Starting /dee2/code/volunteer_pipeline.sh SRR7170691 current disk space = 3088845336576 free memory = 1453462204 SRR7170691 SRAfilesize 8458696dd38591c999fb2a3e0dd7df96 SRR7170691.sra SRR7170691.sra file validated SRR7170691 is paired end SRR7170691 is conventional basespace SRR7170691 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170691_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.5775 31.0 18.0 33.0 18.0 33.0 2 30.35975 31.0 29.0 33.0 27.0 33.0 3 31.6925 33.0 31.0 33.0 29.0 33.0 4 32.2405 33.0 33.0 33.0 30.0 34.0 5 32.85775 33.0 33.0 34.0 32.0 34.0 6 36.9525 38.0 37.0 38.0 35.0 38.0 7 37.33525 38.0 38.0 38.0 37.0 38.0 8 37.51575 38.0 38.0 38.0 37.0 38.0 9 37.5555 38.0 38.0 38.0 38.0 38.0 10-14 37.53425 38.0 38.0 38.0 38.0 38.0 15-19 37.54285 38.0 38.0 38.0 38.0 38.0 20-24 37.562599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.57675 38.0 38.0 38.0 38.0 38.0 30-34 37.55585 38.0 38.0 38.0 38.0 38.0 35-39 37.5438 38.0 38.0 38.0 38.0 38.0 40-44 37.515699999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.46915 38.0 38.0 38.0 37.6 38.0 50-54 37.40185 38.0 38.0 38.0 37.0 38.0 55-59 37.31885 38.0 38.0 38.0 37.0 38.0 60-64 37.2729 38.0 38.0 38.0 36.8 38.0 65-69 37.24055 38.0 38.0 38.0 36.8 38.0 70-74 37.1717 38.0 38.0 38.0 36.2 38.0 75-79 37.030899999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.0433 38.0 38.0 38.0 36.0 38.0 85-89 36.893899999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.82895 38.0 38.0 38.0 35.0 38.0 95-99 36.645250000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.5184 38.0 38.0 38.0 34.0 38.0 105-109 36.4565 38.0 38.0 38.0 34.0 38.0 110-114 36.346349999999994 38.0 37.8 38.0 34.0 38.0 115-119 36.01035 38.0 37.0 38.0 33.0 38.0 120-124 35.789550000000006 38.0 36.8 38.0 31.4 38.0 125-129 35.6577 38.0 36.2 38.0 31.4 38.0 130-134 35.39765 38.0 36.0 38.0 30.2 38.0 135-139 35.12259999999999 38.0 35.6 38.0 29.8 38.0 140-144 34.74705 38.0 34.8 38.0 27.6 38.0 145-149 33.97255 38.0 33.0 38.0 25.2 38.0 150-151 29.255249999999997 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 2.0 19 1.0 20 3.0 21 3.0 22 5.0 23 6.0 24 8.0 25 8.0 26 8.0 27 15.0 28 20.0 29 27.0 30 35.0 31 49.0 32 63.0 33 97.0 34 162.0 35 289.0 36 783.0 37 2410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.557019766852505 19.51343132285859 12.899138367967561 30.03041054232134 2 19.2 24.675 37.7 18.425 3 15.950000000000001 31.574999999999996 28.799999999999997 23.674999999999997 4 20.4 37.3 22.225 20.075000000000003 5 19.72925545249436 37.97944346954124 23.43945851090499 18.851842567059414 6 16.975 36.175000000000004 25.324999999999996 21.525 7 13.275 20.3 46.050000000000004 20.375 8 17.925 20.7 27.55 33.825 9 15.85 24.2 29.175 30.775000000000002 10-14 19.634999999999998 29.79 26.405 24.169999999999998 15-19 18.975 28.845 27.834999999999997 24.345 20-24 18.775 29.42 27.560000000000002 24.245 25-29 19.715 28.794999999999998 27.91 23.580000000000002 30-34 19.355 29.134999999999998 27.755000000000003 23.755000000000003 35-39 19.505 28.71 27.744999999999997 24.04 40-44 19.71 28.79 27.655 23.845 45-49 19.8 28.7 27.74 23.76 50-54 19.515 29.48 27.675 23.330000000000002 55-59 19.78 29.044999999999998 27.82 23.355 60-64 20.05 29.15 27.145000000000003 23.655 65-69 19.835 28.599999999999998 27.49 24.075 70-74 19.81 28.84 28.01 23.34 75-79 20.34 28.57 27.33 23.76 80-84 19.86 28.77 27.41 23.96 85-89 20.305 28.58 27.49 23.625 90-94 20.115 28.76 28.115000000000002 23.01 95-99 20.025000000000002 28.59 27.68 23.705000000000002 100-104 20.0 28.735 27.41 23.855 105-109 20.145 28.585 27.48 23.79 110-114 20.385 28.425 27.750000000000004 23.44 115-119 20.205000000000002 28.04 28.275 23.48 120-124 20.86 28.53 27.400000000000002 23.21 125-129 21.255 28.555000000000003 26.87 23.32 130-134 20.36 28.87 26.924999999999997 23.845 135-139 20.845 28.265 27.26 23.630000000000003 140-144 20.95 28.21 26.900000000000002 23.94 145-149 20.375 28.465 26.915 24.245 150-151 21.30799049643616 28.410653995248218 26.597474052769787 23.68388145554583 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 3.5 24 7.0 25 6.5 26 7.0 27 9.5 28 8.0 29 11.5 30 30.0 31 36.5 32 40.5 33 61.5 34 74.5 35 89.0 36 107.5 37 125.5 38 146.5 39 174.5 40 209.5 41 214.5 42 227.5 43 227.5 44 240.5 45 257.0 46 246.0 47 243.0 48 222.5 49 197.0 50 163.0 51 139.0 52 111.0 53 83.5 54 66.0 55 51.0 56 40.5 57 33.5 58 26.0 59 20.0 60 14.5 61 7.0 62 4.5 63 2.0 64 3.0 65 4.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.025 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.4625000000000004 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCCAT 10 0.006830828 145.0 5 CATCAGC 10 0.006830828 145.0 9 GTTTAAA 10 0.006830828 145.0 1 AAAACCT 10 0.006830828 145.0 1 CTGTCCA 10 0.006830828 145.0 4 >>END_MODULE SRR7170691 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170691_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81925 33.0 33.0 34.0 32.0 34.0 2 32.96125 33.0 33.0 34.0 32.0 34.0 3 32.97225 34.0 33.0 34.0 32.0 34.0 4 32.9115 34.0 33.0 34.0 32.0 34.0 5 32.9425 34.0 33.0 34.0 32.0 34.0 6 37.0445 38.0 38.0 38.0 36.0 38.0 7 37.15875 38.0 38.0 38.0 37.0 38.0 8 37.136 38.0 38.0 38.0 37.0 38.0 9 37.16825 38.0 38.0 38.0 37.0 38.0 10-14 37.0912 38.0 38.0 38.0 37.0 38.0 15-19 37.1188 38.0 38.0 38.0 37.0 38.0 20-24 37.07635 38.0 38.0 38.0 37.0 38.0 25-29 37.03225 38.0 38.0 38.0 36.6 38.0 30-34 36.969100000000005 38.0 38.0 38.0 36.4 38.0 35-39 36.99499999999999 38.0 38.0 38.0 36.6 38.0 40-44 36.9901 38.0 38.0 38.0 36.8 38.0 45-49 36.98845 38.0 38.0 38.0 36.2 38.0 50-54 36.94535 38.0 38.0 38.0 36.0 38.0 55-59 36.84695000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.847449999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.8015 38.0 38.0 38.0 35.8 38.0 70-74 36.6969 38.0 38.0 38.0 35.2 38.0 75-79 36.70315 38.0 38.0 38.0 35.2 38.0 80-84 36.59635000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.4654 38.0 38.0 38.0 34.6 38.0 90-94 36.3501 38.0 38.0 38.0 34.0 38.0 95-99 36.29855 38.0 38.0 38.0 34.0 38.0 100-104 36.1509 38.0 38.0 38.0 33.8 38.0 105-109 36.0601 38.0 38.0 38.0 34.0 38.0 110-114 35.94315 38.0 37.6 38.0 33.4 38.0 115-119 35.6262 38.0 37.0 38.0 31.4 38.0 120-124 35.55775 38.0 36.8 38.0 31.2 38.0 125-129 35.2868 38.0 36.0 38.0 30.6 38.0 130-134 34.88935 38.0 36.0 38.0 28.6 38.0 135-139 34.4489 38.0 34.2 38.0 26.8 38.0 140-144 33.99735 38.0 33.4 38.0 24.8 38.0 145-149 33.23004999999999 38.0 33.0 38.0 19.8 38.0 150-151 28.224249999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 3.0 5 2.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 5.0 15 8.0 16 7.0 17 4.0 18 4.0 19 6.0 20 5.0 21 6.0 22 7.0 23 11.0 24 12.0 25 15.0 26 12.0 27 15.0 28 29.0 29 33.0 30 51.0 31 47.0 32 76.0 33 101.0 34 134.0 35 255.0 36 660.0 37 2473.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.725 15.875 15.575 28.825 2 23.95 23.549999999999997 35.375 17.125 3 20.4 27.500000000000004 31.825 20.275000000000002 4 24.45 35.55 21.275 18.725 5 23.425 37.225 21.625 17.724999999999998 6 18.15 37.05 24.325 20.474999999999998 7 16.675 16.125 45.625 21.575 8 20.925 22.025 26.875 30.175 9 21.325 25.25 27.875 25.55 10-14 22.93 28.139999999999997 26.955000000000002 21.975 15-19 22.900000000000002 27.54 28.535 21.025 20-24 22.78 27.71 28.465 21.044999999999998 25-29 22.84 28.04 27.77 21.349999999999998 30-34 23.32 27.894999999999996 27.61 21.175 35-39 23.095 27.529999999999998 28.33 21.044999999999998 40-44 23.04 27.495000000000005 28.405 21.060000000000002 45-49 23.34 27.700000000000003 27.634999999999998 21.325 50-54 23.52 27.485 27.97 21.025 55-59 23.03 27.925 27.72 21.325 60-64 23.599999999999998 27.855 27.584999999999997 20.96 65-69 23.244999999999997 27.97 27.6 21.185000000000002 70-74 23.425 27.794999999999998 28.26 20.52 75-79 23.9 27.175 27.935 20.990000000000002 80-84 23.235 27.85 27.925 20.990000000000002 85-89 23.74 27.334999999999997 28.315 20.61 90-94 23.599999999999998 27.589999999999996 27.915 20.895 95-99 22.845 27.62 28.355000000000004 21.18 100-104 23.385 27.544999999999998 28.02 21.05 105-109 23.355 28.155 27.38 21.11 110-114 23.69 28.065 27.810000000000002 20.435 115-119 23.595 28.355000000000004 27.43 20.62 120-124 24.099999999999998 27.705000000000002 28.185 20.01 125-129 24.5 27.389999999999997 27.794999999999998 20.315 130-134 24.11 27.96 27.725 20.205000000000002 135-139 24.445 27.665 27.985 19.905 140-144 24.985 27.43 27.555000000000003 20.03 145-149 24.8 27.705000000000002 27.76 19.735 150-151 24.74059257407176 28.028503562945367 27.753469183647955 19.47743467933492 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.5 22 1.0 23 0.5 24 1.5 25 1.5 26 4.5 27 7.5 28 7.0 29 9.5 30 17.5 31 24.5 32 25.5 33 40.5 34 55.0 35 58.0 36 79.0 37 116.0 38 138.0 39 148.0 40 183.0 41 214.5 42 228.5 43 239.0 44 263.0 45 269.0 46 257.0 47 254.5 48 238.5 49 220.5 50 184.5 51 139.0 52 119.5 53 100.0 54 80.5 55 71.5 56 60.0 57 47.5 58 29.0 59 18.5 60 11.5 61 7.5 62 7.0 63 5.0 64 4.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.757002271006813 1.5 3 0.05046681806712087 0.15 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 2.025 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.1624999999999996 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.75 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605143 spots for SRR7170691.sra Written 605143 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra Read 605138 spots for SRR7170691.sra Written 605138 spots for SRR7170691.sra SRR ids: ['SRR7170691.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vwavyzu9 SRR7170691.sra spots: 12102765 blocks: [[1, 605138], [605139, 1210276], [1210277, 1815414], [1815415, 2420552], [2420553, 3025690], [3025691, 3630828], [3630829, 4235966], [4235967, 4841104], [4841105, 5446242], [5446243, 6051380], [6051381, 6656518], [6656519, 7261656], [7261657, 7866794], [7866795, 8471932], [8471933, 9077070], [9077071, 9682208], [9682209, 10287346], [10287347, 10892484], [10892485, 11497622], [11497623, 12102765]] SRR7170691 file size 4079529 SRR7170691 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170691 SRR7170691_1.fastq SRR7170691_2.fastq Input file: SRR7170691_1.fastq Paired file: SRR7170691_2.fastq trimmed: SRR7170691-trimmed-pair1.fastq, SRR7170691-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:47:33 2025 >> started Thu Feb 13 16:47:47 2025 >> done (13.764s) 12102765 read pairs processed; of these: 10588 ( 0.09%) short read pairs filtered out after trimming by size control 15681 ( 0.13%) empty read pairs filtered out after trimming by size control 12076496 (99.78%) read pairs available; of these: 5924217 (49.06%) trimmed read pairs available after processing 6152279 (50.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 6 0.00% 21 6 0.00% 22 5 0.00% 23 7 0.00% 24 9 0.00% 25 4 0.00% 26 6 0.00% 27 4 0.00% 28 6 0.00% 29 9 0.00% 30 6 0.00% 31 8 0.00% 32 9 0.00% 33 11 0.00% 34 8 0.00% 35 7 0.00% 36 7 0.00% 37 9 0.00% 38 17 0.00% 39 18 0.00% 40 8 0.00% 41 13 0.00% 42 10 0.00% 43 14 0.00% 44 16 0.00% 45 23 0.00% 46 29 0.00% 47 34 0.00% 48 28 0.00% 49 29 0.00% 50 57 0.00% 51 54 0.00% 52 64 0.00% 53 57 0.00% 54 49 0.00% 55 72 0.00% 56 62 0.00% 57 72 0.00% 58 104 0.00% 59 98 0.00% 60 120 0.00% 61 143 0.00% 62 172 0.00% 63 204 0.00% 64 214 0.00% 65 234 0.00% 66 257 0.00% 67 257 0.00% 68 304 0.00% 69 342 0.00% 70 441 0.00% 71 548 0.00% 72 601 0.00% 73 687 0.01% 74 768 0.01% 75 861 0.01% 76 949 0.01% 77 998 0.01% 78 1127 0.01% 79 1214 0.01% 80 1376 0.01% 81 1606 0.01% 82 1841 0.02% 83 2191 0.02% 84 2967 0.02% 85 3292 0.03% 86 3556 0.03% 87 3792 0.03% 88 3969 0.03% 89 4130 0.03% 90 4429 0.04% 91 4864 0.04% 92 5196 0.04% 93 5706 0.05% 94 6090 0.05% 95 6414 0.05% 96 6637 0.05% 97 6938 0.06% 98 7218 0.06% 99 7567 0.06% 100 8131 0.07% 101 8432 0.07% 102 9077 0.08% 103 9818 0.08% 104 10305 0.09% 105 10731 0.09% 106 11240 0.09% 107 11659 0.10% 108 11980 0.10% 109 12239 0.10% 110 12647 0.10% 111 13615 0.11% 112 14340 0.12% 113 15075 0.12% 114 15871 0.13% 115 16318 0.14% 116 16858 0.14% 117 17079 0.14% 118 17454 0.14% 119 18228 0.15% 120 18888 0.16% 121 19346 0.16% 122 20026 0.17% 123 21540 0.18% 124 22574 0.19% 125 23490 0.19% 126 24363 0.20% 127 25086 0.21% 128 25991 0.22% 129 27253 0.23% 130 28266 0.23% 131 29644 0.25% 132 31399 0.26% 133 33047 0.27% 134 35751 0.30% 135 38173 0.32% 136 40694 0.34% 137 43837 0.36% 138 47244 0.39% 139 51448 0.43% 140 56370 0.47% 141 63327 0.52% 142 71022 0.59% 143 83478 0.69% 144 98172 0.81% 145 119080 0.99% 146 150814 1.25% 147 206558 1.71% 148 322641 2.67% 149 650794 5.39% 150 3131517 25.93% 151 6152279 50.94% 12076496 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.64 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=67.21 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.3 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTAGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCAACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=27 prefix-density=0.67 prefix-fanout=2.1 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=85.36 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170691 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:48:33 Started mapping on | Feb 13 16:48:33 Finished on | Feb 13 16:50:21 Mapping speed, Million of reads per hour | 402.55 Number of input reads | 12076496 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11028926 Uniquely mapped reads % | 91.33% Average mapped length | 294.64 Number of splices: Total | 10594109 Number of splices: Annotated (sjdb) | 10331323 Number of splices: GT/AG | 10384641 Number of splices: GC/AG | 160953 Number of splices: AT/AC | 7412 Number of splices: Non-canonical | 41103 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346948 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 27665 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.52% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 711519 711519 711519 N_multimapping 346948 346948 346948 N_noFeature 399127 10822708 461052 N_ambiguous 242051 923 97324 UnstrandedReadsAssigned:10387748 PositiveStrandReadsAssigned:205295 NegativeStrandReadsAssigned:10470550 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170691 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170691-trimmed-pair1.fastq SRR7170691-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,076,496 reads, 10,408,285 reads pseudoaligned [quant] estimated average fragment length: 266.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR7170691.ke.tsv 34699 SRR7170691.se.tsv 87100 total ==> SRR7170691.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.26 852 39.5226 Potri.005G024800.1.v4.1 1035 769.26 209 22.084 Potri.004G059700.1.v4.1 961 695.367 3 0.350681 Potri.007G009000.2.v4.1 1416 1150.26 0 0 Potri.003G141000.2.v4.1 2943 2677.26 607.418 18.4417 Potri.016G087400.1.v4.1 270 74.8708 732 794.7 Potri.015G069301.1.v4.1 564 306.53 0 0 Potri.010G195200.1.v4.1 1773 1507.26 216 11.6485 Potri.012G127500.1.v4.1 977 711.298 137 15.6557 ==> SRR7170691.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 366 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 89 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR7170691 completed mapping pipeline successfully