68 1.0 69 1.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.05 8 0.125 9 0.05 10-14 0.06 15-19 0.034999999999999996 20-24 0.045 25-29 0.045 30-34 0.034999999999999996 35-39 0.09 40-44 0.125 45-49 0.05 50-54 0.03 55-59 0.09 60-64 0.06 65-69 0.034999999999999996 70-74 0.015 75-79 0.04 80-84 0.025 85-89 0.034999999999999996 90-94 0.015 95-99 0.0 100-104 0.005 105-109 0.025 110-114 0.095 115-119 0.045 120-124 0.015 125-129 0.02 130-134 0.015 135-139 0.08 140-144 0.09 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11144960649911 97.6 2 0.6600660066006601 1.3 3 0.10154861640010156 0.3 4 0.07616146230007616 0.3 5 0.0 0.0 6 0.02538715410002539 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02538715410002539 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 14 0.35000000000000003 Illumina Single End PCR Primer 1 (96% over 32bp) CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.6124999999999998 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.6375 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.4125 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.225 0.0 0.0 0.0 0.0 128-129 5.487500000000001 0.0 0.0 0.0 0.0 130-131 5.9125 0.0 0.0 0.0 0.0 132-133 6.325 0.0 0.0 0.0 0.0 134-135 6.987500000000001 0.0 0.0 0.0 0.0 136-137 7.475 0.0 0.0 0.0 0.0 138-139 7.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCATG 10 0.006830828 145.0 2 TAGTTCA 10 0.006830828 145.0 9 GCCACTT 10 0.006830828 145.0 7 GTCTACA 10 0.006830828 145.0 1 TTAGTTC 10 0.006830828 145.0 8 ATCAATC 20 0.00593511 29.0 30-34 >>END_MODULE Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796435 spots for SRR7170690.sra Written 796435 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra Read 796417 spots for SRR7170690.sra Written 796417 spots for SRR7170690.sra SRR ids: ['SRR7170690.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a7yznhbw SRR7170690.sra spots: 15928358 blocks: [[1, 796417], [796418, 1592834], [1592835, 2389251], [2389252, 3185668], [3185669, 3982085], [3982086, 4778502], [4778503, 5574919], [5574920, 6371336], [6371337, 7167753], [7167754, 7964170], [7964171, 8760587], [8760588, 9557004], [9557005, 10353421], [10353422, 11149838], [11149839, 11946255], [11946256, 12742672], [12742673, 13539089], [13539090, 14335506], [14335507, 15131923], [15131924, 15928358]] SRR7170690 file size 5375897 SRR7170690 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170690 SRR7170690_1.fastq SRR7170690_2.fastq Input file: SRR7170690_1.fastq Paired file: SRR7170690_2.fastq trimmed: SRR7170690-trimmed-pair1.fastq, SRR7170690-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:28:00 2025 >> started Thu Feb 13 16:28:27 2025 >> done (27.330s) 15928358 read pairs processed; of these: 10421 ( 0.07%) short read pairs filtered out after trimming by size control 79618 ( 0.50%) empty read pairs filtered out after trimming by size control 15838319 (99.43%) read pairs available; of these: 8322408 (52.55%) trimmed read pairs available after processing 7515911 (47.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 3 0.00% 21 4 0.00% 22 7 0.00% 23 2 0.00% 24 6 0.00% 25 8 0.00% 26 4 0.00% 27 13 0.00% 28 11 0.00% 29 10 0.00% 30 14 0.00% 31 42 0.00% 32 12 0.00% 33 13 0.00% 34 18 0.00% 35 12 0.00% 36 21 0.00% 37 25 0.00% 38 28 0.00% 39 38 0.00% 40 40 0.00% 41 53 0.00% 42 42 0.00% 43 53 0.00% 44 60 0.00% 45 71 0.00% 46 80 0.00% 47 97 0.00% 48 128 0.00% 49 134 0.00% 50 169 0.00% 51 174 0.00% 52 198 0.00% 53 185 0.00% 54 233 0.00% 55 217 0.00% 56 247 0.00% 57 291 0.00% 58 325 0.00% 59 390 0.00% 60 452 0.00% 61 510 0.00% 62 561 0.00% 63 573 0.00% 64 664 0.00% 65 750 0.00% 66 728 0.00% 67 814 0.01% 68 975 0.01% 69 1138 0.01% 70 1133 0.01% 71 1448 0.01% 72 1680 0.01% 73 1866 0.01% 74 2088 0.01% 75 2297 0.01% 76 2951 0.02% 77 3511 0.02% 78 3114 0.02% 79 3393 0.02% 80 3512 0.02% 81 3951 0.02% 82 4522 0.03% 83 5315 0.03% 84 6342 0.04% 85 7027 0.04% 86 7336 0.05% 87 7571 0.05% 88 8084 0.05% 89 8549 0.05% 90 9322 0.06% 91 10079 0.06% 92 10901 0.07% 93 11933 0.08% 94 12400 0.08% 95 13299 0.08% 96 14037 0.09% 97 14228 0.09% 98 14865 0.09% 99 15396 0.10% 100 16555 0.10% 101 17077 0.11% 102 18221 0.12% 103 19425 0.12% 104 20426 0.13% 105 21552 0.14% 106 22278 0.14% 107 22599 0.14% 108 23210 0.15% 109 24062 0.15% 110 24368 0.15% 111 25534 0.16% 112 27234 0.17% 113 28728 0.18% 114 29826 0.19% 115 30142 0.19% 116 31308 0.20% 117 31911 0.20% 118 32104 0.20% 119 32551 0.21% 120 33960 0.21% 121 34937 0.22% 122 36228 0.23% 123 38192 0.24% 124 39644 0.25% 125 40896 0.26% 126 42106 0.27% 127 43444 0.27% 128 44774 0.28% 129 46367 0.29% 130 47910 0.30% 131 49997 0.32% 132 51603 0.33% 133 54829 0.35% 134 57885 0.37% 135 61317 0.39% 136 65325 0.41% 137 69521 0.44% 138 73516 0.46% 139 79599 0.50% 140 86677 0.55% 141 95931 0.61% 142 108226 0.68% 143 122094 0.77% 144 140153 0.88% 145 171734 1.08% 146 216610 1.37% 147 303788 1.92% 148 451449 2.85% 149 868403 5.48% 150 4023379 25.40% 151 7515911 47.45% 15838319 reads passed initial QC criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=1.11 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=75.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCTACCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGCTTCGGGATCGTCAGCCAAGCCCAGTGGGTCGAAGCTTCCACCTGGGTAGATTGGGTCAGTTACCTCACCGAGTGGCCCGCCAGCAATTCTGTAACCCTCAACGGCACCCATCAAGACCACCTGTGTAGCCCAGATGGCCAAGATGCTTTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCTCGCTGAAGATCTGGGCTCCAGCCTT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=14 prefix-density=0.54 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.23 sequence-density-rank=18 fanout-score=12.23 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=4.8 sequence=AGCAATGGCAGCA SRR7170690 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:29:24 Started mapping on | Feb 13 16:29:24 Finished on | Feb 13 16:32:16 Mapping speed, Million of reads per hour | 331.50 Number of input reads | 15838319 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14697617 Uniquely mapped reads % | 92.80% Average mapped length | 292.77 Number of splices: Total | 13578708 Number of splices: Annotated (sjdb) | 13263230 Number of splices: GT/AG | 13323605 Number of splices: GC/AG | 196008 Number of splices: AT/AC | 10716 Number of splices: Non-canonical | 48379 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462229 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 39036 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 689333 689333 689333 N_multimapping 462229 462229 462229 N_noFeature 452776 14338760 528645 N_ambiguous 401712 1122 118221 UnstrandedReadsAssigned:13843129 PositiveStrandReadsAssigned:357735 NegativeStrandReadsAssigned:14050751 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170690 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170690-trimmed-pair1.fastq SRR7170690-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,838,319 reads, 13,926,581 reads pseudoaligned [quant] estimated average fragment length: 243.847 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7170690.ke.tsv 34699 SRR7170690.se.tsv 87100 total ==> SRR7170690.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.15 733 20.7416 Potri.005G024800.1.v4.1 1035 792.153 805 51.0459 Potri.004G059700.1.v4.1 961 718.173 11 0.769373 Potri.007G009000.2.v4.1 1416 1173.15 0 0 Potri.003G141000.2.v4.1 2943 2700.15 676 12.5757 Potri.016G087400.1.v4.1 270 81.0383 1299 805.179 Potri.015G069301.1.v4.1 564 325.413 0 0 Potri.010G195200.1.v4.1 1773 1530.15 278.941 9.15696 Potri.012G127500.1.v4.1 977 734.158 149 10.1946 ==> SRR7170690.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 723 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 488 Potri.001G212900.v4.1 37 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7170690 completed mapping pipeline successfully